ID: 1149337551

View in Genome Browser
Species Human (GRCh38)
Location 17:55651956-55651978
Sequence AGGTTCTGACAGATTGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149337546_1149337551 30 Left 1149337546 17:55651903-55651925 CCAAAGAACCTAAAAGGAAACCA No data
Right 1149337551 17:55651956-55651978 AGGTTCTGACAGATTGAGAAAGG No data
1149337550_1149337551 -6 Left 1149337550 17:55651939-55651961 CCATTAAAACAATATTAAGGTTC No data
Right 1149337551 17:55651956-55651978 AGGTTCTGACAGATTGAGAAAGG No data
1149337548_1149337551 10 Left 1149337548 17:55651923-55651945 CCAAGCATAAAAAGTGCCATTAA No data
Right 1149337551 17:55651956-55651978 AGGTTCTGACAGATTGAGAAAGG No data
1149337547_1149337551 22 Left 1149337547 17:55651911-55651933 CCTAAAAGGAAACCAAGCATAAA No data
Right 1149337551 17:55651956-55651978 AGGTTCTGACAGATTGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149337551 Original CRISPR AGGTTCTGACAGATTGAGAA AGG Intergenic
No off target data available for this crispr