ID: 1149370097

View in Genome Browser
Species Human (GRCh38)
Location 17:55985398-55985420
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38431
Summary {0: 4048, 1: 7216, 2: 8939, 3: 8984, 4: 9244}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149370091_1149370097 7 Left 1149370091 17:55985368-55985390 CCCTCCCATGACATGTGGGAATT 0: 182
1: 866
2: 3319
3: 5812
4: 7115
Right 1149370097 17:55985398-55985420 CTACAATTCAAGATGAGATTTGG 0: 4048
1: 7216
2: 8939
3: 8984
4: 9244
1149370092_1149370097 6 Left 1149370092 17:55985369-55985391 CCTCCCATGACATGTGGGAATTA 0: 147
1: 895
2: 2954
3: 5827
4: 7483
Right 1149370097 17:55985398-55985420 CTACAATTCAAGATGAGATTTGG 0: 4048
1: 7216
2: 8939
3: 8984
4: 9244
1149370093_1149370097 3 Left 1149370093 17:55985372-55985394 CCCATGACATGTGGGAATTATGG 0: 133
1: 887
2: 2679
3: 4912
4: 6273
Right 1149370097 17:55985398-55985420 CTACAATTCAAGATGAGATTTGG 0: 4048
1: 7216
2: 8939
3: 8984
4: 9244
1149370087_1149370097 20 Left 1149370087 17:55985355-55985377 CCTTCCACTGTGTCCCTCCCATG No data
Right 1149370097 17:55985398-55985420 CTACAATTCAAGATGAGATTTGG 0: 4048
1: 7216
2: 8939
3: 8984
4: 9244
1149370095_1149370097 2 Left 1149370095 17:55985373-55985395 CCATGACATGTGGGAATTATGGG 0: 151
1: 1048
2: 2834
3: 4939
4: 6098
Right 1149370097 17:55985398-55985420 CTACAATTCAAGATGAGATTTGG 0: 4048
1: 7216
2: 8939
3: 8984
4: 9244
1149370088_1149370097 16 Left 1149370088 17:55985359-55985381 CCACTGTGTCCCTCCCATGACAT No data
Right 1149370097 17:55985398-55985420 CTACAATTCAAGATGAGATTTGG 0: 4048
1: 7216
2: 8939
3: 8984
4: 9244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149370097 Original CRISPR CTACAATTCAAGATGAGATT TGG Intergenic
Too many off-targets to display for this crispr