ID: 1149375445

View in Genome Browser
Species Human (GRCh38)
Location 17:56039310-56039332
Sequence CTAAACATGTACCTCAGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149375440_1149375445 4 Left 1149375440 17:56039283-56039305 CCTGGTCTTAGTTCATGGATCCC No data
Right 1149375445 17:56039310-56039332 CTAAACATGTACCTCAGTCTTGG No data
1149375437_1149375445 20 Left 1149375437 17:56039267-56039289 CCTTGGCAGATCTAGCCCTGGTC No data
Right 1149375445 17:56039310-56039332 CTAAACATGTACCTCAGTCTTGG No data
1149375439_1149375445 5 Left 1149375439 17:56039282-56039304 CCCTGGTCTTAGTTCATGGATCC No data
Right 1149375445 17:56039310-56039332 CTAAACATGTACCTCAGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149375445 Original CRISPR CTAAACATGTACCTCAGTCT TGG Intergenic
No off target data available for this crispr