ID: 1149375440

View in Genome Browser
Species Human (GRCh38)
Location 17:56039283-56039305
Sequence GGGATCCATGAACTAAGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149375440_1149375445 4 Left 1149375440 17:56039283-56039305 CCTGGTCTTAGTTCATGGATCCC No data
Right 1149375445 17:56039310-56039332 CTAAACATGTACCTCAGTCTTGG No data
1149375440_1149375446 11 Left 1149375440 17:56039283-56039305 CCTGGTCTTAGTTCATGGATCCC No data
Right 1149375446 17:56039317-56039339 TGTACCTCAGTCTTGGCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149375440 Original CRISPR GGGATCCATGAACTAAGACC AGG (reversed) Intergenic