ID: 1149332967

View in Genome Browser
Species Human (GRCh38)
Location 17:55605625-55605647
Sequence GAGAATCCCTGAGGCCTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149332967_1149332971 -10 Left 1149332967 17:55605625-55605647 CCCAACAGGCCTCAGGGATTCTC No data
Right 1149332971 17:55605638-55605660 AGGGATTCTCAGAAATACTTGGG No data
1149332967_1149332973 -6 Left 1149332967 17:55605625-55605647 CCCAACAGGCCTCAGGGATTCTC No data
Right 1149332973 17:55605642-55605664 ATTCTCAGAAATACTTGGGGTGG No data
1149332967_1149332972 -9 Left 1149332967 17:55605625-55605647 CCCAACAGGCCTCAGGGATTCTC No data
Right 1149332972 17:55605639-55605661 GGGATTCTCAGAAATACTTGGGG No data
1149332967_1149332975 -4 Left 1149332967 17:55605625-55605647 CCCAACAGGCCTCAGGGATTCTC No data
Right 1149332975 17:55605644-55605666 TCTCAGAAATACTTGGGGTGGGG No data
1149332967_1149332974 -5 Left 1149332967 17:55605625-55605647 CCCAACAGGCCTCAGGGATTCTC No data
Right 1149332974 17:55605643-55605665 TTCTCAGAAATACTTGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149332967 Original CRISPR GAGAATCCCTGAGGCCTGTT GGG (reversed) Intergenic
No off target data available for this crispr