ID: 1149349039

View in Genome Browser
Species Human (GRCh38)
Location 17:55768821-55768843
Sequence GAGGCTACTCCAGCTCTAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 123}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149349039_1149349041 -3 Left 1149349039 17:55768821-55768843 CCACTTAGAGCTGGAGTAGCCTC 0: 1
1: 0
2: 0
3: 7
4: 123
Right 1149349041 17:55768841-55768863 CTCTGCCAACCCAGTCATAGTGG 0: 1
1: 0
2: 1
3: 4
4: 119
1149349039_1149349043 2 Left 1149349039 17:55768821-55768843 CCACTTAGAGCTGGAGTAGCCTC 0: 1
1: 0
2: 0
3: 7
4: 123
Right 1149349043 17:55768846-55768868 CCAACCCAGTCATAGTGGAATGG 0: 1
1: 0
2: 2
3: 10
4: 83
1149349039_1149349046 23 Left 1149349039 17:55768821-55768843 CCACTTAGAGCTGGAGTAGCCTC 0: 1
1: 0
2: 0
3: 7
4: 123
Right 1149349046 17:55768867-55768889 GGAACTATGAAACTAGCCAAAGG 0: 1
1: 0
2: 1
3: 9
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149349039 Original CRISPR GAGGCTACTCCAGCTCTAAG TGG (reversed) Intronic
900637075 1:3671264-3671286 CATGCTACTCCAGGTCTGAGGGG - Intronic
901224510 1:7605306-7605328 GAGCCTACTGCAGCTCAAGGAGG - Intronic
903152984 1:21426159-21426181 GATCCTATTCCTGCTCTAAGAGG - Intergenic
903160148 1:21481822-21481844 GATCCTATTCCTGCTCTAAGAGG + Intronic
903461052 1:23521313-23521335 GAGGCTACTCCAGTTGGAGGAGG - Intronic
905300423 1:36982887-36982909 GAGCCGACTGCAGCTCTCAGAGG + Intronic
906622829 1:47298438-47298460 GATTCTACTCCAGCTCTGTGAGG + Intronic
907005610 1:50910508-50910530 GAGCCCACTGCAGCTCAAAGAGG - Intronic
907576389 1:55529678-55529700 GACCCTACTCCATATCTAAGAGG - Intergenic
908913714 1:69102152-69102174 GAGGCCACTGCAGCTCAAGGAGG - Intergenic
914331348 1:146673464-146673486 GAGGATAATCGTGCTCTAAGAGG + Intergenic
917309388 1:173662797-173662819 GTGGCTACCCCATCTTTAAGAGG + Intronic
921184010 1:212654888-212654910 GAGGACACTACAGCTCCAAGAGG + Intergenic
922398007 1:225222756-225222778 GAGGATCCGCCAGCTTTAAGCGG - Intronic
922620131 1:226983927-226983949 AAGGCCCCTCCAGCTCTGAGGGG + Intronic
1062986627 10:1775108-1775130 GAGGTGGCTCCAGCTCTGAGTGG + Intergenic
1064496065 10:15911802-15911824 CAGGCTGCTACAGCTCTCAGAGG - Intergenic
1064646798 10:17467821-17467843 GACTCTACACGAGCTCTAAGTGG + Intergenic
1065000865 10:21336579-21336601 GAGGCTCCACCAGCCCTAGGGGG - Intergenic
1067656645 10:48197398-48197420 GAGGACACTCCAGCTCTGAAAGG + Intronic
1072397912 10:95064251-95064273 GAGCCTACTGCAGCTCAAGGAGG - Intronic
1075964926 10:126603219-126603241 GAGGCCTCCCCAGCCCTAAGGGG - Intronic
1076571764 10:131437876-131437898 GAGGCTACCGCACCTCTAAAGGG - Intergenic
1077455435 11:2675705-2675727 GGGGCTGCTCCAGCACAAAGAGG - Intronic
1078526278 11:12103967-12103989 GAGTCCACCCCAGCTCTAGGAGG + Intronic
1080134339 11:28836864-28836886 GAGGCTATTCTAGCTCTTATAGG - Intergenic
1080644305 11:34177148-34177170 GTGGCTACTAAAACTCTAAGAGG + Intronic
1081363998 11:42213242-42213264 GTGGCTACTCCAGCTCCAGAGGG + Intergenic
1083879553 11:65541279-65541301 GGGGCTGCTCCACCTCTGAGGGG + Exonic
1084498699 11:69521497-69521519 CAGGCTGCTCCAGCTCTAGCTGG - Intergenic
1084907403 11:72358701-72358723 GAGGCATCTCTAGCTCTAGGAGG + Intronic
1097241256 12:57576776-57576798 GAAGCTTCTCTAGCTCTAACTGG - Exonic
1098642612 12:72857049-72857071 GAGCCTACTGCAGCTCAAGGAGG - Intergenic
1100791489 12:98134919-98134941 AAGGATACTCCAGGTATAAGAGG + Intergenic
1103203598 12:119110448-119110470 GAGCCTACTGCAGCTCAAGGAGG - Intronic
1103458551 12:121086186-121086208 GTGGCTGCCCCAGCTCTGAGTGG + Intergenic
1107063520 13:36187549-36187571 TAGGCTACTCTGGCTCTAAAGGG - Intronic
1118938486 14:70310698-70310720 GAGCCCACTGCAGCTCTAGGAGG - Intergenic
1119699647 14:76744783-76744805 GAGCCCACTGCAGCTCAAAGAGG + Intergenic
1121109125 14:91300513-91300535 GAGGCTTCTCCAGCCCTTGGAGG - Intronic
1121551580 14:94806846-94806868 GAGGCTACTCTAGCGCACAGTGG - Intergenic
1202897592 14_GL000194v1_random:19208-19230 GAGGATACTCAAGCCCTAGGTGG + Intergenic
1127334374 15:57969107-57969129 GAGGCCACTCCAGATGGAAGTGG - Intronic
1130133779 15:81164775-81164797 GAGGCGACTCCAGCTTGAATTGG + Intronic
1131203771 15:90424126-90424148 CTGGCAACTCCAGCTCTCAGGGG - Intronic
1143219420 17:5249021-5249043 AAGGCTGCTCCCGCTCTACGGGG - Intergenic
1145277752 17:21444901-21444923 GAGGCTAAGCCTGCTCTGAGGGG + Intergenic
1145315583 17:21730780-21730802 GAGGCTAAGCCTGCTCTGAGGGG + Intergenic
1145714020 17:27002719-27002741 GAGGCTAAGCCTGCTCTGAGGGG + Intergenic
1146372813 17:32275851-32275873 GAGGCTTCTCCAGCTGTCAGGGG + Intronic
1149349039 17:55768821-55768843 GAGGCTACTCCAGCTCTAAGTGG - Intronic
1150113159 17:62520097-62520119 AATGCTACCCCAGCTCTAGGAGG + Intronic
1150604398 17:66678539-66678561 TAGGCTTCTCCACCACTAAGTGG - Intronic
1151995595 17:77606803-77606825 GAGTCTACTCCAGGTCTTTGGGG - Intergenic
1162780101 19:13002411-13002433 GAGGCCACTCCCGCCCTCAGAGG - Intronic
926005976 2:9373687-9373709 GCGGGGACTCCAGCTCGAAGGGG + Intronic
932063946 2:68533449-68533471 CAAGCTACTCCAACTCTTAGTGG + Intronic
932462787 2:71894047-71894069 GGGGCTACTCCAGCTCCACCTGG + Intergenic
932538932 2:72630444-72630466 GAGGATAATGCAGGTCTAAGGGG - Intronic
934087439 2:88521892-88521914 GATCCTACTCCAACTCTAAATGG - Intergenic
934758339 2:96839750-96839772 GAAGCTACTGCTGCTCTATGGGG - Exonic
938100449 2:128494453-128494475 GAGGAAACTGCAGCTCGAAGAGG - Intergenic
938490701 2:131759505-131759527 GAGGATACTCAAGCCCTAGGTGG - Intronic
941317374 2:164009965-164009987 GAAGCTGCTCCAGCTCCCAGGGG + Intergenic
943487659 2:188507131-188507153 GAGGCCCCTCCAGCTCCAATGGG + Intronic
946622467 2:221573633-221573655 GAGGCTCCTCCACCTCCCAGCGG - Intronic
948148707 2:235727992-235728014 GAGGCAATCCCAGCTCTAATCGG - Intronic
948315117 2:237022633-237022655 GTGGCTTCTCCAGCTCTAGGTGG - Intergenic
948369764 2:237481226-237481248 GAGGCAAACCCAGGTCTAAGGGG - Intergenic
1168978582 20:1986372-1986394 GAGGCTACTCCAGAACCAGGTGG - Intronic
1170869553 20:20192570-20192592 CAAGCTACTCCCACTCTAAGAGG - Intronic
1172178802 20:32988237-32988259 GAGGAAATTCCAGCTCTGAGAGG + Intronic
1173425664 20:42941244-42941266 GAGGAAACTGCAGCTCTGAGAGG - Intronic
1174694516 20:52543441-52543463 GAGCCTACTGCAGCTCAAAGAGG + Intergenic
1176101621 20:63367026-63367048 GGGGCTCCTCAAGCTCTCAGGGG + Intronic
1176617276 21:9035197-9035219 GAGGATACTCAAGCCCTAGGTGG + Intergenic
1176707867 21:10128474-10128496 GAGGATACTCAAGCCCTAGGTGG - Intergenic
1178759116 21:35383584-35383606 GAGACCACTCCAGCTCAGAGTGG - Intronic
956569802 3:70681295-70681317 GAGCCTACTGCAGCTCAAGGAGG - Intergenic
957604131 3:82375921-82375943 GAGCCTACTGCAGCTCAAGGAGG - Intergenic
961737020 3:129008758-129008780 GAGTCTTCCCCAGCTCTAGGAGG - Intronic
961958801 3:130832323-130832345 GAGCCTACTGCAGCTCAAGGAGG + Intergenic
968579038 4:1381182-1381204 GAGGATGCTCCAGCTTTAGGGGG + Intronic
968891120 4:3368998-3369020 GAGGCCACTCCAGACCTATGGGG + Intronic
968905319 4:3448134-3448156 GCGGCTACTCCAGCTCCCTGCGG + Exonic
970302698 4:14698141-14698163 GAGGCTACCTCAGCTCCTAGGGG - Intergenic
972716162 4:41648452-41648474 GAGTAATCTCCAGCTCTAAGAGG - Intronic
977974043 4:103243696-103243718 GAGGCCACTGCAGCTCAAGGAGG - Intergenic
980607523 4:135111882-135111904 GAGCCCACTGCAGCTCAAAGAGG - Intergenic
988187817 5:27889520-27889542 GAGGCTACTGCAGCTCAAGGAGG - Intergenic
990092821 5:52075362-52075384 GATGCTACTTCACATCTAAGAGG - Intronic
992564795 5:77986499-77986521 GAGGCTCCTCCAGGTCTGAGAGG + Intergenic
993681081 5:90878987-90879009 AAGGCTACTTCAGCTTTAAGTGG + Intronic
993816994 5:92561002-92561024 GAGGCTAATGCAGCTCAGAGGGG + Intergenic
994287858 5:97991818-97991840 GAGCCCACTGCAGCTCAAAGAGG + Intergenic
996335991 5:122384706-122384728 GAGCCTGCTCCAGCTCCTAGAGG - Intronic
998507781 5:142686074-142686096 CAGGCTACTGCAGCTCTGAGTGG + Intronic
999048913 5:148500486-148500508 GAAGCTAGGCCAACTCTAAGAGG + Intronic
1000544195 5:162578537-162578559 GAGGCTACCACAGCTCAAGGAGG + Intergenic
1002055575 5:176596472-176596494 GAGCCTGCCCCAGCTCTCAGGGG + Exonic
1002792125 6:444560-444582 GAGGCTGCTCCAGTGCTAATGGG - Intergenic
1006397826 6:33798564-33798586 CATGCTGCCCCAGCTCTAAGAGG + Intronic
1010503436 6:76628763-76628785 GAGCCCACTGCAGCTCAAAGAGG - Intergenic
1021043120 7:15888420-15888442 GAGGCTACTCCTGTGCAAAGTGG + Intergenic
1025040931 7:55645223-55645245 GAGGCTTCTTCTGGTCTAAGCGG + Intergenic
1027112840 7:75454501-75454523 GAGGCTGCTCCTCTTCTAAGGGG - Intronic
1027244899 7:76359897-76359919 GAGCCTACTCCACATCTAACTGG + Intergenic
1027285084 7:76639112-76639134 GAGGCTGCTCCTCTTCTAAGGGG - Intergenic
1031085149 7:117295238-117295260 GAGGACACTGAAGCTCTAAGAGG - Intronic
1032042373 7:128574034-128574056 AATGCTACCCCAGCTCTAGGAGG + Intergenic
1032506447 7:132438233-132438255 GAGGACACTGAAGCTCTAAGTGG - Intronic
1033844115 7:145411817-145411839 GAGGCTTCCTCAGCTCTATGTGG - Intergenic
1034626614 7:152498133-152498155 GTGCCCACTCCAGCTGTAAGAGG - Intergenic
1037863914 8:22427525-22427547 GAGGATACTCAAGATCAAAGAGG - Intronic
1039829539 8:41202045-41202067 GATGCTAGGCCAGGTCTAAGAGG + Intergenic
1042915867 8:73875559-73875581 GAAGTTACTTAAGCTCTAAGAGG - Intronic
1046086715 8:109445606-109445628 GAGGATACTCCATTTCTCAGAGG + Exonic
1049187551 8:141265686-141265708 GAGGCGACAGCAGCTCTCAGGGG - Intronic
1053760920 9:41349642-41349664 GAGGATACTCAAGCCCTAGGTGG + Intergenic
1059394487 9:114025697-114025719 GGGGCTACTCAAGCTCAGAGAGG - Intronic
1202792612 9_KI270719v1_random:97354-97376 GAGGATACTCAAGCCCTAGGTGG - Intergenic
1186658963 X:11648604-11648626 GAGGGTACACAAGCTATAAGGGG - Intronic
1186800384 X:13086843-13086865 GAGGCTCTTCCTTCTCTAAGTGG + Intergenic
1191191873 X:57676487-57676509 GAAGTTTCACCAGCTCTAAGTGG + Intergenic
1194196760 X:90903773-90903795 CAGGGTACTCCAGCTGTCAGTGG + Intergenic
1195391397 X:104366263-104366285 GAGCCTACTGCAGCTCAAGGAGG - Intergenic
1196766400 X:119249318-119249340 AAGGATACTCCTGATCTAAGTGG + Intergenic
1200542607 Y:4477974-4477996 CAGGGTACTCCAGCTGTCAGTGG + Intergenic
1201150670 Y:11094033-11094055 GAGGATACTCAAGCCCTAGGTGG + Intergenic
1201330230 Y:12811393-12811415 GAGGTTACTACAGCACTGAGTGG - Intronic
1201915100 Y:19173000-19173022 GAGTCTACTGCAGCTCAAGGAGG + Intergenic