ID: 1149368392

View in Genome Browser
Species Human (GRCh38)
Location 17:55968150-55968172
Sequence TTTTCAAAGCTGATAGTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149368392_1149368394 1 Left 1149368392 17:55968150-55968172 CCACCAACTATCAGCTTTGAAAA No data
Right 1149368394 17:55968174-55968196 CTTAAGATCAATAAGAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149368392 Original CRISPR TTTTCAAAGCTGATAGTTGG TGG (reversed) Intergenic
No off target data available for this crispr