ID: 1149353643

View in Genome Browser
Species Human (GRCh38)
Location 17:55817198-55817220
Sequence GCCAGGGCTTGGAGGGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 466
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 419}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149353643 Original CRISPR GCCAGGGCTTGGAGGGAAAT TGG Intronic
900559200 1:3295337-3295359 GCCAGTGCTGGGAGGGGACTGGG + Intronic
901231633 1:7644924-7644946 GCCAGGCCTTGGACTGAGATGGG - Intronic
902180169 1:14682128-14682150 GCCAGGGCCTGGAAGGAAGGGGG - Intronic
902362910 1:15951762-15951784 GGCCAGGCTTGGAGGGACATAGG + Intronic
902553590 1:17233734-17233756 GCCAGGGCTTGGGGGGTAAGTGG - Intronic
902664421 1:17927552-17927574 GCCAGGGGTTGGGGGAAAAGAGG + Intergenic
902822799 1:18953832-18953854 GCCCAGTCTTGGAGGGAGATGGG - Intronic
903304394 1:22402475-22402497 GGCAGGGCTTGCAGGGGAATGGG - Intergenic
903584927 1:24407071-24407093 GCCAGGGATTGCAGGGAAAAAGG - Intronic
904756473 1:32771192-32771214 TCCTGGGCTTGGAGGGAGGTGGG - Exonic
905122243 1:35691067-35691089 AGCAGGGCTGGGAGGGAAATTGG + Intergenic
905165708 1:36082006-36082028 GCAAGGGCTTGGTAGGCAATTGG - Intergenic
905734019 1:40314142-40314164 GCCAGGCCCTGGAGGTCAATTGG + Intronic
905921582 1:41722950-41722972 GCCAGAGCTTTGAGGGAAAGAGG + Intronic
906247960 1:44290318-44290340 GCCCAGGCTTGGAGAGAAGTGGG + Intronic
906293315 1:44633842-44633864 GCCAGGGCTGGGATGGAGAATGG - Intronic
907239777 1:53074971-53074993 GCAGGGGCATGGAGGGTAATAGG + Intronic
907850125 1:58248220-58248242 GCCAGGGCTTATTGGCAAATAGG - Intronic
908795413 1:67826371-67826393 GCCTGGGCAAGGAGGCAAATGGG - Intronic
909212037 1:72836258-72836280 GTCAGGGGTTGGAGGGCAAGGGG + Intergenic
910136145 1:83972268-83972290 GCCAGGGGTTGGGAGGGAATGGG - Intronic
910845592 1:91601910-91601932 TCCAGGGTTTGGAGGGAGAGTGG - Intergenic
911925657 1:103828453-103828475 GCCAGGGGTTGGAGGGGAGAGGG - Intergenic
912562546 1:110560999-110561021 GCCAGGGCTGGGAGAGAACTGGG + Intergenic
912685942 1:111764839-111764861 GGCAGAACTAGGAGGGAAATTGG + Intronic
912749834 1:112277544-112277566 GGCAGGGGGTGGAGGGAAAGTGG + Intergenic
912758087 1:112341651-112341673 GCCAAGACTTGGAGGGAGAGAGG + Intergenic
913532431 1:119742548-119742570 GCGAAGGCTTGGAGGAAAACAGG - Intronic
915475577 1:156150891-156150913 TCCAGGGCTTGTGGAGAAATGGG + Intronic
917132655 1:171758412-171758434 ACCAGGGCATGGAGGGAAAATGG + Intergenic
917159641 1:172043178-172043200 GCTAGGGCTTCGATTGAAATGGG + Intronic
918057708 1:181036413-181036435 TCCTGGGCTTTGAGGGATATTGG + Intronic
918064639 1:181090868-181090890 GCCTGGGTTGGGAGGGAAGTGGG + Intergenic
918539999 1:185621616-185621638 GCCAGGGCTTAGTGGGAGAGAGG + Intergenic
918719505 1:187835748-187835770 GCCAGGGTTTGGTGGGAGAGTGG + Intergenic
919841417 1:201611814-201611836 CCCTGGGCTGGGTGGGAAATGGG + Intergenic
921113615 1:212064530-212064552 GCCAGGGCTTAGAGGGAGGTAGG - Intronic
921858434 1:220014584-220014606 GCCAGGCTTTGGAGCCAAATGGG - Intronic
921888527 1:220330424-220330446 GCCAGGGCCTGGAGGGAGAGAGG - Intergenic
922193805 1:223342060-223342082 GCCATGACTAGGAAGGAAATAGG - Intronic
922507238 1:226133626-226133648 GCCATGTCCTGGAGGCAAATGGG + Intergenic
922749333 1:228063345-228063367 GCCATGGCTGGGAGTGATATTGG - Intergenic
924403536 1:243717030-243717052 TCCAGGCCTGGGAGGGGAATGGG - Intronic
1062962177 10:1580763-1580785 GCCAGGGCTTGTGGGGAAGGAGG - Intronic
1064008377 10:11715580-11715602 GCCTGGGTTTGGAGGGCACTTGG + Intergenic
1065103646 10:22357218-22357240 ACCCAGGCTTGGAGGGACATGGG - Intronic
1065265242 10:23968624-23968646 GCCAGGGGTTGGGTGGTAATGGG - Intronic
1065637437 10:27745585-27745607 ACCAGACCTTGGAGGGAAGTTGG + Intronic
1066677748 10:37906020-37906042 GCCAGGGCCAGGAGGGGAAAAGG - Intergenic
1067478313 10:46580097-46580119 GCCAGGGCTGTGAGGGAGAGTGG + Intronic
1067529069 10:47057480-47057502 GCCAGGGGTTGGGGGGACAGAGG + Intergenic
1067616426 10:47761690-47761712 GCCAGGGCTGTGAGGGAGAGTGG - Intergenic
1067937174 10:50622996-50623018 GGCAAGGCCTGGAGGGGAATCGG - Intronic
1068023272 10:51610887-51610909 ATCAGGGCTTGGGGGGAAAGGGG + Intronic
1068950029 10:62767524-62767546 GGTGGGGCTTGGGGGGAAATAGG - Intergenic
1069333268 10:67318699-67318721 GCAAAGGCTTGGAGGTAAAAAGG - Intronic
1069629816 10:69890595-69890617 GCCAGGGCATGGAGGGAGGCAGG + Intronic
1072010534 10:91299245-91299267 GCCAGACCTGGGAGGGAACTTGG - Intergenic
1072985661 10:100137707-100137729 GCCAGGGCTTGGCGGGAGGGAGG + Intergenic
1073295897 10:102438537-102438559 AACAGGGCCTGGAGTGAAATGGG + Intergenic
1073618411 10:105022029-105022051 GCCAGGGGTTGTGGGGAAAGAGG + Intronic
1073926774 10:108525605-108525627 GTCAGGGGCTGGAGAGAAATAGG + Intergenic
1074932339 10:118141488-118141510 GCCAGGGTTTGAAGGGTAACTGG - Intergenic
1076637535 10:131892041-131892063 GGCTGGGCTTGGAGGGAAGCTGG + Intergenic
1076923358 10:133467019-133467041 GCCAGGGATGGGAGGGCACTGGG + Intergenic
1077280453 11:1742641-1742663 GGTAGGGCTTGGAAGGAAAGTGG + Intronic
1077362340 11:2146229-2146251 GCCAGAGCTGGGGAGGAAATGGG - Intronic
1077531618 11:3099197-3099219 GCCAGGGCCTGGAGGGACTGAGG + Intronic
1077609565 11:3636022-3636044 GCCTGGGGGTGGGGGGAAATGGG + Intergenic
1079953499 11:26833714-26833736 GCCAGGGCTTAGTGGGATAGAGG - Intergenic
1080528521 11:33151085-33151107 CTTAGGGATTGGAGGGAAATGGG - Intronic
1081490494 11:43564595-43564617 ACCAGGGCTTGGAAGCAAATTGG + Intronic
1081559302 11:44198181-44198203 GCCAGGGCTTGGAGTTAAATGGG - Intronic
1081650107 11:44818244-44818266 GCAGGGCCGTGGAGGGAAATGGG - Intronic
1082056645 11:47823348-47823370 GCTAGGAATTGAAGGGAAATGGG - Intronic
1084082238 11:66835574-66835596 GCCAGGGGTTGAAGGGAGAGGGG - Intronic
1085717886 11:78889325-78889347 CCCTGGGCTTGGAGGGAAACTGG - Intronic
1085746271 11:79117270-79117292 GGCCGTGCTAGGAGGGAAATCGG + Intronic
1085746415 11:79118558-79118580 GCCAGGGTCTGGAGGGAAGGGGG - Intronic
1085753389 11:79183383-79183405 GCCAGGGATTGGAGGGAGGAAGG + Intronic
1086427109 11:86696141-86696163 GCCAGGCCTGTCAGGGAAATAGG + Intergenic
1086542242 11:87926856-87926878 GCCAGGGTTTCCTGGGAAATTGG - Intergenic
1087558644 11:99754922-99754944 GCCAGGGCTTGGGGGCAGAGGGG - Intronic
1088132868 11:106516052-106516074 GACATGGCTTGAATGGAAATTGG + Intergenic
1088311754 11:108467554-108467576 GGCGGGGCTAGGAGGGCAATGGG - Intergenic
1088735910 11:112727546-112727568 GCCACAGCTTTGAGGGAAAGGGG + Intergenic
1089257021 11:117199445-117199467 GCTGGGGCTTGGAGGGAAGTTGG + Intronic
1089618271 11:119707425-119707447 GGCAGGGATGGGAGGGGAATGGG - Intronic
1089869285 11:121657672-121657694 ACTTGGCCTTGGAGGGAAATAGG + Intergenic
1091440756 12:510482-510504 GGCTGGGCTGGGAGGGAAACGGG + Intronic
1091613750 12:2033404-2033426 GCCTGGGTTTGGAGAGAAAATGG - Intronic
1091848057 12:3672830-3672852 GAGAGGTCTTGGAGGCAAATAGG + Intronic
1093445376 12:19250887-19250909 CGCAGGGCTTGGGGGGAAAATGG + Intronic
1096098077 12:48950675-48950697 GCCAGGGGCTGGAGGGACAGGGG - Intronic
1096500421 12:52061133-52061155 GCCAGGGCTGGGAGTGGAGTGGG + Intergenic
1096995450 12:55835250-55835272 GGTAAGGCTTGGAGGGAATTCGG - Intergenic
1097021573 12:56024740-56024762 GCCAGGGCGGAGAGGAAAATGGG - Intronic
1097919899 12:65060529-65060551 GCCAGTGTCTGGAGGGAAAGGGG + Intronic
1098636470 12:72790240-72790262 GCTAGGGCTTGGAGGGAGAGAGG + Intergenic
1099383286 12:81981948-81981970 GCTAGGGTTTGAAGGGAAATAGG + Intergenic
1100442158 12:94627246-94627268 GCCAGGGCTTTGGGGGCAACAGG - Intronic
1101493428 12:105231546-105231568 GGCAGGGCTGGGATGTAAATGGG + Intronic
1101817562 12:108157474-108157496 TCCAGGGGTAGGAGGGAAATAGG - Intronic
1101849686 12:108392297-108392319 GCCAGTGGTTGGAGGGAGTTGGG - Intergenic
1102658472 12:114503811-114503833 GACAGGGCTGGGAGGGACAGGGG + Intergenic
1103436217 12:120929062-120929084 GACAGGCCCTGGAGGGAAGTGGG - Intergenic
1103735783 12:123060027-123060049 GCCAGGACTTGGAGAAAAAAAGG - Intronic
1104804404 12:131575845-131575867 ACCAGGGCTGGGAGGCAAAGAGG + Intergenic
1104873491 12:132017018-132017040 ACCAGGGCTGGGCAGGAAATGGG - Intronic
1105226753 13:18442071-18442093 GTCAGGGGTTGGAGGGGAAGAGG + Intergenic
1107040123 13:35939155-35939177 TCCACTGCTTGGAGGCAAATGGG + Intronic
1107456529 13:40560591-40560613 GCCAGGGCTTGCAGGCCATTTGG + Exonic
1107720613 13:43244675-43244697 GCCAGCCCTTGGAGGGTCATAGG - Intronic
1108440339 13:50446755-50446777 GCCAGAGAGTGGGGGGAAATGGG - Intronic
1108854056 13:54771868-54771890 GCCAGGGGGTGGAGGGCAAGGGG - Intergenic
1111137026 13:84060723-84060745 GTCAGGGGTTGGGGGGAAAGGGG + Intergenic
1111665381 13:91261262-91261284 ACCATTGCCTGGAGGGAAATGGG - Intergenic
1112051988 13:95652241-95652263 AGCAGGGCTTAGAGGGAAATTGG + Intergenic
1112474087 13:99715186-99715208 GCCAAGGCTAGGAGGCAACTGGG + Intronic
1112670275 13:101627621-101627643 GCCAGGGGTTGTAGGGAGAGAGG - Intronic
1113307086 13:109090465-109090487 GCCAGGGATTGTGGGGAGATGGG + Intronic
1113557577 13:111250930-111250952 GACAGGGCTTGGAGAGATTTTGG - Intronic
1113673817 13:112194818-112194840 GCCAGGGCCTGCAGGGACAACGG - Intergenic
1114011209 14:18370558-18370580 GTCAGGGGTTGGAGGGGAAGAGG + Intergenic
1114219454 14:20683723-20683745 GCTAGGGCCTGGAGGGAACCTGG - Intergenic
1115269158 14:31532447-31532469 GCCAGGGTTTTGGGGGAAAGGGG - Intronic
1121027986 14:90630644-90630666 GCCAGGGCTGGGAGGGGGAATGG - Intronic
1121727762 14:96165709-96165731 GCCAAGGCTGGGAGGGAAAGAGG + Intergenic
1121792797 14:96711706-96711728 GCCAGGGCCTGAATGGAAACGGG + Intergenic
1122215182 14:100198790-100198812 GCCAGGGTTTGGATGGAAGGGGG + Intergenic
1122799018 14:104220685-104220707 GAGAGGGCTTGGAGGGGGATGGG + Intergenic
1122904253 14:104794875-104794897 GCCAAGGCTTGGAGGGCAGCTGG - Intronic
1123122877 14:105926288-105926310 GCCAGGGCCAGGTGGGCAATGGG - Intronic
1123405520 15:20017708-20017730 GCCAGGGCCAGGTGGGCAATGGG - Intergenic
1123514852 15:21024356-21024378 GCCAGGGCCAGGTGGGCAATGGG - Intergenic
1124486503 15:30121810-30121832 GCCAGGGGTTGGAGAAGAATGGG - Intergenic
1124541578 15:30590789-30590811 GCCAGGGGTTGGAGAAGAATGGG - Intergenic
1124548243 15:30652590-30652612 GCCAGGGGTTGGAGAAGAATGGG - Intronic
1124757081 15:32416796-32416818 GCCAGGGGTTGGAGAAGAATGGG + Intergenic
1125144188 15:36447285-36447307 TCCAGGACTTGGAGACAAATAGG + Intergenic
1126108507 15:45162390-45162412 GCCATGGGTTGGTGGGAAGTGGG - Intronic
1128160744 15:65421774-65421796 GGCAGGGCTGGGAGGGGGATGGG - Intronic
1128591976 15:68906216-68906238 CCCAGGGAGTGGAGGGAGATGGG - Intronic
1129051821 15:72787204-72787226 GCAATGGTTTGGAAGGAAATGGG + Intergenic
1129271457 15:74421416-74421438 GCTAGGGTTTGAAGGGAACTGGG - Intronic
1130905264 15:88235627-88235649 GCCAGGGCCTGGTGGGCATTTGG - Intronic
1131392874 15:92063286-92063308 TCCAGGGTTTGGACTGAAATGGG - Intronic
1132164020 15:99566625-99566647 CCCCGGGCTTGGAGGGAAAAGGG - Intronic
1133206849 16:4239184-4239206 GCCAGGGGTGGGAGAGAAAGGGG + Intronic
1133216522 16:4295772-4295794 GCCAGGGCCTGGGAGGAAAGAGG + Intergenic
1133868807 16:9668904-9668926 TCCTGCTCTTGGAGGGAAATGGG + Intronic
1134031615 16:10996595-10996617 GCCAGGGCTGGGAGGCATAGGGG - Intronic
1136290266 16:29267441-29267463 GCCAGGGCCTGCAGGAAGATGGG - Intergenic
1137398479 16:48134047-48134069 GTCAGGGCTGGAAGGGAAGTTGG - Intronic
1138131760 16:54485859-54485881 GGCAGGGTTTGGAGGGAGGTAGG + Intergenic
1139311497 16:66031844-66031866 ACCAGGGCTTGGAAGGAAAAAGG + Intergenic
1141173580 16:81705367-81705389 CCCAGGGCTTGGTGGGCCATGGG + Intronic
1141434270 16:83990441-83990463 GAAAGGGGTGGGAGGGAAATTGG - Intronic
1141693921 16:85611319-85611341 GCCAGGGCTGGGAGGGGGAGGGG - Intergenic
1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG + Intronic
1141811303 16:86378134-86378156 GCCAGTTCTGGGAGGGAGATGGG + Intergenic
1141855283 16:86677010-86677032 GCCACTGCTTGGAGGGAACTGGG + Intergenic
1141904675 16:87016423-87016445 GCCAGGGGTTGGGGGGAAGGCGG + Intergenic
1142096152 16:88240962-88240984 GCCAGGGCCTGCAGGAAGATGGG - Intergenic
1143133220 17:4694215-4694237 GGGAGGGCTTGGTGGGCAATGGG + Intronic
1143536154 17:7541206-7541228 GCCAGTGATGGGTGGGAAATGGG - Intergenic
1145262875 17:21365212-21365234 GCCAGGGCTTAGACAGAAAATGG - Intergenic
1145815084 17:27789484-27789506 GCCAGGGTTTGGATGGAGAGTGG - Intronic
1146916786 17:36682961-36682983 GCCAGGGCAGGAAGGGAACTAGG + Intergenic
1147609135 17:41791440-41791462 GCCAGGACCTGGAGAGAAACTGG - Intergenic
1147911673 17:43859720-43859742 GGCAGGGCTAGGAGGGACAAGGG + Intronic
1147964931 17:44189480-44189502 GCCAGGGCTGGGAGGGAGGCAGG - Exonic
1148085667 17:44992451-44992473 GTCAGGGCTTGCAGGGACCTGGG + Intergenic
1148385272 17:47229861-47229883 ACCAGGGCTTTTAGGGAAAACGG + Intergenic
1148387719 17:47246872-47246894 TCCAGGGATTGGAGGGAAGGAGG + Intergenic
1148850643 17:50553375-50553397 ACCAAGGCCTGGAGGGAAAGAGG + Intronic
1148902341 17:50887887-50887909 CCCAGGGCAAGGAGCGAAATGGG - Intergenic
1149202186 17:54199845-54199867 GGCAGGGGTTGGGGGGAAAGGGG - Intergenic
1149353643 17:55817198-55817220 GCCAGGGCTTGGAGGGAAATTGG + Intronic
1149901946 17:60488494-60488516 GCCTGGTGTTGGAGAGAAATGGG + Intronic
1150212175 17:63447214-63447236 CCTAGGGGTAGGAGGGAAATGGG + Intergenic
1150492497 17:65584094-65584116 GCCAGACCTTGGATGGAAAGCGG - Intronic
1151318260 17:73337194-73337216 GCCAGGGCGGGGAGGGGAAGGGG - Exonic
1151516768 17:74601521-74601543 GCCAGGGATTGGTGGGGAAGTGG + Intergenic
1151848432 17:76674555-76674577 GACAGGGCTTGGTGGGCACTCGG - Exonic
1152079623 17:78178683-78178705 GCCCAGGCTTGGAGTGCAATGGG + Intronic
1152147127 17:78575128-78575150 GCCAGGGATGGGTGGGAAATTGG - Intronic
1152237487 17:79146180-79146202 TCCATGGCTTGGTGGGAACTGGG - Intronic
1152313992 17:79569240-79569262 GCCAGGGCTTGGGGGGAGTGGGG - Intergenic
1154009803 18:10564853-10564875 CCCAGGGCTTGGATGGGAAGTGG + Intergenic
1154137656 18:11794561-11794583 GCCAGGTGTTGGAGGGAAGAGGG + Intronic
1154526630 18:15297403-15297425 GTCAGGGGTTGGAGGGGAAGAGG - Intergenic
1156848538 18:41698672-41698694 CCCAGGGAGTGGAGGGAGATAGG + Intergenic
1158500102 18:57993363-57993385 TCCAGGGCTGGGAAGGAAATGGG + Intergenic
1159045969 18:63368410-63368432 GGCGGGGCTTGGGAGGAAATGGG - Intergenic
1159890480 18:73948594-73948616 GTCTGGGCTTGTTGGGAAATGGG + Intergenic
1159941391 18:74411682-74411704 GCCAGGGCGGGGAGGGGGATGGG - Intergenic
1160225579 18:77008652-77008674 GCCAGGGCTTGGGGGCAGAAGGG - Intronic
1160319789 18:77879736-77879758 GCCAGGTCTTGGAAGGAAGCAGG + Intergenic
1160703433 19:518547-518569 GCCTGGGCTGGGAGGGGACTGGG + Intronic
1161120526 19:2523225-2523247 GCAGGGGCTGGGAGGGAGATAGG + Intronic
1161489703 19:4555240-4555262 GTCAGGGCTTGGATGGAGGTGGG - Intronic
1162003959 19:7765339-7765361 GCCAGGTCTGGGAGGGAGGTGGG + Intronic
1162345028 19:10113877-10113899 GCCAGTGCTTGGGGGGATAGAGG - Exonic
1163186487 19:15642478-15642500 GCCAGGGCATGAAGGGATGTGGG + Intronic
1163414923 19:17180694-17180716 GGCAGGGCTTTGAGGCAAATTGG - Intronic
1163584859 19:18157952-18157974 GCCAGGGCTGGGAGGGGGCTGGG + Intronic
1163648968 19:18506091-18506113 CCCAGGGCTTGGAGGGAGGCTGG - Intronic
1164803341 19:31096215-31096237 GGCAGGGCTGGGAGAGAAAATGG + Intergenic
1165186989 19:34030997-34031019 GCCAGGCCTGGGAGTGACATAGG + Intergenic
1165500393 19:36184626-36184648 GCCAGGGGCTGGAGGGAATAGGG - Intronic
1165753633 19:38278109-38278131 GCCAGGGCTGGGGGGGAAATGGG - Intronic
1166144314 19:40823847-40823869 GCCAGGGCCTGGGAGGAAGTGGG + Intronic
1166297946 19:41897781-41897803 GCCAGGGCAGGGACAGAAATTGG - Intronic
1166403294 19:42500432-42500454 GCCAGAGGTTTGAGGGCAATGGG + Intergenic
1167915258 19:52735072-52735094 GCCAGGCCTGGGCGGGAAGTGGG + Intronic
1167980899 19:53274089-53274111 GTCATGGCTTGGAGGGAAGAGGG + Intergenic
925235665 2:2275131-2275153 GCCAGGTCTTGGAGGATAAATGG + Intronic
926208587 2:10851725-10851747 GCCAGGGGCTGGAGGGAAGGAGG - Intronic
926694727 2:15763305-15763327 ACCAGGGCACTGAGGGAAATAGG + Intergenic
927435915 2:23066051-23066073 GCCAGGGCTTAGGCGGGAATGGG - Intergenic
928272773 2:29871978-29872000 TCTAGGGCTTGGAGGACAATGGG - Intronic
928284866 2:29981183-29981205 GGCAGAGCTTGGAGTGAGATTGG - Intergenic
928815806 2:35293170-35293192 GCCAGGACTTGGGGGCAGATGGG - Intergenic
929206781 2:39305040-39305062 GCCAGGGGCTGGAGGGAAAAAGG + Intronic
929460403 2:42098989-42099011 GCCAGGCCCTGGGAGGAAATAGG - Intergenic
929675184 2:43919531-43919553 ACAAGGGCTGGGAAGGAAATAGG + Intronic
931696845 2:64877419-64877441 GCCAGGGTTGGGATGGCAATGGG - Intergenic
932771429 2:74502848-74502870 CCCAGGGCTTGATGGGAAAAAGG - Intronic
933356563 2:81217605-81217627 GCCAGGGCCTGTATGGAAATGGG - Intergenic
934308766 2:91845171-91845193 GCAGGGGCTTGGGGGGAACTGGG + Intergenic
934746603 2:96763569-96763591 CCTAGGGCTTGGAGGGACTTCGG + Intronic
935194683 2:100805908-100805930 GCCAGGAGCTGGGGGGAAATGGG + Intergenic
935724797 2:106014198-106014220 GCCAGGGGGTGAGGGGAAATGGG - Intergenic
936347886 2:111689008-111689030 GCCGGGGCTTGGAGCGAAGCTGG - Intergenic
936532322 2:113284757-113284779 GCCAGGGCTTTAAGGCAACTGGG + Intergenic
936584459 2:113741831-113741853 GCCAGGGAATGGAGAAAAATGGG + Intronic
937127457 2:119483501-119483523 GCCAGGGCTGGGAGAGAACAAGG - Intronic
937146018 2:119645334-119645356 GCCAGGGGCTGGAGGGAGGTGGG - Intronic
938985730 2:136573687-136573709 GACAGGGCCTGGAGGGAATGAGG - Intergenic
940745674 2:157564953-157564975 GTCAGGGGGTGGAGGGTAATGGG + Intronic
941238790 2:163011501-163011523 GTCAGGGCATGGGGGGAAAGGGG - Intergenic
941415068 2:165210177-165210199 TCCAGATGTTGGAGGGAAATAGG - Intergenic
942021717 2:171872696-171872718 GCCAGGGAATGGAGGGAGAAAGG + Intronic
942245293 2:174002639-174002661 GCTAGGGTTTGGAGGGAAGAAGG + Intergenic
942287045 2:174429782-174429804 GCCAGGGGTTGGAGGGAGGGTGG - Intergenic
942438505 2:176006233-176006255 GCCAGAGCTGGGAGAGAAATTGG + Intergenic
942560517 2:177213346-177213368 GCCTGGGATTGGAGGGAAGAGGG + Intronic
943032110 2:182697744-182697766 GTCTAGGCTTGGAGGGAATTAGG + Intergenic
946212758 2:218160852-218160874 GCCAGGGGATGGAGGGCAAGGGG + Intergenic
948792966 2:240388680-240388702 GCCCCGGCTTGGAGGGAGAAAGG + Intergenic
1169312279 20:4554235-4554257 GCCAGGGCTTGCTGGGAGACAGG - Intergenic
1170812328 20:19684282-19684304 GCCGGGTCTTGGGGGGAAAGTGG - Exonic
1170905860 20:20514811-20514833 GCCTGGGCTTGGAGTGCAAAAGG - Intronic
1172170456 20:32927989-32928011 TCCAGGGTTTGGAGGGAGAGGGG - Intronic
1172275446 20:33676711-33676733 GACAGGGCTTGGAGGGACCAGGG - Exonic
1172464520 20:35146377-35146399 GCCAGTGATGGGAGGAAAATGGG + Intronic
1172611282 20:36254501-36254523 GCCAGGGCCTGGAGGGAAGAGGG + Intronic
1173167454 20:40695507-40695529 CCCAGGCCTTGGAGGGACTTGGG + Intergenic
1173684286 20:44911737-44911759 CACAGGGCTTGGAGGAAGATGGG - Intronic
1174383464 20:50172298-50172320 GCCAGGGCTTGGAGCCACAGTGG + Intergenic
1174485224 20:50856701-50856723 GTCAGTGCTTGGAGAGACATGGG + Intronic
1175169615 20:57070838-57070860 GCCAGGGCTTGGCAGGAGCTTGG - Intergenic
1175252382 20:57617206-57617228 GCCAGCACTTGGAGGGAAGTTGG - Intronic
1175710041 20:61212324-61212346 CCCAGGCCTTGGAGGAACATGGG + Intergenic
1176770803 21:13071095-13071117 GTCAGGGGTTGGAGGGGAAGAGG + Intergenic
1177541541 21:22499470-22499492 GTCAGGGCATGGAGGAAAAGGGG + Intergenic
1178309745 21:31519879-31519901 GCCAGGGCCTGGAGGGAGGGTGG + Intronic
1178372629 21:32038820-32038842 GCCAGGGCATGGGGGGAAAGTGG - Intronic
1178821233 21:35977082-35977104 GGCAGGGCATGAAGGGACATGGG - Intronic
1179816245 21:43908214-43908236 ACCAGGGCTTGGGGTGAATTTGG + Intronic
1180016467 21:45088650-45088672 GCCAGAGTTTGGAGAGAAACAGG + Intronic
1180435703 22:15301362-15301384 GTCAGGGGTTGGAGGGGAAGAGG + Intergenic
1180517941 22:16165530-16165552 GTCAGGGGTTGGAGGGGAAGAGG + Intergenic
1180909377 22:19438172-19438194 GCCAGGGCTTGGGGGAAGAGGGG - Intronic
1180957410 22:19747181-19747203 GCCAGGGCATGAACAGAAATGGG - Intergenic
1181515427 22:23408703-23408725 GCCAGGGCCTGGGGTGAGATGGG + Intergenic
1181593099 22:23896571-23896593 GCCAGGGCTTGGTGGGGTGTGGG - Intronic
1181802770 22:25358223-25358245 ACCAGGGCTAGGAGGGACCTTGG + Intronic
1182436941 22:30336924-30336946 GCCAAGACTGGGAGTGAAATAGG + Intronic
1182437531 22:30340367-30340389 GCAAGGGCTTGGAGGCTAAAAGG + Exonic
1183140494 22:35933802-35933824 GAAAGGGCTTGGGGGCAAATAGG - Intronic
1183442379 22:37830436-37830458 GCCAGGCCTTGGAGGAAAAAAGG - Intergenic
1183658003 22:39201514-39201536 AGCTGGGCTTGGAGGGAAGTGGG + Intergenic
1183904717 22:41031857-41031879 GCTAGGGACTGGAGGGGAATGGG - Intergenic
1183951834 22:41356822-41356844 GGCAGGGCCTGGCGGGACATGGG + Intronic
1184347683 22:43923668-43923690 GGCGGGGCTTGGAGGGGGATGGG - Intergenic
1184973529 22:48044872-48044894 CCCAGGGCTTGGCAGGAAAACGG + Intergenic
949331173 3:2924303-2924325 GCGGGGGCTTGGGGGGTAATGGG - Intronic
949733783 3:7146533-7146555 GCCTGGGCTTGGAAGGAATCGGG - Exonic
949922064 3:9010603-9010625 TCCAGGGCTAGGAGGGCACTGGG - Intronic
950128139 3:10523508-10523530 GCCAGGGCTAGAAGTGAAGTTGG + Intronic
950194139 3:10997280-10997302 GCCAGGTCTTGCAGCGAGATTGG + Intronic
950348988 3:12328426-12328448 TCCAGGGCTGGGAAGCAAATGGG - Intronic
950495176 3:13329364-13329386 ACCAGGGGAAGGAGGGAAATGGG + Intronic
950584353 3:13881725-13881747 GCCTGAGCTTGAAGGGAGATGGG + Intergenic
950697753 3:14716641-14716663 GGCAGGGCTTTGAAGGAATTTGG - Intronic
951064239 3:18245902-18245924 GCCAGGGGATGGAGGGAGAAGGG - Intronic
951845484 3:27080123-27080145 GCCAGGTCTTCCAAGGAAATCGG - Intergenic
953312046 3:41890084-41890106 GCCAGGGGTTGGAGAAGAATGGG + Intronic
953406164 3:42660842-42660864 GCCAAGGCTTGGGCAGAAATTGG - Intronic
954314476 3:49793770-49793792 CCCAGGGCTGGGATGGAAACAGG - Intronic
954584789 3:51723817-51723839 GCCAGGGCCTGGGGGGAATAGGG - Intergenic
954730322 3:52655234-52655256 GCCAGGGGCTGGAGGGAATGGGG - Intronic
954864850 3:53719506-53719528 GCCAGGGCCTGCAGGGAATCTGG + Intronic
955152694 3:56383857-56383879 GCCAGGGGCTGGAGGGAGAAAGG - Intronic
958993362 3:100873419-100873441 TCCAGGGCAGGGAGGGAAAGGGG + Intronic
959964070 3:112333738-112333760 GCAAGGGCTAGGAGGGAGAAAGG - Intronic
960699286 3:120425018-120425040 GCTAGGGCGTGGAAGGAAAAGGG + Intronic
960844475 3:121993662-121993684 CCCAGGGCCTGGAGGGAATTGGG + Exonic
961142716 3:124568822-124568844 GCCAGGGGCTGGAGGGAATGGGG + Intronic
963017334 3:140838392-140838414 TGAGGGGCTTGGAGGGAAATGGG + Intergenic
964389745 3:156184848-156184870 CCCAGGGATGGGAGGGAAAATGG - Intronic
964409105 3:156379685-156379707 GCCTTTGCATGGAGGGAAATGGG + Intronic
964593286 3:158391533-158391555 CCAAGGGCTTTAAGGGAAATTGG - Intronic
966049896 3:175603475-175603497 GTCAGGGCCTGGAGGGAGAAGGG - Intronic
967837515 3:193977335-193977357 GCAAGGGGTTGGCAGGAAATCGG - Intergenic
968588724 4:1446993-1447015 GCGAGGGCTTGGTGGGATGTTGG - Intergenic
968911029 4:3477080-3477102 GCCAGGGGAGTGAGGGAAATCGG + Intronic
968938079 4:3624062-3624084 GCCAGAGCTGGGAGGGGAGTGGG - Intergenic
968968896 4:3783398-3783420 GCCAGGGCTGGGAGGGAGGAAGG + Intergenic
969104607 4:4796014-4796036 GGCAGGGCTTGGGGGGAATCTGG + Intergenic
969286948 4:6208471-6208493 GCCAGGGCTAGGGGAGGAATAGG + Intergenic
969934665 4:10668669-10668691 GCCTGGGCTTGGAGGGATTTGGG + Intronic
971184061 4:24356885-24356907 CCCAGGGTATGGAGGGGAATTGG - Intergenic
971615824 4:28789226-28789248 GCCAGGGTTTTGAGGGGAAGAGG - Intergenic
972887711 4:43512860-43512882 GTCAGGGGTTGGAGGGCAAGGGG - Intergenic
973632125 4:52829434-52829456 GACAGTGATTTGAGGGAAATAGG - Intergenic
973712400 4:53642832-53642854 GCCATGGCTGGGAGGGATCTGGG - Intronic
973748120 4:53984530-53984552 GTCAGAGCTTGGTGTGAAATGGG - Intronic
974117510 4:57598253-57598275 GCTAGAGTTTGGAGGGAACTTGG + Intergenic
974825051 4:67117447-67117469 GTCAGGGGGTGGAGGGAAAAGGG + Intergenic
975495917 4:75035757-75035779 GCCAGGTTTTGAAGAGAAATTGG + Intronic
976621398 4:87131444-87131466 GCCAAAGCTTTGAGGGAGATTGG + Intronic
976830140 4:89306665-89306687 GCAAGGGCTTGGAGGGGGAGGGG - Intronic
977539082 4:98293676-98293698 GCGGGGGCGTGGAGGGAAGTAGG - Intronic
981033619 4:140150760-140150782 GCGGGGGCTGGGAGAGAAATAGG + Intronic
981724320 4:147831879-147831901 GCAAGGCCTTGCAGGGAAAGGGG - Intronic
986062023 5:4200979-4201001 CCCAGGGGTTGGAGAGAGATGGG - Intergenic
986486311 5:8241940-8241962 GCCATGCTTTGGAAGGAAATTGG + Intergenic
986825047 5:11511414-11511436 GCCAGGGCTGGGAGGGGAGAAGG + Intronic
987026209 5:13929321-13929343 GCCAGGGGCTGGAGGGAAGGAGG + Intronic
988177066 5:27742538-27742560 TCCAGGGCTTGGAGGAAATAGGG - Intergenic
988517939 5:31920776-31920798 GCCAAGTGTTGGAGGGAAAAAGG - Intronic
989182807 5:38595450-38595472 CCCAGGGACTGGAGGGAAAGAGG + Intronic
990488586 5:56282601-56282623 GCCAGGGGTTGCAGGGATCTAGG - Intergenic
991594546 5:68288998-68289020 GCCAGGGCTTGGAGAGACCATGG + Intronic
991733537 5:69611414-69611436 CCTAGGGCTAGGAGGGTAATGGG + Intergenic
991809971 5:70466560-70466582 CCTAGGGCTAGGAGGGTAATGGG + Intergenic
991861417 5:71016436-71016458 CCTAGGGCTAGGAGGGTAATGGG - Intronic
992793314 5:80232950-80232972 GCCAGGGCTCTGAGGGAGTTTGG + Intronic
993181568 5:84560582-84560604 GCCAGTGCTTGGAGGGCATTGGG - Intergenic
994511812 5:100713480-100713502 GCCAGGGCTTGCATGCAGATTGG + Intergenic
996363368 5:122675039-122675061 GCCAGGGGCTGGAGGGAAAGGGG - Intergenic
997211978 5:132082180-132082202 GCCAGGGACTGGAAGGGAATTGG + Intergenic
998167739 5:139854124-139854146 GACAGGGCTGGGAGAGAAACAGG - Intronic
998217128 5:140245803-140245825 TCCAGGGCTGGGAAGCAAATGGG + Exonic
999449289 5:151666260-151666282 GCCAGGGCTTGGAGCAGTATAGG + Intronic
1001536084 5:172498809-172498831 GCCAGGCCCTGGAGGGACAGAGG - Intergenic
1001790828 5:174456398-174456420 GCCAGGGGCTGGGGGGAAAGGGG + Intergenic
1002084536 5:176764447-176764469 GCCAGGGGTTGGGGGGAAGGAGG - Intergenic
1003062482 6:2874550-2874572 GCCAGGGCTGGGAGGAACACAGG - Intergenic
1003088695 6:3082712-3082734 TCTAGGGCTTGGGGGGAAAATGG - Intronic
1003271659 6:4613153-4613175 GCCAGGGCTGGGAGAACAATGGG - Intergenic
1004882266 6:20020725-20020747 GCCAGGAGCTGGAGGGAAGTGGG + Intergenic
1005362208 6:25041649-25041671 GATAGGGCTGGGAAGGAAATAGG + Intronic
1006079896 6:31559124-31559146 GCCAGGGAGGGGAGGGAAACTGG - Intergenic
1006117192 6:31781655-31781677 GCCGGGGCTTGGCGGGACAGGGG - Intronic
1006180840 6:32152510-32152532 GCTGGGCCTTGGAGGGAAAAGGG + Intronic
1007277860 6:40688922-40688944 GAGAAGGCTTGGAGGGAAGTAGG - Intergenic
1007979358 6:46134846-46134868 GCCAGGGGTTGGGGGGGAAATGG - Intronic
1008286751 6:49662312-49662334 GCCAGGAGTTGGAGGGAAGGAGG + Intergenic
1012624861 6:101393232-101393254 GCCAGGGCTTGGAGGGCTGCTGG - Intergenic
1014082422 6:117302971-117302993 CCCAGGGCTTGGAAGGAATGAGG + Intronic
1014228578 6:118876212-118876234 GCCAGGGGTTGAAGGGAAAGAGG + Intronic
1014265334 6:119270515-119270537 AAGAGGGGTTGGAGGGAAATGGG - Intronic
1016492959 6:144627616-144627638 ACCAGGGATTGGAGGGAAGGAGG - Intronic
1016706914 6:147119470-147119492 GCCAGGGGCTGGAGGGAAGAGGG + Intergenic
1016888145 6:148978668-148978690 GTCAGGGGTTGGGGGGAAAGGGG + Intronic
1017205351 6:151799395-151799417 ACCAGAGCTTGGAGGACAATTGG - Intronic
1017758366 6:157549009-157549031 GCCAGTGCTTGGGAGGAAAGGGG + Intronic
1018493616 6:164324416-164324438 GGCAGGGAGTGGAAGGAAATGGG - Intergenic
1018711400 6:166500372-166500394 GCCAGGGCTCAGATGGAAACAGG + Intronic
1018928228 6:168221950-168221972 GCCAGGGATGGGTGGGAGATGGG + Intergenic
1019523452 7:1470543-1470565 GCCGGGGCTTGGAGGGGGGTCGG + Exonic
1019935264 7:4250946-4250968 GCCAGGGTTTGGAGGGAGAAGGG - Intronic
1020154568 7:5712106-5712128 GCCCTGGGCTGGAGGGAAATCGG - Intronic
1020264155 7:6549272-6549294 CCCAGGGCTGGGATGGAAAGAGG - Intronic
1020278041 7:6636749-6636771 GCCCGCACTTGGAGGGACATGGG - Intergenic
1022473272 7:30694585-30694607 GCCAGGGACCGGAGGGGAATGGG + Intronic
1022503135 7:30894902-30894924 GCCAGGGCTTGGAGGGGTGTTGG + Intergenic
1023627758 7:42133465-42133487 CCCAGTGTTTGGAGGGAACTCGG - Intronic
1023898569 7:44455506-44455528 GATTGGGCTTGGAGGGAAAGAGG - Intronic
1024557610 7:50616913-50616935 GCCAGGTCATGGAGCGAAGTTGG + Intronic
1024682469 7:51707396-51707418 GTCAGGGGCTGGAGGGAAAGGGG - Intergenic
1025533119 7:61915010-61915032 GGGAGGCCTTGGAGGGCAATGGG + Intergenic
1025840490 7:65141603-65141625 GCGAGTGCTTGGTGGGAACTGGG + Intergenic
1026171336 7:67956484-67956506 CCCAGGGCTTAGAGTTAAATAGG + Intergenic
1027230192 7:76267879-76267901 GCCAGGGCTTGGTGGGAAGAGGG - Intronic
1028573361 7:92317304-92317326 GCCTGGGCTTGGAGGGGTTTGGG + Intronic
1028869340 7:95750501-95750523 GCCAGGGGTTGGAGGGATAGAGG - Intergenic
1030104625 7:105976614-105976636 GCCAGGGATTGGAGGGATAAGGG - Intronic
1031575846 7:123415086-123415108 GTAAGAGCTTGGAGGGAAACGGG + Intergenic
1032263826 7:130356666-130356688 ACAAGAGCTTGGAGGCAAATGGG - Intronic
1032376508 7:131424783-131424805 GACAGGGATTGGAGGTAAAGTGG - Intronic
1033125192 7:138701236-138701258 GCCAAGTCTTAGACGGAAATTGG + Intronic
1033288108 7:140059846-140059868 GTCAGGGCTGGGAGAGAACTGGG + Intronic
1034749784 7:153557963-153557985 GTCTGGGGTTGGAGGGATATGGG - Intergenic
1035181120 7:157090427-157090449 GCCAGGGGCTGGAGGGAGAGAGG + Intergenic
1036556446 8:9864068-9864090 GCCAGAGCTTGGGGACAAATAGG - Intergenic
1037818442 8:22124159-22124181 CCTAGGGCTTGGAGGGAAGGAGG - Intronic
1038183938 8:25255511-25255533 GCCAGGGGTTAGAGGGAAGGAGG + Intronic
1042199414 8:66266767-66266789 GCTGGGGCTGGGAGGGAGATAGG + Intergenic
1042208445 8:66352551-66352573 CCCAGGGCTTTGAGGCAGATGGG - Intergenic
1043579045 8:81690630-81690652 GCAAGGGCATGGATGGAATTTGG - Intergenic
1046148352 8:110191145-110191167 GCCAGAGCTAGATGGGAAATTGG - Intergenic
1048235304 8:132683839-132683861 TCCAGGGGTGGGAGGAAAATAGG - Intergenic
1048861427 8:138727005-138727027 ACCAGGGCTGGGAGGGAGAGTGG + Intronic
1051373323 9:16377913-16377935 GCCAGGGCCTGTTGGGGAATGGG - Intergenic
1053462753 9:38283104-38283126 GCCAGGGCTTGGAACAAAATGGG - Intergenic
1053571045 9:39307540-39307562 GCCAGGAGTTTGAGGGAAAGGGG + Intergenic
1053617124 9:39779858-39779880 GCCAGGGATTTGAGGGAAGCAGG - Intergenic
1053704433 9:40736197-40736219 GTCAGGGGTTGGAGGGGAAGAGG - Intergenic
1053836930 9:42148148-42148170 GCCAGGAGTTTGAGGGAAAGGGG + Intergenic
1053897335 9:42755407-42755429 GCCAGGGATTTGAGGGAAGCAGG + Intergenic
1054092605 9:60866242-60866264 GCCAGGAGTTTGAGGGAAAGGGG + Intergenic
1054126100 9:61311472-61311494 GCCAGGAGTTTGAGGGAAAGGGG - Intergenic
1054236393 9:62562500-62562522 GCCAGGGATTTGAGGGAAGCAGG + Intergenic
1054267044 9:62927579-62927601 GCCAGGGATTTGAGGGAAGCAGG + Intergenic
1054414518 9:64859807-64859829 GTCAGGGGTTGGAGGGGAAGAGG - Intergenic
1054453093 9:65413644-65413666 GCCAGAGCTGGGAGGGGAGTGGG + Intergenic
1054550535 9:66597030-66597052 GCCAGGGATTTGAGGGAAGCAGG + Intergenic
1054593676 9:67040356-67040378 GCCAGGAGTTTGAGGGAAAGGGG - Intergenic
1055087434 9:72328354-72328376 GGCAGAGATTGGAGGGATATAGG + Intergenic
1055630807 9:78221298-78221320 GGCAGAGCTGGAAGGGAAATAGG - Intergenic
1057045771 9:91885324-91885346 GGCAGGGTGTGGAGGGAGATGGG + Intronic
1061071001 9:128310716-128310738 GCCAGGGCTGGGAAGGAAGTCGG + Intronic
1061646566 9:132007535-132007557 GCCTGGGGTGGGAGAGAAATTGG + Intronic
1062528883 9:136991135-136991157 GCCAGGACTGGGAGTGAACTGGG + Intergenic
1062729688 9:138102034-138102056 CTCAGGGCTGGGTGGGAAATGGG - Intronic
1186085129 X:5979489-5979511 GCCAGGGCTTGGTGAGGATTTGG - Intronic
1187145837 X:16636509-16636531 GCCAGGGGCTGGCGGGAAGTAGG + Intronic
1187178815 X:16922966-16922988 GCCAGGGGCTGGGAGGAAATGGG - Intergenic
1187190885 X:17033884-17033906 GCCAGAGAGTGGAGGGAAAGCGG - Intronic
1187943471 X:24403807-24403829 GCCAGGGACTGGGAGGAAATGGG - Intergenic
1188817083 X:34728918-34728940 GCCAGGCCTTGGAGAGAATAAGG + Intergenic
1188821007 X:34775064-34775086 GTCAGGGGTTGGGGGGAAAGTGG + Intergenic
1190158692 X:48014645-48014667 GCCAACACTTGGAAGGAAATTGG - Intronic
1190159798 X:48023033-48023055 GCCAGGGGCTGGGGGGAAAGGGG - Intronic
1190174390 X:48136933-48136955 GCCAACACTTGGAAGGAAATTGG - Intergenic
1190749868 X:53352730-53352752 GCCAGGGGTTTGAGGGAAGGAGG + Intergenic
1191653140 X:63563922-63563944 GCCAGGGGGTGGGGGCAAATGGG - Intergenic
1192163429 X:68806692-68806714 GCCAGGGGTTGGAGGGAGAGGGG + Intergenic
1192464447 X:71344128-71344150 GCCAGGGGTTGGGGGGAAGAGGG + Intergenic
1192682511 X:73266856-73266878 GCCAGAACTGGGAGGCAAATGGG + Intergenic
1193605400 X:83561912-83561934 GTCAGGGTGTGGAGGGTAATGGG - Intergenic
1194041117 X:88943083-88943105 GCCAGGGATTGGAGGAGAGTTGG + Intergenic
1196400520 X:115311748-115311770 GCCAGAGCTTGCAGGAATATGGG - Intergenic
1197075160 X:122344321-122344343 GTCAGGGGTTGGGGGGAAATGGG + Intergenic
1197291254 X:124661144-124661166 GCCAGGGGTTGGAAGGAGGTGGG + Intronic
1197487271 X:127068700-127068722 GTCAGGGGTTGGGGGGAAAAAGG - Intergenic
1198497728 X:137209853-137209875 GTCAGGGCTTCCAGGGAAGTAGG - Intergenic
1199921874 X:152414999-152415021 CCAAGGGCTTGGAGGAAAAGAGG + Intronic
1200102009 X:153692916-153692938 GCCATGGCTCGGAGGACAATGGG + Intronic
1201298243 Y:12483992-12484014 GCCAGGGGCTGGAGGGGAAAAGG - Intergenic
1202091802 Y:21198689-21198711 GCCAGGGGGTGGAGGGCTATGGG - Intergenic