ID: 1149370095

View in Genome Browser
Species Human (GRCh38)
Location 17:55985373-55985395
Sequence CCCATAATTCCCACATGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 15070
Summary {0: 151, 1: 1048, 2: 2834, 3: 4939, 4: 6098}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149370095_1149370099 7 Left 1149370095 17:55985373-55985395 CCATGACATGTGGGAATTATGGG 0: 151
1: 1048
2: 2834
3: 4939
4: 6098
Right 1149370099 17:55985403-55985425 ATTCAAGATGAGATTTGGATGGG 0: 521
1: 8557
2: 11490
3: 11630
4: 9310
1149370095_1149370097 2 Left 1149370095 17:55985373-55985395 CCATGACATGTGGGAATTATGGG 0: 151
1: 1048
2: 2834
3: 4939
4: 6098
Right 1149370097 17:55985398-55985420 CTACAATTCAAGATGAGATTTGG 0: 4048
1: 7216
2: 8939
3: 8984
4: 9244
1149370095_1149370098 6 Left 1149370095 17:55985373-55985395 CCATGACATGTGGGAATTATGGG 0: 151
1: 1048
2: 2834
3: 4939
4: 6098
Right 1149370098 17:55985402-55985424 AATTCAAGATGAGATTTGGATGG 0: 546
1: 8662
2: 13006
3: 11577
4: 9085
1149370095_1149370100 8 Left 1149370095 17:55985373-55985395 CCATGACATGTGGGAATTATGGG 0: 151
1: 1048
2: 2834
3: 4939
4: 6098
Right 1149370100 17:55985404-55985426 TTCAAGATGAGATTTGGATGGGG 0: 496
1: 8600
2: 11730
3: 9467
4: 6946

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149370095 Original CRISPR CCCATAATTCCCACATGTCA TGG (reversed) Intergenic
Too many off-targets to display for this crispr