ID: 1149342307

View in Genome Browser
Species Human (GRCh38)
Location 17:55699459-55699481
Sequence AAGCCAACTCCCACCACCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149342305_1149342307 11 Left 1149342305 17:55699425-55699447 CCAGGAATGCTGCTGCTAACTGG No data
Right 1149342307 17:55699459-55699481 AAGCCAACTCCCACCACCCTAGG No data
1149342304_1149342307 19 Left 1149342304 17:55699417-55699439 CCACTTTTCCAGGAATGCTGCTG No data
Right 1149342307 17:55699459-55699481 AAGCCAACTCCCACCACCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149342307 Original CRISPR AAGCCAACTCCCACCACCCT AGG Intergenic
No off target data available for this crispr