ID: 1149370092

View in Genome Browser
Species Human (GRCh38)
Location 17:55985369-55985391
Sequence TAATTCCCACATGTCATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 17306
Summary {0: 147, 1: 895, 2: 2954, 3: 5827, 4: 7483}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149370092_1149370098 10 Left 1149370092 17:55985369-55985391 CCTCCCATGACATGTGGGAATTA 0: 147
1: 895
2: 2954
3: 5827
4: 7483
Right 1149370098 17:55985402-55985424 AATTCAAGATGAGATTTGGATGG 0: 546
1: 8662
2: 13006
3: 11577
4: 9085
1149370092_1149370100 12 Left 1149370092 17:55985369-55985391 CCTCCCATGACATGTGGGAATTA 0: 147
1: 895
2: 2954
3: 5827
4: 7483
Right 1149370100 17:55985404-55985426 TTCAAGATGAGATTTGGATGGGG 0: 496
1: 8600
2: 11730
3: 9467
4: 6946
1149370092_1149370099 11 Left 1149370092 17:55985369-55985391 CCTCCCATGACATGTGGGAATTA 0: 147
1: 895
2: 2954
3: 5827
4: 7483
Right 1149370099 17:55985403-55985425 ATTCAAGATGAGATTTGGATGGG 0: 521
1: 8557
2: 11490
3: 11630
4: 9310
1149370092_1149370097 6 Left 1149370092 17:55985369-55985391 CCTCCCATGACATGTGGGAATTA 0: 147
1: 895
2: 2954
3: 5827
4: 7483
Right 1149370097 17:55985398-55985420 CTACAATTCAAGATGAGATTTGG 0: 4048
1: 7216
2: 8939
3: 8984
4: 9244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149370092 Original CRISPR TAATTCCCACATGTCATGGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr