ID: 1149370094

View in Genome Browser
Species Human (GRCh38)
Location 17:55985372-55985394
Sequence CCCATGACATGTGGGAATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 14003
Summary {0: 134, 1: 846, 2: 2585, 3: 4748, 4: 5690}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149370085_1149370094 11 Left 1149370085 17:55985338-55985360 CCCGCATGATTTCATTACCTTCC No data
Right 1149370094 17:55985372-55985394 CCCATGACATGTGGGAATTATGG 0: 134
1: 846
2: 2585
3: 4748
4: 5690
1149370088_1149370094 -10 Left 1149370088 17:55985359-55985381 CCACTGTGTCCCTCCCATGACAT No data
Right 1149370094 17:55985372-55985394 CCCATGACATGTGGGAATTATGG 0: 134
1: 846
2: 2585
3: 4748
4: 5690
1149370087_1149370094 -6 Left 1149370087 17:55985355-55985377 CCTTCCACTGTGTCCCTCCCATG No data
Right 1149370094 17:55985372-55985394 CCCATGACATGTGGGAATTATGG 0: 134
1: 846
2: 2585
3: 4748
4: 5690
1149370086_1149370094 10 Left 1149370086 17:55985339-55985361 CCGCATGATTTCATTACCTTCCA No data
Right 1149370094 17:55985372-55985394 CCCATGACATGTGGGAATTATGG 0: 134
1: 846
2: 2585
3: 4748
4: 5690

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149370094 Original CRISPR CCCATGACATGTGGGAATTA TGG Intergenic
Too many off-targets to display for this crispr