ID: 1149340794

View in Genome Browser
Species Human (GRCh38)
Location 17:55684150-55684172
Sequence CATTAGCTGGAGCAATTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149340794_1149340797 13 Left 1149340794 17:55684150-55684172 CCTCCAAATTGCTCCAGCTAATG No data
Right 1149340797 17:55684186-55684208 TCAACCAGAGTCTTACTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149340794 Original CRISPR CATTAGCTGGAGCAATTTGG AGG (reversed) Intergenic
No off target data available for this crispr