ID: 1149375446

View in Genome Browser
Species Human (GRCh38)
Location 17:56039317-56039339
Sequence TGTACCTCAGTCTTGGCCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149375439_1149375446 12 Left 1149375439 17:56039282-56039304 CCCTGGTCTTAGTTCATGGATCC No data
Right 1149375446 17:56039317-56039339 TGTACCTCAGTCTTGGCCGCTGG No data
1149375440_1149375446 11 Left 1149375440 17:56039283-56039305 CCTGGTCTTAGTTCATGGATCCC No data
Right 1149375446 17:56039317-56039339 TGTACCTCAGTCTTGGCCGCTGG No data
1149375443_1149375446 -10 Left 1149375443 17:56039304-56039326 CCCTGGCTAAACATGTACCTCAG No data
Right 1149375446 17:56039317-56039339 TGTACCTCAGTCTTGGCCGCTGG No data
1149375442_1149375446 -9 Left 1149375442 17:56039303-56039325 CCCCTGGCTAAACATGTACCTCA No data
Right 1149375446 17:56039317-56039339 TGTACCTCAGTCTTGGCCGCTGG No data
1149375437_1149375446 27 Left 1149375437 17:56039267-56039289 CCTTGGCAGATCTAGCCCTGGTC No data
Right 1149375446 17:56039317-56039339 TGTACCTCAGTCTTGGCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149375446 Original CRISPR TGTACCTCAGTCTTGGCCGC TGG Intergenic