ID: 1149370096

View in Genome Browser
Species Human (GRCh38)
Location 17:55985373-55985395
Sequence CCATGACATGTGGGAATTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 14082
Summary {0: 138, 1: 846, 2: 2652, 3: 4736, 4: 5710}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149370085_1149370096 12 Left 1149370085 17:55985338-55985360 CCCGCATGATTTCATTACCTTCC No data
Right 1149370096 17:55985373-55985395 CCATGACATGTGGGAATTATGGG 0: 138
1: 846
2: 2652
3: 4736
4: 5710
1149370086_1149370096 11 Left 1149370086 17:55985339-55985361 CCGCATGATTTCATTACCTTCCA No data
Right 1149370096 17:55985373-55985395 CCATGACATGTGGGAATTATGGG 0: 138
1: 846
2: 2652
3: 4736
4: 5710
1149370088_1149370096 -9 Left 1149370088 17:55985359-55985381 CCACTGTGTCCCTCCCATGACAT No data
Right 1149370096 17:55985373-55985395 CCATGACATGTGGGAATTATGGG 0: 138
1: 846
2: 2652
3: 4736
4: 5710
1149370087_1149370096 -5 Left 1149370087 17:55985355-55985377 CCTTCCACTGTGTCCCTCCCATG No data
Right 1149370096 17:55985373-55985395 CCATGACATGTGGGAATTATGGG 0: 138
1: 846
2: 2652
3: 4736
4: 5710

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149370096 Original CRISPR CCATGACATGTGGGAATTAT GGG Intergenic
Too many off-targets to display for this crispr