ID: 1149358194

View in Genome Browser
Species Human (GRCh38)
Location 17:55866075-55866097
Sequence CTTCAAATGCAGATGGCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149358190_1149358194 -7 Left 1149358190 17:55866059-55866081 CCACAATCTCTCCATCCTTCAAA No data
Right 1149358194 17:55866075-55866097 CTTCAAATGCAGATGGCACCAGG No data
1149358189_1149358194 3 Left 1149358189 17:55866049-55866071 CCTCATTAAGCCACAATCTCTCC No data
Right 1149358194 17:55866075-55866097 CTTCAAATGCAGATGGCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149358194 Original CRISPR CTTCAAATGCAGATGGCACC AGG Intergenic
No off target data available for this crispr