ID: 1149348396

View in Genome Browser
Species Human (GRCh38)
Location 17:55762263-55762285
Sequence ATTTTGTTCTGGTTGATCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 3, 2: 8, 3: 41, 4: 271}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149348391_1149348396 19 Left 1149348391 17:55762221-55762243 CCTGGAGGAAGGAGAAAAGTTCA 0: 1
1: 0
2: 2
3: 32
4: 375
Right 1149348396 17:55762263-55762285 ATTTTGTTCTGGTTGATCAGTGG 0: 1
1: 3
2: 8
3: 41
4: 271
1149348394_1149348396 -5 Left 1149348394 17:55762245-55762267 CCAGTTGGGTTAACAAGCATTTT 0: 1
1: 0
2: 4
3: 6
4: 128
Right 1149348396 17:55762263-55762285 ATTTTGTTCTGGTTGATCAGTGG 0: 1
1: 3
2: 8
3: 41
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149348396 Original CRISPR ATTTTGTTCTGGTTGATCAG TGG Intronic
906084876 1:43123096-43123118 CTTTTGCTCTGGAAGATCAGAGG + Intergenic
906445953 1:45898233-45898255 CTGTTTTTCTGGTTGATCTGAGG - Intronic
908079975 1:60566493-60566515 ATTTTGTCCAGGTTGGTGAGTGG - Intergenic
908448483 1:64225601-64225623 AGGTTATTTTGGTTGATCAGGGG + Intronic
908712831 1:67036823-67036845 ACTTTGTTCTGGTAGTTCTGTGG + Intronic
909299786 1:73997811-73997833 ATTTTGTTCTCATTGATCCGTGG - Intergenic
910880670 1:91919808-91919830 TTGTTTTTCTGGTTGATCTGAGG - Intergenic
911119651 1:94282724-94282746 GTTTTCTTCTGGATGATGAGAGG + Intergenic
911259794 1:95672089-95672111 ATTTTGTTCCTGGTTATCAGAGG + Intergenic
911289922 1:96045073-96045095 GCTTTGTTCTGATTGGTCAGTGG - Intergenic
912314682 1:108657086-108657108 ATTTTCTTCCCATTGATCAGTGG - Intronic
912866100 1:113257989-113258011 TTTTAGTTAAGGTTGATCAGTGG + Intergenic
913026070 1:114841953-114841975 ATTTTGTTTTGATTGATCAGTGG + Intergenic
915045484 1:153010654-153010676 TTTTTGTTCTGGTTGATCTTGGG + Intergenic
915214977 1:154334184-154334206 AGCATGTTCTGGTTGCTCAGAGG - Exonic
915959380 1:160252300-160252322 ATGCTGTTGTGGTTGAACAGAGG + Intronic
916642308 1:166743615-166743637 ATTTTCTTCTTGTTCCTCAGTGG + Intergenic
916956797 1:169845938-169845960 ACTTTGTCCAGGTTCATCAGAGG + Intronic
917050585 1:170917789-170917811 AGTTTGGGCTGGTTGATCAGGGG + Intergenic
920414692 1:205791095-205791117 TTTTGGTTTTGGTTGAACAGAGG - Exonic
920620018 1:207536126-207536148 ATTTTGTTCAGATCCATCAGAGG - Intronic
920621800 1:207554681-207554703 ATTTTGTTCAGATCCATCAGAGG - Intronic
920623425 1:207571776-207571798 ATTTTGTTCAGATCCATCAGAGG - Intronic
921279797 1:213555232-213555254 AGTTTGTTCTGATTCTTCAGTGG - Intergenic
922608077 1:226903447-226903469 ATTTTATTCCGATTAATCAGTGG - Intronic
923477401 1:234347010-234347032 CTTTTGTTCTGTGTGACCAGTGG + Intergenic
924071041 1:240279024-240279046 ATTTTGTTCTAGTTGGGCAGTGG + Intronic
924814378 1:247429253-247429275 GTTCTGTGCTGGGTGATCAGAGG - Intronic
1062830442 10:601918-601940 GTTTTGTTCTGATTGATCAGTGG + Intronic
1066076211 10:31880185-31880207 ATTTTGTTCTTTTCGATCAGTGG + Intronic
1067390419 10:45858094-45858116 ATTGTGGTGTGGTTGATCAGAGG - Intergenic
1067482250 10:46609860-46609882 ATTATGTTCTGGTTGATGTAGGG + Intergenic
1067501044 10:46805726-46805748 ATTGTGGTGTGGTCGATCAGAGG + Intergenic
1067593537 10:47534189-47534211 ATTGTGGTGTGGTCGATCAGAGG - Intronic
1067612499 10:47731808-47731830 ATTATGTTCTGGTTGATGTAGGG - Intergenic
1067640646 10:48042293-48042315 ATTGTGGTGTGGTCGATCAGAGG - Intergenic
1067872857 10:49977973-49977995 ATTGTGGTGTGGTTGATCAGAGG + Intergenic
1068254694 10:54494430-54494452 ATTTTGTTCCAGTTAATCAGTGG - Intronic
1068599959 10:58946429-58946451 ATTTTGTTCTGGAGGCTCGGCGG + Intergenic
1069088760 10:64174026-64174048 ATTTTTATCTGCTTGGTCAGAGG + Intergenic
1070017962 10:72553572-72553594 TTTTTGTTGTTGTTGTTCAGAGG - Intronic
1070137608 10:73708322-73708344 ATTGTGGTGTGGTCGATCAGAGG - Intergenic
1071627920 10:87192055-87192077 ATTATGTTCTGGTTGATGTAGGG - Intergenic
1071873956 10:89823707-89823729 CTTCTGTTCTGGCTGCTCAGAGG + Intergenic
1072338625 10:94423732-94423754 ATTTTTCTCTGTTTTATCAGTGG + Intronic
1072938792 10:99739726-99739748 ATTATGTTCTGGTTTATCAGAGG + Exonic
1073824111 10:107300703-107300725 ATTTTGTTGTGGTGGTTGAGGGG - Intergenic
1073923923 10:108491785-108491807 TTTTTGTTCTAGTAGATCATGGG - Intergenic
1075987349 10:126799331-126799353 TTTTTGTCCAGGTTGGTCAGTGG - Intergenic
1076369744 10:129944527-129944549 ATTTCCTTCTGCTGGATCAGTGG - Intronic
1078638108 11:13070772-13070794 ATTTTGCTCAGATTCATCAGAGG - Intergenic
1079010405 11:16823347-16823369 ATTTTGATGTAGTTGATCTGGGG - Intronic
1079421474 11:20293886-20293908 ATTTTGTTCTGATTTAGGAGTGG - Intergenic
1080149676 11:29036269-29036291 ATGGGGTTCTGGGTGATCAGGGG - Intergenic
1083159134 11:60843893-60843915 AGTTTCTTCTGTTTCATCAGGGG - Intronic
1085170244 11:74443612-74443634 ATTTCGTTTTGGTTTATCTGTGG + Intergenic
1086007507 11:82055271-82055293 ATTTTGTTTAGGTCCATCAGAGG - Intergenic
1086435528 11:86776441-86776463 AATTTGATCTGGTTTATCTGTGG - Intergenic
1086738988 11:90343439-90343461 CTTTTGTCCTGGTTGATAAGTGG + Intergenic
1087439754 11:98168103-98168125 ATCTTGTTCTAGTTCTTCAGAGG - Intergenic
1089157361 11:116412795-116412817 ATTTTGTTCTTATTAGTCAGTGG - Intergenic
1089192724 11:116665489-116665511 ATCTTGTTAGGGTTGATCACTGG - Intergenic
1091073497 11:132591745-132591767 ATTATTTTGTGGTTTATCAGAGG + Intronic
1092609465 12:10155783-10155805 ATTTTGTTCTGGTTTTTTAGAGG - Intergenic
1092954444 12:13536913-13536935 ATTTTTTCCTGGTTGACCAGTGG - Intergenic
1096439831 12:51631636-51631658 ATTTTATTTTGTTTGATCAAGGG - Intronic
1096571852 12:52527924-52527946 ACTTTGTTCAGGATGAGCAGAGG + Intergenic
1098184247 12:67879343-67879365 ATCTTTTTCTGGTTGATCTGGGG + Intergenic
1098729293 12:74012310-74012332 ATTTTGTTGTTGTTGTTAAGAGG + Intergenic
1098734279 12:74079161-74079183 CTTTTGTGATGGCTGATCAGAGG + Intergenic
1098908507 12:76185919-76185941 ATTTTACTCTGGTTTATCACAGG - Intergenic
1099843403 12:87996485-87996507 CTTTTCTTATGGTTGATTAGGGG - Exonic
1100267330 12:92990085-92990107 ATTTTGTTCTGATTGATCAGTGG + Intergenic
1101300512 12:103475212-103475234 ACTTTGTTGTGTTTGCTCAGAGG - Intronic
1104671777 12:130685858-130685880 ATTTTGTTCTGGTCCACCAGCGG - Intronic
1105350373 13:19609705-19609727 ATTTGGTTTTTGTTGTTCAGTGG + Intergenic
1105381039 13:19887614-19887636 TTTTTGATCTGGTTACTCAGTGG + Intergenic
1106305672 13:28506982-28507004 ATATTGTTCAGGTTGATGGGAGG - Intergenic
1107009022 13:35649208-35649230 ATTTCTATCTGGTTGATCTGGGG - Intronic
1107136053 13:36945180-36945202 ATGACGTTCTGGGTGATCAGGGG + Intergenic
1108135750 13:47356414-47356436 TTGTTGTTCTTGTTGTTCAGAGG + Intergenic
1110043338 13:70794754-70794776 TTTTTGTTGTTGTTGTTCAGAGG - Intergenic
1110709184 13:78631259-78631281 ACTTTGTTCTGTTTGAGCAAGGG - Intronic
1111571644 13:90095534-90095556 ATTTTGTTCAGATCCATCAGAGG + Intergenic
1111593662 13:90383189-90383211 ATTTTGTTTTGTTTTCTCAGTGG + Intergenic
1112606388 13:100910668-100910690 ATCTTATTTTGATTGATCAGTGG + Intergenic
1115150188 14:30275946-30275968 ATTTTGTTGTGGTTTGTCTGTGG + Intergenic
1115208339 14:30938302-30938324 ATTTTGTTGTGGTAGATTTGTGG - Intronic
1116284215 14:42951067-42951089 TTTTTGTTGTTGTTGTTCAGGGG + Intergenic
1119135376 14:72213468-72213490 ATTTTGTCCAGATTGATCACAGG - Intronic
1119462688 14:74821657-74821679 ATTTTGCTCAGGCTGATTAGAGG + Intronic
1121293905 14:92800695-92800717 ATTTTGTTGTTGTTGTTCTGTGG + Intronic
1123986030 15:25647127-25647149 ATTTTGTTCTGCTTAATTTGAGG + Intergenic
1124035799 15:26052757-26052779 ATGTTGTTCCGATTGACCAGTGG - Intergenic
1125756348 15:42068178-42068200 ATTTTATTCTTTTTGATAAGTGG - Exonic
1127822423 15:62670322-62670344 CTTTTGTTCTGGGAGGTCAGAGG + Intronic
1128912237 15:71526159-71526181 ATTTTGTTCTGATTGATTGCCGG + Intronic
1130707776 15:86249401-86249423 ATTTTGTTATTGTTTAGCAGGGG - Intronic
1131845881 15:96490385-96490407 ATTTTTTTATGGGTGTTCAGTGG + Intergenic
1131888075 15:96941364-96941386 TTTTTTTTCTGGTTGTTCTGTGG + Intergenic
1134839310 16:17388921-17388943 ATGTTGTTCTGATTGATCAGTGG + Intronic
1140339122 16:74139862-74139884 ATTTGGCTGGGGTTGATCAGAGG - Intergenic
1141304596 16:82850139-82850161 ATTTTGTCCTGATCCATCAGAGG - Intronic
1142028224 16:87825597-87825619 ATTTTGTTCTGATGGATCTGTGG - Intergenic
1142998302 17:3774341-3774363 ATTTTTTTCTGGGTGGTCATAGG - Intronic
1146089761 17:29864870-29864892 ATTTTTATTTGGTAGATCAGGGG - Intronic
1148069500 17:44899759-44899781 CTCCTGTTCTGGTTTATCAGGGG + Exonic
1149005555 17:51801685-51801707 ATTTTGTTCTGGATGATTCCAGG + Intronic
1149348396 17:55762263-55762285 ATTTTGTTCTGGTTGATCAGTGG + Intronic
1154066692 18:11113341-11113363 ATTTTGTCCAGGTTGGTCAATGG - Intronic
1155241030 18:23863742-23863764 ATTTTGTTCTGTCTAATCAGAGG + Intronic
1156907367 18:42370037-42370059 ATTTTGAGGTGGTTGTTCAGAGG - Intergenic
1158782828 18:60671317-60671339 TTTTTGCTCAAGTTGATCAGTGG - Intergenic
1158920991 18:62190677-62190699 ATTCTGTTCTAAGTGATCAGTGG - Intronic
1161893699 19:7063921-7063943 ATTTTGTTGTTGTTGAGAAGGGG + Intergenic
1162593612 19:11610017-11610039 ATTTTGTTTTTGTTGAAAAGTGG + Intronic
1163257939 19:16168834-16168856 ATTTTTTTGTTGTTGTTCAGGGG + Intronic
1164649325 19:29880699-29880721 ATTTTGTTATGGTTGTTTATTGG + Intergenic
1164812396 19:31167665-31167687 ATTTTTTTCTGTTTGCTCAGTGG + Intergenic
1166586656 19:43954877-43954899 CTATTTTTCTGGTTGATCTGGGG - Intronic
928644057 2:33333266-33333288 ATTTTGTTCTTTTTAATGAGTGG + Intronic
928898773 2:36295412-36295434 ATTATGTTCAGGTTCATGAGTGG + Intergenic
928915965 2:36470830-36470852 ATTTAGTTCTGATCCATCAGAGG - Intronic
931085755 2:58828984-58829006 ATTTGCTTCTGGTTGTTCTGTGG + Intergenic
933114359 2:78448518-78448540 ATTTTGATCTCTTTGAGCAGTGG - Intergenic
933276721 2:80291889-80291911 ACTTTGTTCTGGTTCTTTAGTGG - Intronic
933405069 2:81847573-81847595 ATTTTGTTTAGATTGATCAGTGG - Intergenic
933530909 2:83510598-83510620 ATTTTGTTTTTATTGATCAGTGG - Intergenic
933582332 2:84141879-84141901 GTTTTGTACTGATTGATCAGAGG - Intergenic
934556946 2:95292449-95292471 ATTATCATCTGGTTGAGCAGAGG + Intergenic
934575780 2:95400431-95400453 CTTTTGTTCTTATTGATCTGTGG + Intergenic
934637962 2:96008314-96008336 ATTTTGTTCTTATTGATCTGTGG + Intergenic
934795692 2:97097103-97097125 ATTTTGTTCTTATTGATCTGTGG - Intergenic
936393306 2:112096191-112096213 GTTTTGTTCAGATCGATCAGTGG - Intronic
936641770 2:114320847-114320869 ATTTTGTTTTGTTTTATAAGGGG - Intergenic
936869406 2:117116666-117116688 ATTTTTTTGTTGTTGATCACAGG - Intergenic
937892834 2:126952506-126952528 ATTTTGTTCTGATTGAACAGTGG - Intergenic
937937143 2:127255445-127255467 ATTTTGTTCCCATTGATCACTGG + Intergenic
940168699 2:150803450-150803472 AGTTTGGTCAGGTTTATCAGAGG + Intergenic
941418536 2:165252951-165252973 ATTTTGTTCCCATTGGTCAGTGG + Intronic
943485077 2:188469160-188469182 ATTTTGTCCAGTTTGGTCAGTGG + Intronic
944176514 2:196834518-196834540 ATTTTGGTCTGGTTTCTCATGGG + Exonic
944348246 2:198695046-198695068 ATTTTTTTCTTTTTAATCAGAGG + Intergenic
944631803 2:201634386-201634408 ATTTTGTTCAGGATGACCAATGG - Intronic
945242784 2:207691716-207691738 AATTTGGTTTAGTTGATCAGAGG - Intergenic
946266517 2:218547370-218547392 ATTCTATTCTAGTTGATCTGCGG + Intronic
947997731 2:234543073-234543095 ATTTTTTTCAGGTCTATCAGTGG + Intergenic
948151398 2:235747538-235747560 TTTTCGTTCTGGTTCATCTGGGG - Intronic
1171209740 20:23308159-23308181 ATTTTGTTCCAATTGATCAGTGG - Intergenic
1171520166 20:25769702-25769724 ATTTTGTTTTGTTTAAGCAGTGG + Intronic
1171556753 20:26086791-26086813 ATTTTGTTTTGTTTAAGCAGTGG - Intergenic
1175357317 20:58378825-58378847 TGTGTGTTCTGGTTGATCAGAGG + Intergenic
1175676841 20:60953434-60953456 ACTTTGTTCTGATTGACCAGTGG - Intergenic
1176136962 20:63527748-63527770 TTCTTGTTCTGGTTGATCCTGGG + Intergenic
1176225366 20:63995124-63995146 ATTTAGTCCTGTTAGATCAGTGG + Intronic
1176654298 21:9575988-9576010 ATTTTGTTTTGTTTAAGCAGTGG + Intergenic
1177334179 21:19701932-19701954 GTTTTGTTCAGATTGTTCAGGGG + Intergenic
1177596560 21:23250852-23250874 ATTTTGTTTTGATTAATCAGTGG + Intergenic
1178150558 21:29789303-29789325 ATTTTGTTCTGATTGGTCAGTGG - Intronic
1178157766 21:29874472-29874494 ATTTTGTTCTGATTGGTCATGGG - Intronic
1179058738 21:37959950-37959972 ATTTTGTTCCATTTGATCAGTGG + Intronic
1179416513 21:41202884-41202906 ATTTTGTCCTGCCTGATCACTGG - Intronic
1179463152 21:41551192-41551214 ATTTTGTTCTGATTGATCAGTGG + Intergenic
1180966622 22:19791843-19791865 GTTTTGTTCTGGTAGATCTAGGG - Intronic
1182627838 22:31661281-31661303 ATTTTGTCAGCGTTGATCAGAGG - Intronic
1183069102 22:35383954-35383976 AGCTTGTTCAGGTTGAACAGAGG + Intronic
1183657301 22:39194878-39194900 ATTTTATTTTGGTTTATCAGTGG - Intergenic
1184908896 22:47512413-47512435 ACTTTGTTCTGACTGATCAGTGG + Intergenic
1184944227 22:47790695-47790717 ATTTTGTTCTGTTTGTTTTGGGG - Intergenic
949225531 3:1689563-1689585 ACTTGCTTCTGGTTGATAAGAGG - Intergenic
951149677 3:19274253-19274275 ATGTTGATCAGGTTGATCAGTGG + Intronic
951652458 3:24965822-24965844 ATTTTTTTCTGGAGGGTCAGGGG - Intergenic
951835610 3:26980185-26980207 ATTTTGTTCTGATTGATCAGTGG + Intergenic
953589148 3:44234934-44234956 ATTTTGTTCCAATTGGTCAGTGG - Intergenic
953619248 3:44518635-44518657 ATTTTGTTCCACTTGATCAGTGG + Intergenic
953735286 3:45488934-45488956 ATTTTGTTCTGATAGATATGAGG - Intronic
954466178 3:50656338-50656360 ATTCTGTCCTGGGTGGTCAGTGG - Intergenic
955581747 3:60430473-60430495 ATTTTGTTCTGGTTCATTGTGGG + Intronic
958516853 3:95127284-95127306 ATTTGGTTCTAATTGATTAGTGG - Intergenic
958729828 3:97949809-97949831 GTTTTCTTCTGGGTGGTCAGAGG - Intronic
959468045 3:106714364-106714386 ATGTGGTTCTGGGTGGTCAGGGG + Intergenic
960415598 3:117381576-117381598 ATTTTGTTTCTGTTGATAAGAGG + Intergenic
960432823 3:117590639-117590661 ATTTTCTTATGGTTAAACAGAGG + Intergenic
962326884 3:134441775-134441797 CTGTTTTTCTGGTTGATCTGGGG - Intergenic
962504394 3:136031139-136031161 ATTTTGTTTTGTTTTTTCAGGGG + Intronic
962545303 3:136428428-136428450 ACTGGGTTCTGGTTGGTCAGGGG - Intronic
964171386 3:153774442-153774464 ATTGTGTTTTAGTTGCTCAGTGG + Intergenic
964624127 3:158742701-158742723 ATTTTTTTCTGGTTTACCTGGGG + Intronic
965718733 3:171637213-171637235 ATATTGATCTGATTGATCTGTGG + Intronic
966213013 3:177471933-177471955 ATTTTGTTCTGGGTCATCTCAGG + Intergenic
966439482 3:179928070-179928092 TTTATGTTAAGGTTGATCAGTGG + Intronic
966898535 3:184463884-184463906 TTTTTATTCTGGCTGGTCAGTGG - Intronic
968334977 3:197905706-197905728 ATTTTGTTCTTGTTGCCCAGTGG - Intronic
970304590 4:14718439-14718461 AAGTTGTTCTGGTTGTTGAGGGG - Intergenic
970931675 4:21519010-21519032 ATTTTCTTCGGTTTGCTCAGTGG - Intronic
972223918 4:36989726-36989748 ATAATGCTCAGGTTGATCAGTGG - Intergenic
972827788 4:42781016-42781038 ATTTTGTTTTGAATGAGCAGTGG + Intergenic
974745663 4:66072079-66072101 GTTTTGTTCTGGTTCTTAAGGGG + Intergenic
974934694 4:68398371-68398393 TTGTTTTTCTGGTTGATCTGGGG + Intergenic
976557693 4:86468014-86468036 ATTTTGTTCTGGCCGACCGGCGG - Intronic
976855730 4:89603473-89603495 AAAATGTTCTGGTTGATCATTGG + Intergenic
978260458 4:106751078-106751100 ACTTTGCTCTGATTCATCAGAGG + Intergenic
979208248 4:118068599-118068621 TTTTTGTCTTGGTAGATCAGGGG + Intronic
981633835 4:146852227-146852249 ATTTTGTTATTCTTGTTCAGTGG - Intronic
982235177 4:153245431-153245453 ATTTTGTTAGGCTTGAGCAGGGG + Intronic
983106057 4:163687530-163687552 ATTTTTTTCTGGTAGATTAAAGG + Intronic
983822774 4:172216959-172216981 AACTTGTTCTGGTTGATAATTGG + Intronic
985383437 4:189420046-189420068 CTGTTGATCTGTTTGATCAGGGG + Intergenic
986660482 5:10055580-10055602 ATTTTGTCCTGGATGATTGGTGG - Intergenic
987399614 5:17462110-17462132 ATTTTGTTGTGTTTGTGCAGTGG + Intergenic
987674569 5:21058931-21058953 ATTTATTTCTGTGTGATCAGTGG + Intergenic
988174868 5:27709144-27709166 AGTTGGTTTTGGTTGATCATTGG + Intergenic
988847256 5:35140744-35140766 TTTCTGTTCTGATTGGTCAGTGG + Intronic
991325268 5:65424815-65424837 ATGTTGTTTTCCTTGATCAGTGG + Intronic
991966805 5:72100290-72100312 ATTTTCTTTTGGTGGAACAGTGG - Intergenic
992284411 5:75219061-75219083 ATTTTGTTCTGGTTTTCAAGGGG - Intronic
993467551 5:88267834-88267856 ATTTTGTTCCGATTGATCTGTGG - Intronic
993666171 5:90699235-90699257 ATTTTATTCTGTTTTATAAGAGG + Intronic
993994437 5:94704923-94704945 ATTATGTTCTTTTTGATAAGTGG + Intronic
994343193 5:98655952-98655974 ATTTTGAGCTGAATGATCAGAGG - Intergenic
994533506 5:100997210-100997232 ATGTTGTTCTTTTTGATCATTGG - Intergenic
994543409 5:101129888-101129910 AGTTGGTTCTGGCTGATGAGTGG - Intergenic
995698257 5:114904354-114904376 ATTGTGCTTTGGTTGTTCAGAGG + Intergenic
998641671 5:144018618-144018640 ATTTTGTTCTCTTTGCCCAGGGG - Intergenic
999804210 5:155066959-155066981 ACTCTGTTATGGTTGATCAGTGG + Intergenic
1000447369 5:161339105-161339127 ATTTTGAACTGGTTTATCAAAGG - Intronic
1001183402 5:169542432-169542454 ATTTTGTCCAGATTCATCAGAGG - Intergenic
1002392056 5:178921847-178921869 TTTCTGTTCGGGTTTATCAGTGG + Intronic
1002490366 5:179571925-179571947 TTTTTTTTCTGGTTTCTCAGTGG + Intronic
1002823169 6:747759-747781 ATATTGTTCTGCTTGCTAAGGGG - Intergenic
1004713408 6:18193695-18193717 ATTTGGTTCTGGTGGAGCTGGGG + Intronic
1007354284 6:41300333-41300355 ATCTTGTTCTGGTTCTCCAGGGG - Intergenic
1007710392 6:43819406-43819428 CTGTTTTTCTGGTTGATCTGGGG + Intergenic
1008456712 6:51719397-51719419 ATTTTGTACTGGATGATTATCGG + Intronic
1008606060 6:53140782-53140804 ATTTTCTTCTGGTTGAAAATTGG - Intronic
1009446756 6:63751884-63751906 ATTTTGTTCTGAATGATCTTTGG + Intronic
1009919763 6:70043124-70043146 ATTTTGCCCAGGTTCATCAGAGG + Intronic
1011802111 6:91028841-91028863 ATTTTGTTGTGGTTGGTAAGAGG + Intergenic
1012534913 6:100283752-100283774 GTTTTGTTCTAGTTGAACTGAGG - Intergenic
1012840091 6:104319073-104319095 ATTGTGTTCTTGTGGTTCAGAGG + Intergenic
1013011969 6:106128882-106128904 AATTCTTTCTGGTGGATCAGAGG - Intergenic
1015577177 6:134684174-134684196 ACTTTTCTCAGGTTGATCAGTGG - Intergenic
1015590326 6:134816843-134816865 ATTTTGATTTGGAGGATCAGGGG - Intergenic
1018522689 6:164668894-164668916 ATTTTGTTCCCACTGATCAGTGG + Intergenic
1018750239 6:166798067-166798089 ATTTTGCTCTGTTTGATCTCTGG - Intronic
1022227173 7:28375197-28375219 ATTTTGTTCTGTTTGGTTATGGG + Intronic
1022354640 7:29601574-29601596 ATTTTGTTTTTCTTGGTCAGTGG + Intergenic
1022749650 7:33211213-33211235 ATTTTTTTCTGGTTGTTGTGTGG + Intronic
1022886586 7:34653026-34653048 ATTTTTTTCTGATTGATCAGTGG + Intergenic
1023241775 7:38156146-38156168 CTTATGTTCTCGTTGATAAGTGG + Intergenic
1024030332 7:45455217-45455239 ATTTTGTTCTGACTGATCAGTGG - Intergenic
1027994213 7:85403835-85403857 ATTTTGTTCTGGTTTTCAAGGGG - Intergenic
1028433664 7:90777149-90777171 GTTATGTTCTGGTAGATAAGAGG + Intronic
1030635673 7:111945732-111945754 ATGTCGTTCCGGTTTATCAGGGG + Exonic
1031502957 7:122544616-122544638 ATTTAGTTCTGCTTTACCAGTGG + Intronic
1032625021 7:133582202-133582224 ATTATGTTCTTGCTTATCAGTGG - Intronic
1032977423 7:137241795-137241817 ATTCTGTTCCTCTTGATCAGAGG - Intronic
1033188472 7:139252753-139252775 TTTTTGTTCTGTTTGAGCAAGGG - Intronic
1035081905 7:156223136-156223158 ATTACTTTGTGGTTGATCAGCGG - Intergenic
1035189151 7:157150411-157150433 AATTTGTTCTGCTGGATTAGAGG - Intronic
1035281425 7:157780841-157780863 ATTCTGTCCTGATTGATCTGTGG - Intronic
1035998094 8:4572225-4572247 ATTTTGGTATGTTTGAGCAGTGG + Intronic
1036087283 8:5626283-5626305 AATTTGATCTGGTTGAAAAGTGG - Intergenic
1036419263 8:8581017-8581039 TTTTTTTTTTGGTTGATCATAGG + Intergenic
1037167212 8:15845684-15845706 ATTTTGTTCTGTTTGCTCTAGGG + Intergenic
1039002765 8:32999751-32999773 TTTTTGTTCTTGTGGATAAGAGG - Intergenic
1039486351 8:37913107-37913129 ATTTTGAGATGGTTGTTCAGAGG + Intergenic
1040051648 8:43021160-43021182 ATTTTGTTCTGTGAGATGAGAGG + Exonic
1040849054 8:51879622-51879644 ATTTTGCTTTGGTTGCTCAGAGG - Intronic
1040884660 8:52248097-52248119 AATATGGTCTGGATGATCAGAGG - Intronic
1041191376 8:55358837-55358859 GTTTTGTTCTGGTTGGTCCGGGG + Intronic
1041357733 8:57019006-57019028 ATTTTGTCCATGTTCATCAGTGG - Intergenic
1041751562 8:61266358-61266380 ATTTTGTTCCAATTGATCAGTGG - Intronic
1041757921 8:61334296-61334318 ATTTCATTCTGACTGATCAGTGG + Intronic
1041833024 8:62178920-62178942 ATTTTATTCTCTTTTATCAGTGG - Intergenic
1042525726 8:69762898-69762920 ATTATTTTCTGGTTCATCTGTGG - Intronic
1042701696 8:71622413-71622435 GTTCTCTTCTGGTTGGTCAGAGG + Intergenic
1042879939 8:73476187-73476209 ATTCTGTTCTGGGTGCTCTGAGG - Intronic
1043238866 8:77905485-77905507 ATTTTGTTCCAGTAGAGCAGTGG - Intergenic
1043534764 8:81190177-81190199 AGTTTCTTCTGTTTGATCAAGGG + Intergenic
1043618482 8:82158317-82158339 ATTTGGTTCTGATTGATTATGGG + Intergenic
1043823900 8:84901809-84901831 ATTTTGTTCTCATTGACCAATGG + Intronic
1044287993 8:90431800-90431822 ACTTTGTTCAGGTCCATCAGAGG - Intergenic
1044494174 8:92857171-92857193 ATGTTGTTTTTTTTGATCAGAGG + Intergenic
1044622646 8:94205181-94205203 ATATTGTTCTGCTAGATCTGGGG - Intronic
1045391865 8:101723211-101723233 ATTTTGTGCTAGTTGAACATAGG + Intronic
1047208017 8:122819016-122819038 AGTTTGTTCTAGATGCTCAGGGG + Intronic
1047477489 8:125247694-125247716 ATTTTGCTCTTGTTGTCCAGTGG - Intronic
1048177166 8:132163291-132163313 GTTTCCTTCTGGTTGATCTGAGG - Intronic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1050584253 9:7093924-7093946 CTTTGGTTCTGGTTGAAGAGAGG + Intergenic
1051190775 9:14509706-14509728 ATTTTGTCCTGGTGCTTCAGGGG - Intergenic
1051864604 9:21665441-21665463 AGTTTGTTCTGGTTGAGAGGAGG + Intergenic
1051971938 9:22898991-22899013 ATTTTCTTCAGTTTCATCAGTGG - Intergenic
1053557826 9:39156412-39156434 ATGTTGTTCAGGTTGGTCTGAGG - Intronic
1054139288 9:61462539-61462561 ATGTTGTTCAGGTTGGTCTGAGG + Intergenic
1056007581 9:82288755-82288777 ATTATTTTCTGGTTGTTCTGTGG - Intergenic
1056089460 9:83190385-83190407 ATTTCGTTCTAGTGGATCAATGG + Intergenic
1056788423 9:89609749-89609771 ATTTTATTCTAGTTGATAAAGGG - Intergenic
1059477364 9:114558306-114558328 TTTTGTTTCTGATTGATCAGTGG - Intergenic
1059635092 9:116162483-116162505 ATTTTGCAATGGTTGATCACAGG + Intronic
1203632019 Un_KI270750v1:79446-79468 ATTTTGTTTTGTTTAAGCAGTGG + Intergenic
1186149134 X:6655679-6655701 ATTTTGTTCCCATTGATTAGTGG - Intergenic
1186395982 X:9209483-9209505 ATTTTGAGCTGGTTGTTCATTGG + Intergenic
1187785494 X:22881035-22881057 ATTTTGTTCTCATTCATAAGTGG + Intergenic
1189619561 X:42821237-42821259 ATTTTGAGATGGTTGTTCAGAGG + Intergenic
1189768574 X:44397786-44397808 ATTTTGTCCAGATTGATCAGAGG - Intergenic
1190096537 X:47485614-47485636 ATTTTGTTCCAATTGATCAGTGG + Intergenic
1191943198 X:66501842-66501864 TTTTGTTTCTGGTTGATCTGGGG + Intergenic
1192626884 X:72738205-72738227 ATTTGGTTCTGTGTGATCATAGG - Intergenic
1192898908 X:75473434-75473456 ATTATGTTCTGCTTGCCCAGAGG + Intronic
1194385819 X:93254186-93254208 ATATTGTCTTGGTTGCTCAGTGG - Intergenic
1195146258 X:102020000-102020022 AATTTTTTCTGGTTGACCATTGG - Intergenic
1195156471 X:102128166-102128188 ATTTTTTTCTGCTAGAGCAGGGG - Intergenic
1195287482 X:103399024-103399046 ATTTTTTTCTGGCTGTTCAGAGG + Intergenic
1197285463 X:124589940-124589962 ATTTTCTTCTGGTTGCTTTGGGG + Intronic
1197375713 X:125679863-125679885 ATTTTGTTTCCATTGATCAGTGG - Intergenic
1197718129 X:129724875-129724897 ATTTTGAGCAGGTTGAGCAGGGG + Intergenic
1198057222 X:133007142-133007164 ATTTTGTCCAGATTGGTCAGTGG + Intergenic
1198740510 X:139836835-139836857 ATTTCATTCTGTTTTATCAGAGG - Intronic
1199084055 X:143608755-143608777 ATTTTGTTTTGATTTGTCAGTGG + Intergenic
1200358338 X:155575920-155575942 GTTTTGTTCTGGTTCTTAAGGGG - Intronic
1201229447 Y:11849765-11849787 ATTTTGTGCTGGTTTTTGAGAGG - Intergenic
1202068741 Y:20968540-20968562 ATTTTGTTGTTGTTGTTCACTGG - Intergenic