ID: 1149347236

View in Genome Browser
Species Human (GRCh38)
Location 17:55751112-55751134
Sequence GGCCGCCGGAAGCTTCTCGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 47}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149347232_1149347236 0 Left 1149347232 17:55751089-55751111 CCGGACTGCGGAAGGATGGAGCT 0: 1
1: 0
2: 0
3: 1
4: 103
Right 1149347236 17:55751112-55751134 GGCCGCCGGAAGCTTCTCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 47
1149347225_1149347236 18 Left 1149347225 17:55751071-55751093 CCCTCCAGGCGGAGGAGCCCGGA 0: 1
1: 0
2: 0
3: 13
4: 129
Right 1149347236 17:55751112-55751134 GGCCGCCGGAAGCTTCTCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 47
1149347221_1149347236 28 Left 1149347221 17:55751061-55751083 CCGCGGCCTGCCCTCCAGGCGGA 0: 1
1: 0
2: 1
3: 15
4: 224
Right 1149347236 17:55751112-55751134 GGCCGCCGGAAGCTTCTCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 47
1149347223_1149347236 22 Left 1149347223 17:55751067-55751089 CCTGCCCTCCAGGCGGAGGAGCC 0: 1
1: 0
2: 4
3: 43
4: 305
Right 1149347236 17:55751112-55751134 GGCCGCCGGAAGCTTCTCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 47
1149347226_1149347236 17 Left 1149347226 17:55751072-55751094 CCTCCAGGCGGAGGAGCCCGGAC 0: 1
1: 0
2: 1
3: 15
4: 154
Right 1149347236 17:55751112-55751134 GGCCGCCGGAAGCTTCTCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 47
1149347227_1149347236 14 Left 1149347227 17:55751075-55751097 CCAGGCGGAGGAGCCCGGACTGC 0: 1
1: 1
2: 1
3: 11
4: 151
Right 1149347236 17:55751112-55751134 GGCCGCCGGAAGCTTCTCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 47
1149347231_1149347236 1 Left 1149347231 17:55751088-55751110 CCCGGACTGCGGAAGGATGGAGC 0: 1
1: 0
2: 0
3: 11
4: 141
Right 1149347236 17:55751112-55751134 GGCCGCCGGAAGCTTCTCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149347236 Original CRISPR GGCCGCCGGAAGCTTCTCGG AGG Exonic
900105599 1:979562-979584 GGCCCCCGGATGCTGCTCTGGGG - Exonic
1063560094 10:7118218-7118240 GGCCATCGAAAGCTTCTCAGAGG + Intergenic
1065636989 10:27743465-27743487 GGCCGCCGGGAGCTCCGCAGCGG + Exonic
1067806861 10:49398413-49398435 GGCGGCCGGACTCTCCTCGGGGG - Intergenic
1069942432 10:71964667-71964689 GGCCGCCGGTGGAGTCTCGGCGG + Exonic
1074863984 10:117534697-117534719 GGCCGCCAGCAGCTTGCCGGGGG - Intergenic
1077421091 11:2450369-2450391 GGCTTCTGGAAGCTTCTCTGCGG - Intronic
1084100488 11:66944884-66944906 GGCCCCAGGAAGCTTGTAGGTGG - Intronic
1097280785 12:57844787-57844809 GGAGGCCGGAGCCTTCTCGGGGG + Intronic
1104062990 12:125283664-125283686 AGCTGCCGGAAGCTACTCGGAGG - Intronic
1122317402 14:100834374-100834396 GGCCCCCGGCAGGTTCTCTGGGG + Intergenic
1125424665 15:39536837-39536859 GGCTTCCAGAAGCTTCTCTGAGG - Intergenic
1129300825 15:74624506-74624528 CGCCGCAGGAGGGTTCTCGGTGG + Intronic
1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG + Intronic
1133340709 16:5033839-5033861 GGCCGCCGGACGCTTCCCAGAGG + Exonic
1138351711 16:56349469-56349491 GGCAGCCGGAGGCTTCTGGGAGG - Intronic
1149347236 17:55751112-55751134 GGCCGCCGGAAGCTTCTCGGAGG + Exonic
1152039710 17:77894817-77894839 GGCCTCCGCAAGCCTCTCTGGGG + Intergenic
1153586629 18:6627860-6627882 GGCAGCTGGAAGCTTCTGGAAGG - Intergenic
1153872707 18:9335011-9335033 GGCCGCGGCGAGCTTCGCGGGGG + Intronic
1160865847 19:1255617-1255639 GGCAGCCGTGAGCTTCTCGCAGG - Exonic
1161277782 19:3428540-3428562 GGAGGCTGGAAGGTTCTCGGAGG + Intronic
1163234803 19:16023972-16023994 GGCCTCCAGAAGCTTCTTAGAGG - Intergenic
1165191389 19:34066667-34066689 GGCCTCAGGAAGCTTCATGGTGG - Intergenic
1165740565 19:38202821-38202843 GCCCTCAGGAAGCTTCACGGGGG + Intronic
934575982 2:95401939-95401961 GACCGCTGGAAGGTTCTCAGTGG - Intergenic
936118852 2:109724730-109724752 GGCTTCCTGAAGCTTCTGGGAGG - Intergenic
943787271 2:191891870-191891892 GACTGCCGCATGCTTCTCGGAGG + Intergenic
1173251642 20:41366780-41366802 GGCCGCCTGGCGCTTCGCGGCGG + Exonic
1173373085 20:42457724-42457746 GGCAGCAGGAAGATTCTCCGTGG + Intronic
1175681980 20:60995637-60995659 GGCTGGCGGAAGCCTCACGGTGG + Intergenic
1177759607 21:25388547-25388569 GGCTGCCTGAAGCTTCTCTGTGG + Intergenic
1180980774 22:19877050-19877072 GCCCGCCGCCAGCTCCTCGGAGG - Exonic
949887352 3:8706829-8706851 GGCTGCTGGAAGTTTCTAGGAGG + Intronic
950493013 3:13317659-13317681 GGCCGCGTGAAGGTTCCCGGAGG - Exonic
964356293 3:155854564-155854586 GGCTGCCGGAACCTTCGGGGAGG + Intergenic
973634525 4:52849468-52849490 GGCTGTAGGAAGCTTCTTGGAGG - Intergenic
985875649 5:2591905-2591927 GGCTGCCGGCAGCTGCTCAGAGG - Intergenic
990308734 5:54518295-54518317 GGCGGCTGGAAGGTGCTCGGAGG - Exonic
1010671346 6:78690287-78690309 GGCTGCCTGAAGCTTGTAGGAGG - Intergenic
1023703021 7:42911671-42911693 GGCCGGCGGGGCCTTCTCGGTGG + Intronic
1029715137 7:102321560-102321582 GGCCTCCGGGGGCTCCTCGGCGG - Exonic
1031052075 7:116954178-116954200 GGCTGCCGGAGGGTGCTCGGCGG + Intronic
1034508829 7:151518830-151518852 GGCCGCCAGCAGCATCTCGAGGG + Intronic
1034939192 7:155219302-155219324 GGTCGCCTGAACCTTCTCCGGGG - Intergenic
1036561149 8:9901494-9901516 GGCCGCTGGATGCTTCTCTTAGG - Intergenic
1050381960 9:5040904-5040926 GGCTGCCGGCAGCGTCTGGGTGG - Intronic
1051366230 9:16323333-16323355 AGCCTCTGGAAGCTTCTCCGTGG - Intergenic
1057054340 9:91949597-91949619 GGCGGCTGGGAGCCTCTCGGTGG - Intronic
1059219669 9:112602699-112602721 GGCCGCTGGAAGCTTCTCCCAGG - Intronic
1203791544 EBV:154300-154322 GGCCGCCAGCAGCTTCTTGATGG + Intergenic
1190333304 X:49248628-49248650 GGCAGCTGGAATCTTCTCGACGG + Exonic
1199980581 X:152918385-152918407 GACCGCAGGAAGCTTGTAGGAGG + Intronic