ID: 1149383284

View in Genome Browser
Species Human (GRCh38)
Location 17:56116091-56116113
Sequence CATTTCCCAGCCATGTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 356}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149383280_1149383284 1 Left 1149383280 17:56116067-56116089 CCACCTCTCCAAAGTCTTTCCTG 0: 1
1: 1
2: 7
3: 62
4: 586
Right 1149383284 17:56116091-56116113 CATTTCCCAGCCATGTCCCCAGG 0: 1
1: 0
2: 3
3: 30
4: 356
1149383281_1149383284 -2 Left 1149383281 17:56116070-56116092 CCTCTCCAAAGTCTTTCCTGACA 0: 1
1: 0
2: 2
3: 48
4: 329
Right 1149383284 17:56116091-56116113 CATTTCCCAGCCATGTCCCCAGG 0: 1
1: 0
2: 3
3: 30
4: 356
1149383282_1149383284 -7 Left 1149383282 17:56116075-56116097 CCAAAGTCTTTCCTGACATTTCC 0: 1
1: 0
2: 2
3: 25
4: 340
Right 1149383284 17:56116091-56116113 CATTTCCCAGCCATGTCCCCAGG 0: 1
1: 0
2: 3
3: 30
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149383284 Original CRISPR CATTTCCCAGCCATGTCCCC AGG Intronic
900325914 1:2108607-2108629 CTCTCTCCAGCCATGTCCCCAGG + Intronic
900375739 1:2353789-2353811 CATGTCCCCACCATGTCCCAGGG + Intronic
900598283 1:3492404-3492426 CATGGCCCACCCCTGTCCCCTGG + Intronic
901631952 1:10652307-10652329 CACTTCCTAGCCATGTGCCCGGG + Intronic
902086052 1:13863317-13863339 CATTTTCCAGCCTAGCCCCCTGG + Intergenic
902222448 1:14975477-14975499 CTTTTCCCAGCCATAGCACCAGG - Intronic
902470673 1:16646015-16646037 CATTACCCAGCCAGGGGCCCTGG - Intergenic
902488130 1:16761445-16761467 CATTACCCAGCCAGGGGCCCTGG + Intronic
902942205 1:19808562-19808584 CATATCTCAGCCCTGTCCCTCGG + Intergenic
903265812 1:22157275-22157297 AATTTCCCAGCTGTGACCCCAGG + Intergenic
903474068 1:23607389-23607411 CACCTCCCAGCCCTGTTCCCTGG + Intronic
903920754 1:26798860-26798882 CATTTACCAGCCATGTGACTTGG + Intergenic
904158647 1:28505832-28505854 CATTCCCCAGCAAGGTCCCGCGG + Intergenic
904571615 1:31470466-31470488 AATTTCCCACCCAAGACCCCTGG - Intergenic
904925446 1:34044006-34044028 CTTCTCCCAGCCATCGCCCCAGG + Intronic
904991110 1:34593393-34593415 CAGCTCCCAGCCCTGTCCCTTGG - Intergenic
905494994 1:38377998-38378020 CATTTTCCAGCCTTGTCACCGGG + Intergenic
906519998 1:46461259-46461281 CGTTTCCCTGCCTTGTCCCAGGG + Intergenic
907657193 1:56356332-56356354 CATTTCCCAAACATGTACCAAGG + Intergenic
908150451 1:61295844-61295866 CATTTCCATCCCAGGTCCCCTGG + Intronic
908206030 1:61850724-61850746 CATTTACCAGCCATGTGCTTTGG + Intronic
911115886 1:94246858-94246880 CTTTTCCCAGCCATGGCTCTAGG - Intronic
911621983 1:100075178-100075200 CATGGGCCAGCCATGTACCCTGG - Intronic
912004704 1:104883336-104883358 CTCTTCCCAACCCTGTCCCCTGG + Intergenic
913685358 1:121226610-121226632 CTTTTCCAAGCCAGGTCTCCAGG - Intronic
914037204 1:144014214-144014236 CTTTTCCAAGCCAGGTCTCCAGG - Intergenic
914152251 1:145053718-145053740 CTTTTCCAAGCCAGGTCTCCAGG + Intronic
915332859 1:155124572-155124594 CATTGCCCAGAGATGACCCCTGG + Intergenic
915826335 1:159081825-159081847 CCCTTCCCAGCCAAGTCCCTGGG + Intronic
917188681 1:172390410-172390432 CATTTCCTGACCATGACCCCAGG + Intronic
918646764 1:186915092-186915114 CATTTTCCAAACATGGCCCCAGG + Intronic
919039113 1:192359564-192359586 CAGTTCACAGACATGTCCCAAGG + Intronic
920472675 1:206245168-206245190 CTTTTCCAAGCCAGGTCTCCAGG - Intronic
920880963 1:209880220-209880242 CATGTGTCAGCCATTTCCCCTGG - Intergenic
921075033 1:211693843-211693865 CATTTTCCAAACATGGCCCCAGG - Intergenic
921188436 1:212689376-212689398 CATTCCCCAGGCAGGTTCCCAGG + Intronic
921502651 1:215924731-215924753 TATTTCCCACCCCTCTCCCCTGG + Intronic
923606733 1:235450827-235450849 CATTTACCAGCCCTGTGACCTGG - Intronic
924084956 1:240441354-240441376 CATTTCCTATCCATGTCCCAGGG - Intronic
1062818468 10:516966-516988 CACTTCCCAGCAATGGCCACAGG + Intronic
1064259916 10:13777098-13777120 CTTTTCCCAGGCATGCCCCTTGG - Intronic
1064304321 10:14151745-14151767 CATTTCCAAGAAATGTTCCCTGG - Intronic
1065151840 10:22830515-22830537 CAGTTACCAGCCATGCCCTCAGG + Intergenic
1065315325 10:24458231-24458253 GATTTCCAAGCCATGCTCCCTGG + Intronic
1065499138 10:26361936-26361958 AATTACCCAGCCAGGTCCTCAGG - Intergenic
1065598576 10:27344797-27344819 GCTTTCCCAGCCCTGCCCCCGGG + Intergenic
1068687851 10:59887905-59887927 CATTTACCAGCACTGTTCCCTGG + Intronic
1068779271 10:60902059-60902081 CCTGACCCAGCCTTGTCCCCAGG - Intronic
1068901049 10:62269188-62269210 CCTTTCCCAGCGTTGTCACCAGG + Intergenic
1070619871 10:78001094-78001116 CATTTCTGGTCCATGTCCCCAGG - Exonic
1070668415 10:78361501-78361523 CATTTCCCAGCCCTCTGACCAGG + Intergenic
1071282635 10:84116451-84116473 CATTTTCCAAACATGGCCCCAGG - Intergenic
1071479766 10:86056448-86056470 CATTTCCAACCCGTGTCCCAAGG + Intronic
1072335222 10:94391868-94391890 CATTTTCCAAACATGGCCCCAGG - Intergenic
1073144871 10:101273937-101273959 CATTTCCCAGCTATGTCCTCAGG - Intergenic
1073323601 10:102629976-102629998 GATTGCCCAGGCCTGTCCCCGGG - Intronic
1074272910 10:111972448-111972470 CATTACCCACCCCTGTCACCCGG - Intergenic
1076356511 10:129857487-129857509 CACCTCCCAACCATCTCCCCAGG + Intronic
1076362935 10:129902417-129902439 CATTTCCAATCCATGGCCACTGG + Intronic
1076659223 10:132044236-132044258 CATTTCCTAGACACGTCTCCTGG + Intergenic
1077383811 11:2259726-2259748 CAGGTCTCAGCCATGGCCCCAGG - Intergenic
1080570571 11:33552974-33552996 CATTTCCCAGGGATTTTCCCTGG - Intronic
1081190725 11:40100391-40100413 CAGTTACCAGCCATGCCCTCAGG - Intergenic
1081445815 11:43130630-43130652 CCTTTCCCAGTCATGGCCCCTGG - Intergenic
1083090300 11:60192459-60192481 CATTTTCCAAACATGGCCCCAGG - Intergenic
1083197590 11:61098115-61098137 CATTTTCCAAACATGGCCCCAGG - Intergenic
1083298695 11:61728866-61728888 CCTTTCCCAGCCATGCAGCCGGG + Intronic
1083460481 11:62807628-62807650 CTTCTCCCGGCCTTGTCCCCAGG - Exonic
1083615502 11:64024053-64024075 CCTCTCCAAGCCCTGTCCCCAGG + Intronic
1084496191 11:69505046-69505068 CACCTCCCAGCCATGTGCCCTGG + Intergenic
1085518640 11:77125739-77125761 CTTTGCTCAGCCATGTCCCCTGG + Exonic
1086296093 11:85369651-85369673 CACTTACCAGCTATGCCCCCAGG - Intronic
1086402156 11:86469747-86469769 CATTTCCCAGCTGAGTCCCCAGG - Intronic
1088322183 11:108565578-108565600 CTTTTCCCAGCCAATTGCCCTGG + Intronic
1088593030 11:111419537-111419559 CATTTCCCACCCTAGTCCCAAGG - Intronic
1089398754 11:118152622-118152644 CAGTGCCCAGCCATCTCGCCGGG + Exonic
1089498757 11:118920913-118920935 CATACCCCAGACATGTTCCCAGG + Intronic
1089650040 11:119907071-119907093 CATTTCCCAGGCAAGCCCCTGGG - Intergenic
1090398775 11:126435403-126435425 CCTTTCCCAGTCATGTCTCTGGG + Intronic
1090611710 11:128477128-128477150 CATCTCCCTGCCATTTCACCAGG - Intronic
1090664603 11:128906065-128906087 CCTTTCCCAGCCCTGCCCCCTGG + Intronic
1090704551 11:129324654-129324676 CCAGTCCCAGCCCTGTCCCCAGG - Intergenic
1091094645 11:132809221-132809243 CATTTCCCATTCATTTCCCTGGG + Intronic
1091208971 11:133840829-133840851 CATCTCCCTGCTGTGTCCCCTGG - Exonic
1091861790 12:3792122-3792144 CACTTCCTAGCTATGTGCCCTGG + Intronic
1091924081 12:4329778-4329800 CATTTCCCAGCATTTTCTCCAGG + Intronic
1092656430 12:10689803-10689825 CCATTCCCACACATGTCCCCTGG + Intergenic
1093593691 12:20937754-20937776 CATTTTCCAAACATGGCCCCAGG + Intergenic
1095232993 12:39764183-39764205 CATCTCCCAGCTATCTCCCCAGG - Intronic
1096542036 12:52313371-52313393 CCTTTCCCACCCATCTCACCAGG - Intergenic
1098328275 12:69325133-69325155 TGCTTCCCAGCCATGTCACCTGG - Intergenic
1099282903 12:80675462-80675484 CATTTTCCTCCCATGTCCCTAGG + Intronic
1102013046 12:109630847-109630869 CATTTATCAGCCATGACACCTGG + Intergenic
1102224417 12:111217776-111217798 CATTTCCCAAGCATGTCCCGTGG - Intronic
1102687258 12:114734650-114734672 CATTTCCCAGCCATTACCAGCGG + Intergenic
1103276539 12:119716745-119716767 CATTTCCCAGGAATTTCTCCAGG + Intronic
1103394521 12:120597539-120597561 CATTTCCCAGCAATGGGCCCCGG + Intergenic
1103518589 12:121523241-121523263 TATTTCCCAGCCTTTCCCCCGGG - Intronic
1103563249 12:121803605-121803627 CAGACCCCAGCCATCTCCCCGGG + Intergenic
1105615985 13:22012865-22012887 CATTTCTCTTCCATGTCACCAGG - Intergenic
1106864682 13:33950565-33950587 CTTGCCCCAGCCATGTTCCCTGG + Intronic
1107560385 13:41552400-41552422 CCTTTCCCAGCCATGGGCACTGG - Intergenic
1109235371 13:59811769-59811791 CATTTCAAAGCCAGGTCCTCTGG + Intronic
1109803403 13:67405174-67405196 CATTTTCCAAACATGGCCCCAGG - Intergenic
1110249723 13:73367810-73367832 CATTTCCCAGCCCTGACTCCTGG - Intergenic
1110613705 13:77517759-77517781 CATTTCCCAGCCATGTTAGTTGG - Intergenic
1114645712 14:24254940-24254962 CCTTACCCAGCCCTGCCCCCTGG - Intronic
1116240647 14:42338465-42338487 CATTTTCCAAACATGGCCCCAGG + Intergenic
1116557798 14:46334779-46334801 CTTTTCCTACCCATGTCCTCTGG - Intergenic
1117623467 14:57611460-57611482 CATTTCCCAGGACTGTTCCCCGG - Intronic
1117953837 14:61107792-61107814 CTTTTCCCTGCCATGTGTCCTGG + Intergenic
1118535593 14:66760113-66760135 CATTTACTACCCATTTCCCCCGG + Intronic
1119194085 14:72704095-72704117 CACTTCCTAGCCATGACCTCAGG - Intronic
1119439841 14:74620716-74620738 CATTTACCAGTTATGTGCCCTGG + Intergenic
1121472223 14:94164824-94164846 CACTTCCCAGCCTAGTCACCAGG + Intronic
1121493741 14:94378078-94378100 CAGATACCAGCCATGACCCCAGG - Exonic
1122011859 14:98756979-98757001 CTTCTCCCAGCTATGTCCTCAGG - Intergenic
1122093157 14:99353191-99353213 TATTTGCCAGCCCTGTCACCCGG + Intergenic
1122214124 14:100192434-100192456 CCCTCCCCAGCCATGGCCCCAGG - Intergenic
1125983243 15:44023230-44023252 CATTTCCCCTCAATTTCCCCAGG + Intronic
1127095810 15:55511415-55511437 CATTTTCCAAACATGGCCCCAGG + Intergenic
1128262647 15:66243277-66243299 TGTTTCCCAGAAATGTCCCCTGG + Intronic
1128348647 15:66874058-66874080 CTCTTCCCAGGCATGTACCCGGG + Intergenic
1128360324 15:66957230-66957252 CTTTTCCAGGCCATTTCCCCTGG - Intergenic
1128715744 15:69906434-69906456 CCTCTCCTAGGCATGTCCCCAGG + Intergenic
1129509134 15:76107686-76107708 CATGTGTCAGCCATGTCCCAGGG + Intronic
1129694874 15:77734850-77734872 CCTTCCCCAGCCATGTTCCTGGG - Intronic
1130195528 15:81777160-81777182 CATGCCCCAGCCATGTTCCCAGG + Intergenic
1130649938 15:85756692-85756714 CATGTCCCAGCCCCGGCCCCAGG - Intergenic
1137019954 16:35414971-35414993 AATTTCCCTGCCATCTGCCCGGG + Intergenic
1138751935 16:59433062-59433084 CATCTCCCAGCCCTGTGCACTGG - Intergenic
1139258069 16:65562589-65562611 CATCACCCAGCCATTTCCCCAGG + Intergenic
1139917321 16:70436896-70436918 CATTTCCCACCCCTCTCCCCAGG + Intronic
1140395171 16:74620226-74620248 CATTTCCCAGACTTGTCTGCTGG - Intergenic
1141435793 16:83999064-83999086 TGGTTCACAGCCATGTCCCCAGG - Intronic
1141807503 16:86351691-86351713 CAGCTCCCAGCCATAGCCCCAGG - Intergenic
1142127125 16:88415709-88415731 CACATCTCAGCCATGTGCCCTGG + Intergenic
1142263446 16:89053034-89053056 CCTTCCCCTGCCAGGTCCCCTGG + Intergenic
1143993235 17:10985071-10985093 CATTTCACAGCCCTTTCCCTTGG + Intergenic
1144736818 17:17560073-17560095 CATGCCCCAGCCAGGTCACCGGG - Intronic
1145275524 17:21427064-21427086 CATTTCCCAGGCATGGCCATGGG - Intergenic
1145313375 17:21712958-21712980 CATTTCCCAGGCATGACCATGGG - Intergenic
1145711823 17:26984914-26984936 CATTTCCCAGGCATGACCATGGG - Intergenic
1147659826 17:42111569-42111591 CAGTACCCAGCCATGTCCTGCGG - Intronic
1148124884 17:45231435-45231457 CACTTCCCAGCCCTTACCCCTGG - Intronic
1149383284 17:56116091-56116113 CATTTCCCAGCCATGTCCCCAGG + Intronic
1149439614 17:56663606-56663628 CATTTCTCTGGCTTGTCCCCAGG + Intergenic
1149650986 17:58276348-58276370 CATGTCCTAGCCCTCTCCCCTGG - Intronic
1149868223 17:60162185-60162207 CAACTCCCAGCCAAGTCACCAGG + Intronic
1150461419 17:65356780-65356802 CACTTCCCAGCCAGGGACCCAGG + Intergenic
1152076355 17:78162300-78162322 CACTTGCCAGCCATGTGGCCTGG - Intronic
1152359015 17:79821691-79821713 CATTTCCTAGCTCTGTGCCCTGG - Intergenic
1152455364 17:80412787-80412809 CATTTTCCAAACATGGCCCCAGG - Intergenic
1152760984 17:82106946-82106968 CAGGTCACCGCCATGTCCCCGGG + Intronic
1152835303 17:82526309-82526331 GATTGCCAAGCCATGTCCCTTGG - Intronic
1152944149 17:83189966-83189988 CATTTCTCAGGCAGGGCCCCTGG - Intergenic
1153830781 18:8920625-8920647 CATTTTCCAAACATGGCCCCAGG - Intergenic
1155624206 18:27815627-27815649 CATTTCACAGGTATGTCCACTGG + Intergenic
1155784854 18:29883704-29883726 CAGTTACCAGCCATGCCCCCAGG + Intergenic
1157160583 18:45310594-45310616 CATTTCCTAGCAATGCCCCATGG - Intronic
1157691332 18:49684492-49684514 CAGCTCTCAGCCCTGTCCCCTGG - Intergenic
1158623419 18:59051564-59051586 CATTTCCCAGACAGGTCCCCAGG - Intergenic
1158817526 18:61120512-61120534 CATTTACCAGCCCTGTGACCTGG + Intergenic
1159067484 18:63586175-63586197 TATTGCCCAGCCATTTCCACAGG - Intergenic
1160720590 19:595445-595467 CCCTCCCCAGTCATGTCCCCTGG + Intronic
1160981473 19:1818436-1818458 CCCTTCCCACCCATGGCCCCCGG - Intronic
1161344702 19:3762585-3762607 CATTTCCCAGACACCTCCACGGG + Intergenic
1161703838 19:5808621-5808643 CATCTCCCTGCATTGTCCCCTGG + Intergenic
1161984924 19:7647795-7647817 CATTGCCCTGCCCTGACCCCTGG + Exonic
1162139816 19:8578969-8578991 CAATTCTCAGCAATGTCTCCAGG + Intergenic
1163120451 19:15214116-15214138 CTGGACCCAGCCATGTCCCCTGG + Intergenic
1163251709 19:16129718-16129740 CCTTTCCCAGCAATGTCCCATGG - Intronic
1163633053 19:18426782-18426804 CATTCCCCAGACATTGCCCCAGG + Intronic
1163777634 19:19227455-19227477 CAGCTCCCAGCCCTGCCCCCTGG + Exonic
1164774818 19:30844752-30844774 CATTTCCTACCCATGTCCCCTGG - Intergenic
1164911397 19:32015133-32015155 CTTTTCCCAGCCAGGACCACGGG - Intergenic
1165024317 19:32948625-32948647 CACATCCCAGCCATGTTGCCAGG + Intronic
1165837987 19:38770986-38771008 TATTTGCCAGCCAAGGCCCCGGG + Exonic
1165841578 19:38791711-38791733 TATTTGCCAGCCAAGGCCCCGGG - Exonic
1166981469 19:46634480-46634502 CCTTGCCCAGCCCTGTTCCCAGG + Intronic
1167014822 19:46834229-46834251 CATCTCCCTCCCATTTCCCCTGG + Intergenic
1202703068 1_KI270713v1_random:2795-2817 CATTACCCAGCCAGGGGCCCAGG - Intergenic
925361983 2:3286114-3286136 CTTTTTCCAGCCAAGCCCCCAGG + Intronic
925977043 2:9149055-9149077 CATTTCCAAGTCACCTCCCCAGG - Intergenic
926321502 2:11751451-11751473 CTTTTCCCAGGCTGGTCCCCAGG + Intronic
926942445 2:18152540-18152562 CATATCCCAGCCACCTCCCAGGG - Intronic
927512754 2:23654643-23654665 CATCTCCCAGCCCTGCCCACCGG - Intronic
927519537 2:23690566-23690588 CATTTCCCAGCCACGTGGCCAGG + Intronic
928231618 2:29503707-29503729 CACATCCCAGCCATGTTGCCTGG - Intronic
929831681 2:45351896-45351918 CATCTCCCTTCCCTGTCCCCTGG - Intergenic
929984961 2:46720295-46720317 CAGTTCCCAGCAATGTCTGCAGG - Intronic
930011117 2:46939576-46939598 CCTTTGCCAGCCCTGCCCCCAGG - Intronic
932487346 2:72092180-72092202 CAGTACCCAGCCATTGCCCCAGG - Intergenic
932992971 2:76811120-76811142 CTTTTACCAGCCATGAACCCTGG + Intronic
934980429 2:98835237-98835259 CATTTCCTAGCTATATCCACTGG + Intronic
935721076 2:105979823-105979845 CATTTTCCAAACATGGCCCCAGG + Intergenic
935755511 2:106273446-106273468 CCTTGCACAGCCAGGTCCCCAGG + Intergenic
936083975 2:109453895-109453917 CATCTTCGGGCCATGTCCCCTGG - Intronic
936480892 2:112883923-112883945 CATTCCCCAGTGATGTCACCAGG - Intergenic
937482402 2:122276313-122276335 TCTTTCACAGCCATGTCCCATGG - Intergenic
938185970 2:129232175-129232197 ATTTTCTCAGCCATGCCCCCTGG + Intergenic
938770878 2:134499690-134499712 CCTTCCCCAGCCCTGTCCCTTGG - Intronic
938844847 2:135197798-135197820 CACTTCCCAGCTCTGTTCCCTGG + Intronic
939409377 2:141804559-141804581 CTCTTCCCAGCCATGTCCTTAGG + Intronic
940178614 2:150906683-150906705 CATTCCCCAGCCACTTGCCCAGG + Intergenic
940431983 2:153602814-153602836 CATTTCTCTGCCATTGCCCCTGG - Intergenic
942839040 2:180337304-180337326 CAATTACCAGCCATGCCCTCAGG - Intergenic
945946753 2:216002306-216002328 CACTTTGCAGCCATATCCCCAGG - Intronic
946182451 2:217956802-217956824 CTCTTCCCAGCAATCTCCCCAGG - Intronic
947650906 2:231785770-231785792 CATTTCTTAGCCATCTTCCCAGG + Intronic
947930152 2:233958307-233958329 CATTTTCCAGCCATGTGACCTGG - Intronic
1168894178 20:1312533-1312555 CTCACCCCAGCCATGTCCCCAGG - Intronic
1169188924 20:3644682-3644704 CAACTTCCAGCCATCTCCCCTGG + Intronic
1170166856 20:13368667-13368689 CAGTTCCCTTCCATATCCCCTGG - Intergenic
1170590917 20:17771210-17771232 CATGTCCCTGCCATCTCCCAAGG + Intergenic
1172390398 20:34561373-34561395 CATCTTCCAGCCAGGTGCCCAGG + Intronic
1173249269 20:41356096-41356118 CATTTCTCAGCCAGGTCCTGAGG - Intronic
1173842632 20:46168086-46168108 CTCGTCCCTGCCATGTCCCCAGG - Intergenic
1173897725 20:46563380-46563402 CATTTCCCAGCAGAGGCCCCGGG - Intronic
1174557789 20:51408102-51408124 CATTTCCCACCCATGTGGCAGGG + Intronic
1175033138 20:55974739-55974761 CATGTCCCAGCAATGCCCTCAGG + Intergenic
1175714878 20:61248530-61248552 CACCTCACAGCCATGCCCCCAGG + Intergenic
1176065118 20:63190459-63190481 CATTGCCCACCCCTGTGCCCTGG + Intergenic
1176267452 20:64217677-64217699 CATTTCCCAGCCCTGCCTCTGGG + Intronic
1178422767 21:32455545-32455567 CATTTCTCAGCCACCTGCCCTGG + Intronic
1178619987 21:34166033-34166055 CAATTACCAGCCATGCCCCCAGG + Intergenic
1178794930 21:35735118-35735140 CAGATCCCATCCCTGTCCCCAGG - Intronic
1179417474 21:41209798-41209820 CATTTCCTAGCCATGGTCCCAGG - Intronic
1179550456 21:42140440-42140462 CACCTCCCAGCCATGTGACCTGG - Intronic
1179988002 21:44931958-44931980 CAGGTCCCAGCCAGGTGCCCTGG + Intronic
1180138784 21:45878263-45878285 CATTTCCCATCCCTGCCCTCCGG + Intronic
1181773945 22:25146402-25146424 CTTTTCCTAGCCTTGCCCCCAGG + Intronic
1183785328 22:40025956-40025978 CATTTCCCAGTCATCTCCCTGGG - Intronic
1184042253 22:41951201-41951223 CTTTTCCCAGCCACGCCCCGTGG + Intergenic
1184044010 22:41960946-41960968 CCTTTCCCAGACTTCTCCCCTGG + Intergenic
1184464474 22:44660702-44660724 CTGCTCCCAGCCATCTCCCCAGG - Intergenic
1184556557 22:45236326-45236348 TATTTCCCAGCCCTGGCCTCGGG - Intronic
1185236507 22:49716644-49716666 CATTGCCAAGCCCTGCCCCCCGG + Intergenic
1185372237 22:50466287-50466309 CTTTGCCCAGCCGCGTCCCCTGG - Intronic
950468806 3:13172184-13172206 CCTTCCCCAGCCAAGTCCTCCGG + Intergenic
952838989 3:37628431-37628453 TCTTTACCAGCCATGTGCCCTGG + Intronic
953107257 3:39895736-39895758 CATTGCCCATTTATGTCCCCAGG - Intronic
953150439 3:40319670-40319692 CCTTTCCCACACATGTGCCCTGG + Intergenic
953651471 3:44809103-44809125 CCTTTCCCAGCACTGTCCGCAGG + Intronic
953690086 3:45110571-45110593 AAGTTCCCCGCCATGTTCCCAGG + Exonic
954298758 3:49688239-49688261 CATTACCCAGCCAGGGGCCCTGG + Intronic
954961641 3:54570750-54570772 CATTTGCCAGCCTTGTGACCTGG - Intronic
955241023 3:57178196-57178218 CATTTCCCAGCTCTGTCTGCTGG - Intergenic
955612890 3:60776146-60776168 CAATTACCAGCCATGCCCTCAGG - Intronic
957088980 3:75709396-75709418 CATGATCCAGTCATGTCCCCAGG + Intergenic
957406623 3:79780247-79780269 CATTTTCCAAACATGGCCCCAGG - Intergenic
961186790 3:124921985-124922007 CATTGCCCAGGCCTCTCCCCTGG - Intronic
962814650 3:138987373-138987395 CCTTTCCCAGCCCTGGTCCCTGG - Intergenic
964521981 3:157579942-157579964 CATTTTCCAAACATGGCCCCAGG + Intronic
964932594 3:162045237-162045259 CATTTTCCAAACATGGCCCCAGG + Intergenic
966541929 3:181101531-181101553 CATTTCCCACTCCTGTTCCCGGG + Intergenic
966660861 3:182412793-182412815 CATTTACCAGCCATTTACTCTGG + Intergenic
967968672 3:194983778-194983800 CATTTCCCAGCCAGGAGCCCTGG - Intergenic
968563528 4:1297175-1297197 CAGTTGACAGCGATGTCCCCCGG + Intronic
969043227 4:4317484-4317506 CCCTTCCCAGCCCTGGCCCCTGG + Intronic
969078432 4:4599210-4599232 CATCCCCAAGCCATGTGCCCTGG - Intergenic
969660557 4:8525114-8525136 CATCTCCCAGGGATGTGCCCGGG - Intergenic
970315600 4:14825817-14825839 CATTTGCCAGCTAAGTCCCATGG + Intergenic
970726531 4:19052006-19052028 CAATTCCCAGTCATCTTCCCGGG - Intergenic
971941704 4:33224081-33224103 CATTCCCCATCCATGTCCTGGGG + Intergenic
973218128 4:47694740-47694762 TATTTCCCACCCATGTTCCTGGG + Intronic
975373278 4:73612960-73612982 CTTTTCTCACCCATTTCCCCTGG + Intronic
975734327 4:77366880-77366902 CAGTTACTAGCCATGTCCTCGGG - Intronic
976126897 4:81843036-81843058 CATTTCTCAGCCTTGCCCCTTGG + Intronic
976320591 4:83710163-83710185 CATTTCCCCTCCATGGTCCCTGG + Intergenic
976436418 4:85023524-85023546 CTTTTCCCAGACATTCCCCCAGG - Intergenic
976948642 4:90800496-90800518 CATTTCCTAGCTATCTCCTCTGG + Intronic
979746654 4:124222855-124222877 CATGTCTCAGCAATGTACCCAGG + Intergenic
980073416 4:128266960-128266982 CATTTTCCAAACATGGCCCCAGG - Intergenic
980822567 4:138036525-138036547 CTTTTCAAAGCCATGACCCCTGG - Intergenic
983562550 4:169115689-169115711 CATTTCCCCGCCACCACCCCTGG + Intronic
983898370 4:173105517-173105539 CATTTTCCAAACATGGCCCCAGG - Intergenic
984795031 4:183652338-183652360 CAGTCCCCAGCCCTCTCCCCTGG + Intronic
984849481 4:184141567-184141589 CATTTCCCTGCGATGTTCCCTGG - Intronic
986074267 5:4318497-4318519 CATTTCCCAGCCAGACCCCTGGG + Intergenic
987155244 5:15082478-15082500 CACTTCCCAGCCACGTGTCCAGG - Intergenic
988555567 5:32233008-32233030 CATTTCCTAGCTCTGTCTCCAGG - Intronic
989998529 5:50864293-50864315 CAAGTCCCAGTCATGTCCCTAGG + Intergenic
991091021 5:62694257-62694279 CATTTTCCCACCCTGTCCCCTGG + Intergenic
991553838 5:67873288-67873310 CATTTCTCAGCCATGAACACAGG - Intergenic
991675761 5:69088523-69088545 CATTTTCCAAACATGGCCCCAGG + Intergenic
996943899 5:129043561-129043583 CATTTCCCAGCTTTGCCCCGAGG + Intergenic
997364384 5:133316387-133316409 CATTTCCCACCCCGGCCCCCTGG - Intronic
997619124 5:135273300-135273322 CAGTTCCCACCCATGGCCCTTGG - Intronic
998709256 5:144803560-144803582 CATTTGCTAGCTATGTCCCTGGG - Intergenic
999078856 5:148824765-148824787 CACTGCCCAGCCATTGCCCCTGG + Intergenic
1002301874 5:178262013-178262035 CCTCACCCAGCCATTTCCCCAGG + Intronic
1002443608 5:179276715-179276737 CATCTCCCAGACAGGTCCCTGGG + Intronic
1002518528 5:179776704-179776726 CGTCTCCCACCCCTGTCCCCGGG + Exonic
1002998708 6:2311119-2311141 CATTTTCCAAACATGGCCCCAGG + Intergenic
1004071718 6:12304514-12304536 CACTTCCCTTCCCTGTCCCCAGG - Intergenic
1014546483 6:122742228-122742250 CATTTTCCAAACATGGCCCCAGG + Intergenic
1016876423 6:148870230-148870252 CACTACCCAGCCATGTGACCTGG + Intronic
1017722093 6:157250698-157250720 CATTTCCCAACCGAGTTCCCTGG - Intergenic
1018099197 6:160421173-160421195 CATTTCCCAGACAAGTACCCAGG + Intronic
1018536687 6:164827768-164827790 CATTTCCCATCTATATCCCTGGG - Intergenic
1018623571 6:165755395-165755417 CATTTCAAAGACATTTCCCCAGG - Intronic
1018896829 6:168025226-168025248 CATTCCCCAGCCACACCCCCAGG - Intronic
1019909473 7:4090659-4090681 TCTTTCCCAGCCATTTCTCCAGG + Intronic
1020043433 7:5021593-5021615 CATTTTCCAAACATGGCCCCAGG + Intronic
1021976104 7:26012464-26012486 TAATTCCCAGTGATGTCCCCTGG - Intergenic
1022496210 7:30854744-30854766 CATTTCCCAGGGCTGTGCCCAGG - Intronic
1023458701 7:40369699-40369721 CATTTCCCACCCATGTCAACTGG - Intronic
1023599840 7:41871094-41871116 CATTTCCCACCCCTCTACCCTGG + Intergenic
1023784536 7:43693005-43693027 CATTTCCCAGTCCTAGCCCCTGG - Intronic
1023888113 7:44375139-44375161 CCTTTCTCATCCATGTCTCCAGG + Intergenic
1024086482 7:45895857-45895879 CAATTCCCACACATGTTCCCTGG + Intergenic
1025834306 7:65080905-65080927 CTTCCCCCAGCCATGTTCCCGGG - Intergenic
1026902524 7:74044990-74045012 TATTTCCCAGCCATGTGAGCTGG - Intronic
1026953429 7:74362291-74362313 CATCTCCCTCCCCTGTCCCCAGG + Intronic
1027622898 7:80513938-80513960 CATTTCTCAGCCTTCTCCCCTGG + Intronic
1028104893 7:86865593-86865615 CACTCCCTAGCCATGGCCCCTGG - Intergenic
1029096357 7:98087895-98087917 CATTCCCCATCCATTCCCCCTGG - Intergenic
1029682669 7:102122694-102122716 CATTTCCTAGCCATGTCTGGGGG - Intronic
1031134711 7:117872986-117873008 CACGTCCCAGCCTTCTCCCCCGG + Intronic
1032005828 7:128301360-128301382 ACTTTCACAGCCATCTCCCCAGG - Exonic
1032498151 7:132378352-132378374 CATGTGCCAGCCATGTGCCAGGG - Intronic
1033008200 7:137590376-137590398 CATACCCCTGCCATCTCCCCAGG + Intronic
1033043176 7:137937072-137937094 CAATTCCCAGCCCTGCCCTCTGG + Intronic
1033598680 7:142874035-142874057 CTCTTCCCTGCCATGGCCCCTGG + Intronic
1034417759 7:150974257-150974279 CATCTCCCAGACCTGTCACCTGG + Intronic
1034461195 7:151198946-151198968 CATCTCCCAGCCATGCCTCGTGG - Exonic
1034695838 7:153052634-153052656 CATTTCCCAGCCAAGTGTCATGG + Intergenic
1035272878 7:157730797-157730819 CATGTCTCCGCCATGTGCCCAGG - Intronic
1035649235 8:1252691-1252713 CACTGCCCAGCCATGACACCCGG - Intergenic
1036691041 8:10944935-10944957 CTTTCCTCTGCCATGTCCCCTGG - Intronic
1037112299 8:15178071-15178093 GAATTCCCTGCCATTTCCCCAGG + Intronic
1037650212 8:20829598-20829620 CAGCTCCCAGCAAAGTCCCCAGG - Intergenic
1038277451 8:26133825-26133847 CAGTTCCCATCCCTGTTCCCTGG + Intergenic
1038529196 8:28303813-28303835 CATTTACCATCCATGTCCAATGG - Intergenic
1039030162 8:33299956-33299978 CACTTCCCTGCCATCTCCACTGG + Intergenic
1039823481 8:41154191-41154213 AATTTGTCAGCCATGGCCCCTGG - Intergenic
1039823981 8:41157461-41157483 CATTGCCCAGCCATGTGACAGGG + Intergenic
1039876594 8:41591694-41591716 CATTTTCCAAACATGGCCCCAGG + Intronic
1039899419 8:41740785-41740807 CTTTGCTCAACCATGTCCCCTGG + Intronic
1042066623 8:64884085-64884107 TATTTCCCTGCCTTTTCCCCAGG + Intergenic
1042153132 8:65811382-65811404 CATTTCCCAGCTTTTCCCCCTGG - Intronic
1043345405 8:79292145-79292167 CATTCCCCAGGCATCTCCCTTGG + Intergenic
1045046118 8:98280504-98280526 CATGTCTCAGACACGTCCCCTGG - Intronic
1047105007 8:121722460-121722482 CATTTCCCAGCCAGGTGCGGTGG + Intergenic
1047373725 8:124277003-124277025 TAGTTCCCAGCCAAGCCCCCAGG + Intergenic
1048192558 8:132302964-132302986 CATTTCCCAGCATGCTCCCCAGG - Intronic
1048848406 8:138621138-138621160 CATTTTCCAACCACATCCCCTGG + Intronic
1048897924 8:139010932-139010954 CATTTCTCCTCCATCTCCCCCGG - Intergenic
1049299866 8:141863797-141863819 CCATGCCCAGCCCTGTCCCCTGG + Intergenic
1049680385 8:143915487-143915509 CAGTTCCCAGCCATGCCGGCTGG + Exonic
1049760463 8:144329875-144329897 CTTTGCCCAGCAATGTCCCCTGG - Intergenic
1049797244 8:144502448-144502470 CCTTTCCAAGCCATGGTCCCTGG - Intergenic
1050103628 9:2143676-2143698 CATTTCCCAGTTATCTCTCCTGG - Intronic
1052136066 9:24911771-24911793 ATTTTCCTAGCCATGTTCCCTGG - Intergenic
1052508488 9:29383941-29383963 CATTTTCCAAACATGGCCCCAGG - Intergenic
1052764688 9:32629378-32629400 CATTTTCCTACCATTTCCCCTGG + Intergenic
1053143385 9:35695943-35695965 CATTTCCTTGTCATGTCCTCAGG - Intergenic
1055914562 9:81387726-81387748 CATTTCCCAGACATGCTCCTTGG + Intergenic
1056873720 9:90307640-90307662 CATCTCCCAGCTATGTGTCCTGG - Intergenic
1056989808 9:91400174-91400196 GCTGTGCCAGCCATGTCCCCAGG + Intergenic
1058609086 9:106755621-106755643 TATTTCCCAGCCATAGCCTCGGG + Intergenic
1058766697 9:108188904-108188926 CATGTCCCAGCTATGTGACCTGG + Intergenic
1059469074 9:114490330-114490352 CATTTCTCTGCCATCTCCCCTGG - Intronic
1060219507 9:121756933-121756955 CATGTCCCACCCATCTGCCCTGG - Intronic
1060758321 9:126228300-126228322 GATTTTCCAGCCCTGCCCCCCGG + Intergenic
1061190762 9:129081299-129081321 CAGTTCCCACCCCGGTCCCCCGG - Intronic
1062474092 9:136719042-136719064 CCTTCCCCACCCATGGCCCCAGG - Intronic
1062521296 9:136959051-136959073 CAGCTCCCAGCCCCGTCCCCTGG - Intergenic
1185910379 X:3975450-3975472 CATTTTCCAAACATGGCCCCAGG - Intergenic
1186322987 X:8451007-8451029 CATTTCCCTGCCTCCTCCCCTGG - Intergenic
1186715741 X:12249471-12249493 CCATTCCCAGCAATGACCCCAGG - Intronic
1189716124 X:43868362-43868384 CATTTCTCAGACCTGTCCACTGG + Intronic
1189749891 X:44210087-44210109 CATCTCCCAGCCATGACACCTGG + Intronic
1190270698 X:48861061-48861083 CATTTTCCAAACATGGCCCCAGG - Intergenic
1190771698 X:53520038-53520060 CATTTTCCAAACATGGCCCCAGG - Intergenic
1192185934 X:68946855-68946877 GATTCCCCTTCCATGTCCCCGGG - Intergenic
1192225053 X:69222129-69222151 CATTTCCCACCCACGTGCCAGGG + Intergenic
1192478554 X:71464983-71465005 CATTTTCCTACCATTTCCCCTGG - Exonic
1194384798 X:93238913-93238935 CATTTTCCAAACATGGCCCCAGG - Intergenic
1195502048 X:105613177-105613199 CATTTCCAGGCCATCTCTCCTGG + Intronic
1195688111 X:107603396-107603418 CCTTCCCCAACCATGGCCCCAGG + Exonic
1196039595 X:111187927-111187949 CATTTCCCTACCCTGTACCCTGG - Intronic
1198320540 X:135515172-135515194 CATTTACCAGCTATGTGACCTGG - Intergenic
1199881942 X:151980834-151980856 CATTTCTCAGTCTTGTTCCCTGG - Intergenic
1199981918 X:152925821-152925843 AATGTCACAGCCTTGTCCCCAGG + Intronic
1200943760 Y:8810978-8811000 CATTTTCCAAACATGGCCCCAGG - Intergenic
1201297061 Y:12472937-12472959 CATTTTCCAAACATGGCCCCAGG + Intergenic
1201556631 Y:15269798-15269820 CATTTTCCAAACATGGCCCCAGG - Intergenic
1202023407 Y:20492188-20492210 CAGTCCCCAGCCATGTCCAGAGG - Intergenic