ID: 1149370087

View in Genome Browser
Species Human (GRCh38)
Location 17:55985355-55985377
Sequence CATGGGAGGGACACAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149370087_1149370094 -6 Left 1149370087 17:55985355-55985377 CCTTCCACTGTGTCCCTCCCATG No data
Right 1149370094 17:55985372-55985394 CCCATGACATGTGGGAATTATGG 0: 134
1: 846
2: 2585
3: 4748
4: 5690
1149370087_1149370099 25 Left 1149370087 17:55985355-55985377 CCTTCCACTGTGTCCCTCCCATG No data
Right 1149370099 17:55985403-55985425 ATTCAAGATGAGATTTGGATGGG 0: 521
1: 8557
2: 11490
3: 11630
4: 9310
1149370087_1149370100 26 Left 1149370087 17:55985355-55985377 CCTTCCACTGTGTCCCTCCCATG No data
Right 1149370100 17:55985404-55985426 TTCAAGATGAGATTTGGATGGGG 0: 496
1: 8600
2: 11730
3: 9467
4: 6946
1149370087_1149370096 -5 Left 1149370087 17:55985355-55985377 CCTTCCACTGTGTCCCTCCCATG No data
Right 1149370096 17:55985373-55985395 CCATGACATGTGGGAATTATGGG 0: 138
1: 846
2: 2652
3: 4736
4: 5710
1149370087_1149370098 24 Left 1149370087 17:55985355-55985377 CCTTCCACTGTGTCCCTCCCATG No data
Right 1149370098 17:55985402-55985424 AATTCAAGATGAGATTTGGATGG 0: 546
1: 8662
2: 13006
3: 11577
4: 9085
1149370087_1149370097 20 Left 1149370087 17:55985355-55985377 CCTTCCACTGTGTCCCTCCCATG No data
Right 1149370097 17:55985398-55985420 CTACAATTCAAGATGAGATTTGG 0: 4048
1: 7216
2: 8939
3: 8984
4: 9244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149370087 Original CRISPR CATGGGAGGGACACAGTGGA AGG (reversed) Intergenic
No off target data available for this crispr