ID: 1149351763

View in Genome Browser
Species Human (GRCh38)
Location 17:55795997-55796019
Sequence AATTCTGCACAGAGGCGTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 94}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149351763 Original CRISPR AATTCTGCACAGAGGCGTCT AGG Intronic
900718755 1:4161565-4161587 AATTCTGCCCGGAGCCGTCTGGG + Intergenic
902170829 1:14609696-14609718 GATTCTGCAAAGAGATGTCTAGG - Intronic
905531436 1:38682157-38682179 TATTCTGTACAGAGGCATTTTGG + Intergenic
905609757 1:39340111-39340133 AATTCTGCACAGCTGCTCCTTGG + Intronic
907274409 1:53309424-53309446 TCTTCTGCACAGGGGCGTCTTGG - Intronic
919795273 1:201317877-201317899 AAATCTGCACAGCTGTGTCTTGG - Intronic
920272118 1:204773482-204773504 AATTCTACACACAGGAGTCTGGG + Intergenic
923656545 1:235921995-235922017 TATTCTGCACAGACCCGTCATGG - Intergenic
924019007 1:239760742-239760764 AATTATGAACAGAGGCATCAAGG - Intronic
1062816255 10:503073-503095 AAGTCTGCAGGTAGGCGTCTTGG - Intronic
1064809380 10:19177824-19177846 AATTCTACACAAAGGAGTCAAGG - Intronic
1065491448 10:26286171-26286193 AATTCTGGACAGGAGTGTCTAGG - Intronic
1068844750 10:61659222-61659244 AATCCTGCAGAGAGGGGACTGGG + Intergenic
1070994980 10:80770348-80770370 AAATTTGTACAGAGGCGACTGGG + Intergenic
1078436755 11:11331764-11331786 AATCCTACACAGAGTAGTCTTGG + Intronic
1079328152 11:19511998-19512020 AATTCTGCACATTGCCCTCTGGG + Intronic
1080705080 11:34683517-34683539 AAATCTGTACAGATGCATCTAGG + Intergenic
1084589271 11:70080671-70080693 AAGTCTGCAAAGAGGCAGCTGGG + Intronic
1089082705 11:115790373-115790395 AATTCAGCTCAGGGGCTTCTGGG - Intergenic
1094037531 12:26086799-26086821 AATCCTACACAGAAGCCTCTGGG - Intergenic
1100804242 12:98264339-98264361 ATTTCTGCACAGAGGCAGATAGG + Intergenic
1106092046 13:26604981-26605003 AATCCTGGACAGAGGCGCCAGGG + Intronic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1113109421 13:106806194-106806216 TATACTGCACAGAGGCGTCTGGG - Intergenic
1115156157 14:30341379-30341401 AATTCTGAGCAGAGGAGTCCAGG - Intergenic
1118023985 14:61750426-61750448 TTTTCTGTACAGAGGCTTCTAGG - Intergenic
1120789854 14:88569798-88569820 AATTCTGCACAGAATTCTCTGGG + Intronic
1122091430 14:99343453-99343475 GGTTCTGCACAGAGGCCTCACGG + Intergenic
1124973880 15:34515447-34515469 AAATCAGCACAGAGCCTTCTTGG - Intergenic
1125245262 15:37629394-37629416 AATACTGCACAGAGGATTCATGG - Intergenic
1130865033 15:87925880-87925902 AATTATCCACAGAGTTGTCTTGG + Intronic
1141032369 16:80601182-80601204 AGTTCTGCACAAAGTCTTCTTGG + Exonic
1141036123 16:80627746-80627768 AATTCTTCTTAGAGGCTTCTGGG + Intronic
1141105850 16:81232988-81233010 AAATCTGCTCAGAGGATTCTGGG + Intergenic
1146551137 17:33781278-33781300 AATGCTGTGGAGAGGCGTCTCGG - Intronic
1148067782 17:44885523-44885545 AATTGTGGAAAGAGGAGTCTGGG + Intronic
1149351763 17:55795997-55796019 AATTCTGCACAGAGGCGTCTAGG + Intronic
1155087207 18:22470472-22470494 AATTCTGTCCAGTGGAGTCTGGG - Intergenic
1157167436 18:45370915-45370937 ATTTCTTCACAGGGGCATCTGGG - Intronic
1157575936 18:48743114-48743136 AATTCTGCACATATGCCTCAGGG + Intronic
1160078989 18:75704709-75704731 GAGACAGCACAGAGGCGTCTAGG - Intergenic
1160238242 18:77102797-77102819 AGCTCTGCTCAGAGGCCTCTAGG - Intronic
1160830402 19:1102065-1102087 GATGCAGCACAGAGGCGTCATGG - Intergenic
1163125838 19:15243742-15243764 AGTTCTGCACTGAGGCGTGAAGG - Intronic
1163511015 19:17734990-17735012 ATTTCTGCAGAGAGGGGTCAGGG - Intergenic
1164421180 19:28094306-28094328 AATTGTGCACAGGAGAGTCTGGG - Intergenic
1165731883 19:38151203-38151225 AAGTCTGCCCAGAGGCTTCTGGG - Intronic
925967069 2:9075927-9075949 AATTCTGCACAGAGGGGCCACGG + Intergenic
926002146 2:9342129-9342151 ATTTCTGCACAAAGGCAGCTGGG - Intronic
926022877 2:9512660-9512682 AATGCTGCACAGAGAGGTCAAGG + Intronic
940564457 2:155343214-155343236 AATTCTTGACAAAGGGGTCTGGG + Intergenic
940692129 2:156931787-156931809 AATTCAGCACAGAGCAGTCAGGG - Intergenic
941683838 2:168427840-168427862 AATTGTGCACAGTGACGTCCTGG + Intergenic
946315661 2:218909808-218909830 AATTCAGCACAGTGGGGACTAGG - Intergenic
947131814 2:226934824-226934846 AATTATGCACAGAGGGATGTGGG - Intronic
947649316 2:231771321-231771343 AATTCTCCAGAGAGGCATCATGG + Intronic
947791712 2:232872552-232872574 AATTCTGGTCAGTGGAGTCTGGG + Intronic
1179570466 21:42275631-42275653 CATTCTCCACAGATGCGACTAGG + Intronic
1183407343 22:37636857-37636879 AAATCTGCACAGAGGCTGCCAGG + Intronic
1185159898 22:49217360-49217382 AATTCTGCATAGAGATGTCAGGG + Intergenic
949409537 3:3748899-3748921 AATTATGCACAGAGGGCTATGGG + Intronic
949582573 3:5404588-5404610 AATTATGCCCAGAGGCAACTGGG + Intergenic
954765767 3:52914825-52914847 AATTCTGAAAAGAGGCATTTGGG - Intronic
961495490 3:127288189-127288211 ATTTATGCACAGGGGCTTCTCGG - Intergenic
965312863 3:167153139-167153161 AAATCTGCACTGAGTCCTCTAGG - Intergenic
966304367 3:178513978-178514000 ACTCCTGCTCTGAGGCGTCTGGG + Intronic
966942950 3:184758422-184758444 AAATGTGCACAGAAGGGTCTGGG - Intergenic
967156367 3:186696210-186696232 AATGCTGCACAGAGGGGCCATGG - Intergenic
971418585 4:26455571-26455593 AATTCTGCAATTAGGTGTCTGGG + Intergenic
976411980 4:84724489-84724511 AACTCTCCACAATGGCGTCTTGG + Exonic
977825330 4:101524410-101524432 AAATCTGCACAGATGCATCCAGG - Intronic
980178016 4:129370679-129370701 AAATCAGCACAGAGGCAACTGGG - Intergenic
981473667 4:145165864-145165886 AATACTGAATAGAGGCGGCTGGG + Intronic
990987598 5:61655203-61655225 AATGCTGCTCTGAGGAGTCTGGG + Intronic
991618153 5:68518063-68518085 GATTCTGCACAGAGGCCTAGGGG + Intergenic
992878685 5:81083329-81083351 AAGTCTGGACAGAGGTCTCTTGG - Intronic
994211032 5:97087592-97087614 AAGTTTGGACAGAGGCTTCTGGG - Intergenic
998467614 5:142358016-142358038 AATTCTGTTCAGCGGTGTCTAGG - Intergenic
998706520 5:144768231-144768253 AAGTTTGCACAGATGCTTCTGGG + Intergenic
999094202 5:148963839-148963861 AAGTCTTCAGAGAGGCTTCTAGG - Intronic
1003501229 6:6704554-6704576 ATTTATGCCCAGAGGCCTCTGGG - Intergenic
1005339019 6:24825850-24825872 AAGTCTGCACTGAGGCAACTGGG + Intronic
1005529470 6:26688382-26688404 AATTCTGCACACATGCATGTAGG - Intergenic
1005541326 6:26813264-26813286 AATTCTGCACACATGCATGTAGG + Intergenic
1011088919 6:83572765-83572787 AATTCTGCACAGAAGGGAATAGG + Intronic
1019858118 7:3629558-3629580 TAGCCTGCACAGAGGTGTCTTGG + Intronic
1020076332 7:5261413-5261435 ACTTCTGCTAAGAGGGGTCTCGG - Intergenic
1021005130 7:15385234-15385256 CATTCTGCACAGAAGCATTTTGG + Intronic
1022139052 7:27476288-27476310 AATTCTGCTCAGGGGCATCAGGG - Intergenic
1037911980 8:22748971-22748993 AATTCTCCACAGACCCATCTGGG - Intronic
1038311359 8:26448768-26448790 GAACCTGCACAGAGGCGTCCAGG + Intronic
1043981239 8:86642137-86642159 AACTCCACAGAGAGGCGTCTAGG + Intronic
1045060357 8:98405563-98405585 AATTAGGCTCTGAGGCGTCTAGG - Intronic
1048541396 8:135345218-135345240 AATGCTGCACATAGGGGCCTTGG - Intergenic
1053415548 9:37944903-37944925 AGGTCTGCACAGGGGGGTCTTGG - Intronic
1055307490 9:74944662-74944684 AATGATGCACAGAGGTGTATTGG - Intergenic
1056746773 9:89310491-89310513 CATTCTCCACACAGTCGTCTAGG + Intergenic
1188210815 X:27421096-27421118 AATTCTGCTACGAGGCGTATTGG - Intergenic
1188675715 X:32936688-32936710 AATGTGGCACAGAGGAGTCTGGG + Intronic
1191109073 X:56790947-56790969 ACATCTGCACAGAGGCCTGTTGG - Intergenic
1198933450 X:141883199-141883221 AATGCTGCCCAGAAGCTTCTAGG + Intronic