ID: 1149375437

View in Genome Browser
Species Human (GRCh38)
Location 17:56039267-56039289
Sequence GACCAGGGCTAGATCTGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149375437_1149375441 -3 Left 1149375437 17:56039267-56039289 CCTTGGCAGATCTAGCCCTGGTC No data
Right 1149375441 17:56039287-56039309 GTCTTAGTTCATGGATCCCCTGG No data
1149375437_1149375445 20 Left 1149375437 17:56039267-56039289 CCTTGGCAGATCTAGCCCTGGTC No data
Right 1149375445 17:56039310-56039332 CTAAACATGTACCTCAGTCTTGG No data
1149375437_1149375446 27 Left 1149375437 17:56039267-56039289 CCTTGGCAGATCTAGCCCTGGTC No data
Right 1149375446 17:56039317-56039339 TGTACCTCAGTCTTGGCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149375437 Original CRISPR GACCAGGGCTAGATCTGCCA AGG (reversed) Intergenic