ID: 1149349047

View in Genome Browser
Species Human (GRCh38)
Location 17:55768883-55768905
Sequence CTAAAGGCTTTATGTGCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149349047_1149349048 -10 Left 1149349047 17:55768883-55768905 CCAAAGGCACATAAAGCCTTTAG 0: 1
1: 0
2: 0
3: 11
4: 159
Right 1149349048 17:55768896-55768918 AAGCCTTTAGTCAAGACTCTTGG 0: 1
1: 0
2: 1
3: 22
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149349047 Original CRISPR CTAAAGGCTTTATGTGCCTT TGG (reversed) Intronic
901201771 1:7471331-7471353 CCAATGGCTTTATGAGCCTATGG - Intronic
902587615 1:17450450-17450472 CAAAAGGCTTTCTGTGGATTGGG - Intergenic
908013059 1:59802620-59802642 CTGAATGATTTATATGCCTTTGG - Intergenic
908564631 1:65341772-65341794 CTAAAGGCTGTGTGTGCCTGTGG + Intronic
909556164 1:76956788-76956810 CTAAAGATTGTATGTGACTTTGG - Intronic
912769294 1:112448155-112448177 TTCAAGGCTTGATGAGCCTTGGG - Intronic
915967920 1:160328127-160328149 ATAAAGTATTTATGAGCCTTTGG - Intronic
916354707 1:163891762-163891784 GTAAAAGTTTAATGTGCCTTGGG + Intergenic
917981143 1:180270193-180270215 CTAAGGACTTTATATGCATTCGG - Intronic
918411877 1:184267731-184267753 CTTCAGGCTTTATGTGGCTCTGG - Intergenic
918859685 1:189807035-189807057 CTAAAGGGTTAATGTGCTTTTGG + Intergenic
919677998 1:200405925-200405947 CTATGCGCTTTATATGCCTTAGG - Exonic
920689470 1:208134873-208134895 CCAAGGTCTTTAGGTGCCTTAGG + Intronic
924519026 1:244789685-244789707 CTGCAGGGTGTATGTGCCTTTGG + Intergenic
1065089859 10:22220736-22220758 CAAATGGCTATATGTCCCTTTGG - Intergenic
1071743837 10:88392472-88392494 CTAAGGGCTCTGTGTGCATTTGG - Intronic
1072544222 10:96422063-96422085 CTAGACACTTTATCTGCCTTGGG + Intronic
1074203948 10:111265445-111265467 CTTAGGGCATTATGTACCTTTGG + Intergenic
1078053816 11:7990646-7990668 ATAAAGGATATATGTGCATTTGG + Intronic
1081624749 11:44645550-44645572 ATAATGGCTTTATTTGGCTTTGG - Intergenic
1086107292 11:83158963-83158985 CAAAAGTCTTTAAGTGACTTGGG + Intronic
1086429929 11:86726801-86726823 CGTGAGTCTTTATGTGCCTTTGG + Intergenic
1087259977 11:96000433-96000455 TTATAGGCTTTGTGTGCCGTAGG - Intronic
1087832317 11:102832447-102832469 CCAAAGACATTGTGTGCCTTAGG - Intergenic
1088069649 11:105766324-105766346 CTAAATGCTTGAGATGCCTTTGG - Intronic
1088953159 11:114590540-114590562 CTAAAGGCCTTTTGAGCTTTAGG - Intronic
1089702515 11:120254095-120254117 GTAAATCCTTTATGTACCTTGGG + Intronic
1094070883 12:26411866-26411888 CTAAGGGCATCATATGCCTTGGG + Intronic
1094222714 12:28011834-28011856 CTAAAGGCTTTATACCCTTTGGG + Intergenic
1097951841 12:65438679-65438701 CCAAAGGCTTTATTTTACTTGGG + Intronic
1099026046 12:77465816-77465838 CACAATGCTTGATGTGCCTTGGG + Intergenic
1099355407 12:81628887-81628909 CTATAGGCCTTATGTGCAATTGG - Intronic
1099712447 12:86244609-86244631 CTCTAGGCTTTATGTGTTTTGGG - Intronic
1099716489 12:86300106-86300128 CTAAAGGATTTGTGTGAGTTGGG + Intronic
1103735361 12:123057661-123057683 CTACAGCCTCTATGTGCCCTGGG - Intronic
1104225547 12:126829351-126829373 ATAAAGGCTTTATGTCCTTATGG - Intergenic
1106866536 13:33970417-33970439 CAGAATGCTTTATGTCCCTTTGG + Intergenic
1108191073 13:47939572-47939594 CTCAAGGTTTTATGTGTTTTAGG + Intronic
1111712641 13:91835988-91836010 CTAAAGTCTTTACCTGCCATGGG + Intronic
1114883053 14:26810812-26810834 ATGAAGGCTTTATTTGCCTGAGG + Intergenic
1115332287 14:32211347-32211369 GTAAAGGCTTTATGCACCTTGGG - Intergenic
1117202256 14:53403296-53403318 CTCCAGGCTTAATGTGCCTGTGG + Intergenic
1117965384 14:61202355-61202377 CTTGAGGCTTTTTGTGCCCTGGG - Intronic
1118417843 14:65562770-65562792 CTAAAGGCTTTCTGTACAATTGG - Intronic
1120002768 14:79322242-79322264 CTAAATCCTTCATGTGGCTTTGG + Intronic
1120617527 14:86726106-86726128 CTAAAGCCTTTCTCTGTCTTAGG + Intergenic
1120749454 14:88184500-88184522 CTCAGGGCTTTTTGTCCCTTGGG - Intronic
1120769347 14:88361459-88361481 CTAAGGGCTGTAAGGGCCTTAGG - Intergenic
1128686733 15:69691957-69691979 CCAAATGCTTTCTGTGCTTTGGG + Intergenic
1137956027 16:52830553-52830575 CTATAGCCTTTGTGTACCTTGGG + Intergenic
1138173132 16:54871688-54871710 CTAAAGGCTTTATTTTATTTAGG - Intergenic
1139019679 16:62732047-62732069 CTAAAAGCATTTTGTCCCTTAGG - Intergenic
1139059631 16:63233063-63233085 CTAAAAGCCTAATGTACCTTAGG - Intergenic
1140647038 16:77043331-77043353 CTAAAGGCTTGATGAGATTTAGG - Intergenic
1142776763 17:2146438-2146460 CCAAAGGCTGTATGTTTCTTTGG - Intronic
1143230701 17:5352068-5352090 CAAATTGCTTTATGTGACTTAGG + Intronic
1143744313 17:8979724-8979746 CTAAAAGCCTTATTTGGCTTTGG - Intergenic
1149145534 17:53487766-53487788 AGAAAGGCTTTGAGTGCCTTAGG - Intergenic
1149301832 17:55312150-55312172 TTGAAGGATTTATGTTCCTTTGG + Intronic
1149349047 17:55768883-55768905 CTAAAGGCTTTATGTGCCTTTGG - Intronic
1156558000 18:38089226-38089248 CTAACTGCTTTGAGTGCCTTTGG - Intergenic
1156872909 18:41968129-41968151 CTAAATGATTTAGGTGCCTTGGG - Intronic
1157158493 18:45290387-45290409 TTAGAGGCTTTATGTGACTAAGG + Intronic
1159028637 18:63209080-63209102 CAAAAGGCTATAGGTCCCTTTGG + Intronic
1159598145 18:70403178-70403200 CTTAACGCTTTCTGTGTCTTTGG + Intergenic
1167816718 19:51888646-51888668 GTAAAGGCTTGTTCTGCCTTTGG - Intronic
926833114 2:16986916-16986938 CTAAAGGCTCTGTGTGTGTTGGG + Intergenic
929313918 2:40454757-40454779 CAAAAGGTTTGATTTGCCTTGGG - Intronic
929794092 2:45045608-45045630 TTAAAGGCTTTCTGTGTCCTAGG + Intergenic
930557652 2:52919472-52919494 CTGATGACTTAATGTGCCTTTGG - Intergenic
931618314 2:64184051-64184073 CTAAAGGTTTTATTGGCATTTGG - Intergenic
931683290 2:64770437-64770459 ATTAAGGGTTTATTTGCCTTTGG + Intergenic
932197142 2:69794796-69794818 TTAAAGGCTTTTTGAGCCTTAGG + Intronic
934519517 2:95011051-95011073 CGAGAGGCCTTCTGTGCCTTGGG + Intergenic
937521942 2:122722201-122722223 CTAAAGGCTTTACATGCATATGG + Intergenic
938149600 2:128870742-128870764 CTAATGGGGTTATGTTCCTTTGG - Intergenic
939402159 2:141708733-141708755 CTAAAGGCTTCATTTGAATTTGG - Intronic
940617375 2:156066224-156066246 GTAAATGCTTTATGTACCATCGG + Intergenic
943235529 2:185313759-185313781 CTAAAGTCTTTCTTTGCCATTGG + Intergenic
943260821 2:185660760-185660782 TTAAAAGCTTTTTGTGCCTCAGG - Intergenic
943348066 2:186763953-186763975 GCAAAGGCTTTAAGTGACTTAGG - Exonic
945638814 2:212396027-212396049 CTGATGGTTTTATGTGCTTTAGG + Intronic
945936272 2:215905787-215905809 GAAATGGCTTTATGGGCCTTTGG - Intergenic
946718558 2:222579221-222579243 CTTTAGGCCTTATGTGCCTGTGG - Intronic
947348805 2:229221412-229221434 CTAAAGTCTTTAGGTGGCTTTGG - Intronic
1177700335 21:24631539-24631561 CAAAAAGCCTTATATGCCTTTGG + Intergenic
1177805368 21:25869672-25869694 TTCTAGGCTATATGTGCCTTTGG + Intergenic
1177987594 21:27997125-27997147 CCAAAAACTTTATGTGCTTTTGG + Intergenic
1183848813 22:40565745-40565767 CTATAAGCATTATGTGCCTGGGG + Intronic
949479016 3:4475535-4475557 AAAGATGCTTTATGTGCCTTTGG + Intergenic
950093781 3:10316061-10316083 CTTAAGGCATTGTGTTCCTTGGG - Intronic
951077571 3:18414912-18414934 CTATAGGCTTTTTCTCCCTTGGG - Intronic
951311890 3:21136892-21136914 ATCAAGGTTTTATGTGCCATAGG - Intergenic
951571257 3:24065503-24065525 CAGAAGGCTGTATGTTCCTTTGG + Intergenic
952858260 3:37791162-37791184 ATAAAGTCTTGATTTGCCTTGGG - Intronic
953673592 3:44982768-44982790 CATAAGGCTTTCTGTGCCATGGG - Intronic
957128718 3:76196774-76196796 TTTATGGCTTTATGAGCCTTGGG - Intronic
960205239 3:114889141-114889163 CGAAAGGATTTCTGTGCATTAGG - Intronic
960832270 3:121862819-121862841 ATAAAGGTTTTATCTACCTTTGG + Intronic
961921831 3:130434419-130434441 TTAAATGATTTATATGCCTTTGG + Intronic
962527267 3:136248015-136248037 CTAAAGGCCTTCTCTGCGTTGGG + Intergenic
964643101 3:158930893-158930915 CTCAATGCTTTGGGTGCCTTAGG + Intergenic
970192043 4:13526590-13526612 CTTCAGGCTTCATGAGCCTTTGG + Intergenic
972352884 4:38253414-38253436 CTAAAAGTTATATATGCCTTTGG + Intergenic
973547562 4:51996754-51996776 CTGGAGGTTGTATGTGCCTTAGG + Intronic
974919085 4:68214836-68214858 CTGAAGGCTTTATATAACTTGGG - Intergenic
976427561 4:84923490-84923512 ATAAAAGCTTTATGTGGCATAGG - Intronic
977569552 4:98615204-98615226 CTACAGAGTTTTTGTGCCTTGGG + Intronic
988079134 5:26393584-26393606 TTAAAAGTTTTATATGCCTTGGG + Intergenic
989257385 5:39380168-39380190 CTAAAGACTTCATGTCTCTTGGG - Intronic
989664749 5:43841079-43841101 TTAAAGGCTTCAAGGGCCTTGGG - Intergenic
990205334 5:53422917-53422939 CTAAAGGATCAATGGGCCTTAGG + Intergenic
991130653 5:63118983-63119005 CTAAAGCGATTATCTGCCTTTGG + Intergenic
991482564 5:67097585-67097607 CTAAATTCTGTATGTGCCTACGG + Intronic
993110781 5:83654924-83654946 CTAAGTGCTTTATGTGTATTAGG - Intronic
993159529 5:84271528-84271550 ATAAATGATTTATGTGCCTTGGG + Intronic
993334650 5:86643241-86643263 CTAAAGTGCTTATGTGCCATAGG + Intergenic
993373953 5:87127123-87127145 CTAAAGGCTTTCTGTCCTATAGG + Intergenic
994303816 5:98178740-98178762 CTAAATGCTTGATATGGCTTGGG - Intergenic
994489164 5:100419611-100419633 TTAAAGGCTTTTTGAGCCTTAGG - Intergenic
996594641 5:125186198-125186220 ATCTAGGCTGTATGTGCCTTAGG - Intergenic
997847694 5:137303119-137303141 TTTAAGGCTTTTTGTGCCTCTGG + Intronic
998584101 5:143407649-143407671 CTTAAGGTTTTATTGGCCTTAGG - Intronic
1000927742 5:167214400-167214422 CAAAAGGCTTGATGTGCCTCTGG - Intergenic
1001781149 5:174370170-174370192 CTAAAGGCAAAATCTGCCTTGGG - Intergenic
1004203040 6:13567624-13567646 TTAAATGCTTTATGCGCCTAAGG + Intergenic
1005303477 6:24492997-24493019 CTAAAAGTTTTATGGGCCCTTGG + Intronic
1005787079 6:29255139-29255161 CTAAATGATTTATATTCCTTTGG - Intergenic
1007122728 6:39396718-39396740 CTGGGGGCTTTATGTACCTTGGG - Intronic
1008153446 6:47984852-47984874 CTAATTGCTTTTTGTACCTTTGG - Intronic
1008792625 6:55256021-55256043 TTGAAGGCTTTATGTTTCTTTGG + Intronic
1013232800 6:108171918-108171940 CTAAATTCTTTAGGTCCCTTGGG - Intronic
1013782574 6:113745440-113745462 CTAAAGGATCTATCTTCCTTTGG - Intergenic
1013860118 6:114625611-114625633 CTAAAGCCTGTATTTTCCTTTGG + Intergenic
1014355922 6:120409979-120410001 CTTAAGGCATTCTGTGCCTAAGG + Intergenic
1014976775 6:127895806-127895828 CTAAAGATTTTATGTAACTTTGG - Intronic
1015107491 6:129553900-129553922 CAAAATCCTTTATGTGGCTTAGG - Intergenic
1017452082 6:154563608-154563630 CAAAAAGCTGTATGTCCCTTTGG - Intergenic
1018916997 6:168139261-168139283 CTAAAGGCTTGATGAGACTCGGG + Intergenic
1021297654 7:18928380-18928402 CTTTTGGCTTTATGTGCTTTAGG + Intronic
1024103090 7:46053303-46053325 CAAGAGTCTTTCTGTGCCTTCGG + Intergenic
1026612719 7:71874838-71874860 GGAAGGGCTTTATGTGTCTTGGG + Intronic
1028485336 7:91351223-91351245 CTAAATGCTTTATGTGTAATAGG + Intergenic
1032886636 7:136147075-136147097 TTGAAGGCTTTATGTGTCTTTGG + Intergenic
1033317211 7:140307528-140307550 CTAACAGCTTTATGTGCATGCGG - Intronic
1037766561 8:21775791-21775813 CTCGAGGCTTTGGGTGCCTTGGG + Intronic
1038656769 8:29459984-29460006 CTCATGGCTTCATGTGACTTTGG - Intergenic
1040560430 8:48518745-48518767 CTACACACTTTATGTGTCTTAGG - Intergenic
1041533045 8:58893645-58893667 CTAATGGCTTTAGCTGCCTTTGG + Intronic
1041626475 8:60034549-60034571 GGAAAGGCTTTATTTGTCTTGGG + Intergenic
1041969726 8:63725717-63725739 GTAAAAGCTTTATGTACATTTGG - Intergenic
1043173589 8:76996706-76996728 CTAATGGCTCTTTGTTCCTTTGG - Intronic
1046344473 8:112904457-112904479 CTAAAGGCTTTATGACCTATAGG - Intronic
1048022888 8:130556760-130556782 TTGAAGGCTTTTTTTGCCTTTGG + Intergenic
1048910248 8:139128163-139128185 TTAAAGGCTGTAAGTCCCTTTGG + Intergenic
1050958291 9:11692870-11692892 CTAAAGGCTTCATGTGATTGAGG - Intergenic
1052105835 9:24514500-24514522 TTACAGGCTGTATGTACCTTAGG + Intergenic
1052183347 9:25559159-25559181 ATATAGGCTTTATTTTCCTTTGG + Intergenic
1056332293 9:85530964-85530986 CTAATCGCTTTCTGTGGCTTGGG + Intergenic
1056654451 9:88497505-88497527 CTAAAGGGAAGATGTGCCTTTGG + Intergenic
1058271737 9:102981269-102981291 CCAAAGGCTTTATGGGTCTGGGG - Intergenic
1062347531 9:136122269-136122291 GGAAACGCTTCATGTGCCTTGGG + Intergenic
1186562898 X:10631787-10631809 CTTAAGGATTCCTGTGCCTTGGG - Intronic
1189443183 X:41056033-41056055 CTACAGGCTTCATCTGCCTCTGG - Intergenic
1190372543 X:49756635-49756657 CTAAAAGCTTTAGGTTGCTTGGG + Intergenic
1196159112 X:112462817-112462839 CCAAAGGTTTTATCTACCTTTGG - Intergenic
1197415647 X:126168610-126168632 CTAAATACTTTATGTACATTTGG + Intergenic
1198022992 X:132677604-132677626 CTAAAGGAGTCATGTGGCTTTGG + Intronic
1198338960 X:135694748-135694770 CTGAATGCTTTATATTCCTTTGG + Intergenic
1199996081 X:153027772-153027794 GTAAGGGCTTGATGTGCCTCCGG - Intergenic
1201532292 Y:15005218-15005240 CCAAAGGCTGGATATGCCTTGGG + Intergenic