ID: 1149384751

View in Genome Browser
Species Human (GRCh38)
Location 17:56131219-56131241
Sequence AGCATTATGGATGGTGTATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149384751 Original CRISPR AGCATTATGGATGGTGTATT GGG (reversed) Intronic
901359963 1:8689224-8689246 AGAATTAAGGATGGAGTTTTTGG + Intronic
902635646 1:17733476-17733498 AGCATTACGGAGGGTTTACTGGG - Intergenic
907985569 1:59526512-59526534 AGCAGTATGCAAGTTGTATTAGG - Intronic
909396253 1:75173976-75173998 AGCATTTTGGATTTTGGATTTGG + Intergenic
911086549 1:93982639-93982661 ATCATTCTGGATGATTTATTGGG + Intergenic
916251412 1:162742234-162742256 ATCATAGTGGATGGTGTGTTAGG + Intronic
918009504 1:180573155-180573177 ATAATTACGGATGGTGTATTAGG - Intergenic
918582611 1:186148820-186148842 TGCAGAATGGATGCTGTATTAGG + Intronic
919403880 1:197151923-197151945 AGAATTCTGGATGGTATGTTTGG + Intergenic
921306212 1:213799344-213799366 ATCATTAGGGATGGTGTTTGTGG + Intergenic
922068074 1:222163553-222163575 AGAATTATTGAGGGTGTATTTGG - Intergenic
922580203 1:226691567-226691589 AGTATTTTGGCTGGTGCATTTGG + Intronic
922636310 1:227175941-227175963 AGCTGTATGTATGGTGTACTGGG + Intronic
1063952981 10:11241655-11241677 AGCTTTAGGGATGGTGACTTAGG - Intronic
1063971249 10:11382641-11382663 AGCAGAATGGATGGTGTACCTGG + Intergenic
1064361163 10:14666164-14666186 ATTATTTTGGATTGTGTATTAGG + Intronic
1071217334 10:83423424-83423446 AACATTATTGATGATGTATATGG + Intergenic
1071275632 10:84052221-84052243 AGCATTATGTATGGTCATTTGGG + Intergenic
1072772680 10:98154526-98154548 AGCATTATAGATTTTGGATTAGG + Intronic
1072940268 10:99757115-99757137 AGCATTCAGGATTGTGTCTTTGG + Intergenic
1074514361 10:114151261-114151283 TGCAGTATTGGTGGTGTATTTGG - Intronic
1080109614 11:28551040-28551062 ATCACTATGGATGATGTATCAGG + Intergenic
1082715149 11:56603131-56603153 AGCATTATTGCTGGTGAATTTGG + Intergenic
1084677361 11:70643634-70643656 AGTATTTGGGATGGTGTCTTGGG + Intronic
1085498977 11:77000439-77000461 AGTTTTATGGATTGTGTTTTTGG + Intronic
1085878196 11:80434080-80434102 AGCAATATGGATGGTGTTGGAGG + Intergenic
1092925721 12:13270301-13270323 ATCATTATAGCTGGTGAATTTGG + Intergenic
1095848990 12:46779685-46779707 AGCATTTTGGAAGGTGAATATGG + Intronic
1096445024 12:51681700-51681722 AACACTAGGGATGGTGTAGTGGG + Intronic
1096574619 12:52544882-52544904 AGCATTAGGGAAGCTGTCTTTGG - Intronic
1099920263 12:88948942-88948964 AGAATTATGATTGATGTATTAGG - Intergenic
1099927718 12:89038435-89038457 AGCATAATGGATGCTGTACAGGG - Intergenic
1100107895 12:91199667-91199689 AGCTTTATGGATGATGGATTAGG - Intergenic
1100490745 12:95075400-95075422 AGCATTATTTGTTGTGTATTTGG + Intergenic
1102940734 12:116939244-116939266 AGCATTTTGGATTTTGGATTTGG + Intronic
1103238021 12:119390267-119390289 AGGATTAGGGAAGGTGTCTTTGG - Intronic
1107023395 13:35774917-35774939 GGCAGGATGGATGGTGTACTGGG + Intronic
1107962399 13:45570167-45570189 ATCATCATGGTAGGTGTATTGGG + Intronic
1109935614 13:69279995-69280017 AGCAATATGACTGGTGAATTTGG + Intergenic
1111757941 13:92422158-92422180 AGTATTTGGAATGGTGTATTTGG - Intronic
1112570987 13:100593290-100593312 AGCATGGTGGATAGTATATTTGG - Intergenic
1113874735 13:113587102-113587124 TACATAATGGATGGTGTTTTCGG + Intronic
1116598031 14:46878924-46878946 TGCATTATGTATAGTGAATTTGG - Intronic
1120566040 14:86058288-86058310 TGCATTATAGATGGTGCTTTGGG + Intergenic
1121218911 14:92271143-92271165 AGCAGTATGGATGTTGCAATAGG + Intergenic
1123227840 15:17063673-17063695 AGCATTTTGGAAGCAGTATTTGG + Intergenic
1129344628 15:74908971-74908993 AGCATTATTGATGGAAGATTGGG - Intergenic
1135940646 16:26818992-26819014 CACATTATGGAGGGTGTCTTTGG + Intergenic
1136346353 16:29678833-29678855 GGCATTTTGGATGGTGTGCTGGG - Intronic
1137953920 16:52809835-52809857 GGGAGTTTGGATGGTGTATTGGG + Intergenic
1139621986 16:68152792-68152814 ATCATTATGGATGGTTACTTTGG - Intronic
1140581218 16:76233429-76233451 AGCAATATGGGTGCTTTATTTGG + Intergenic
1140708755 16:77656811-77656833 AGCATTATTAATCGGGTATTGGG - Intergenic
1141268413 16:82517782-82517804 AGCATTTGGGAAGGAGTATTGGG + Intergenic
1145064168 17:19750812-19750834 GGCATTGGGGATGGAGTATTAGG - Intergenic
1145997287 17:29111934-29111956 AGCATTCTGTAGGGTGTGTTTGG - Intronic
1149191381 17:54067137-54067159 AACATTTTGGATGGTGTGTAGGG - Intergenic
1149384751 17:56131219-56131241 AGCATTATGGATGGTGTATTGGG - Intronic
1153729762 18:7998960-7998982 AGCATTATTTATTGTGCATTTGG + Intronic
1155629660 18:27877699-27877721 CTCATTCTGGATGGTGGATTGGG + Intergenic
1155700798 18:28741062-28741084 AGTAGTATGGATGGTGAAGTTGG - Intergenic
1159085602 18:63787210-63787232 AGCATTTTGGATTTTGGATTAGG + Intronic
1159589193 18:70313866-70313888 AGCATTATTGATGTTTTCTTGGG + Intronic
1163805066 19:19391125-19391147 AGAATCATGGCTGGTGAATTAGG + Intronic
1168588762 19:57615455-57615477 AGCATTCTAGATGGTGTTGTTGG + Intronic
925255019 2:2475927-2475949 AGCAATATGGATAGTGAAGTGGG + Intergenic
925408299 2:3623402-3623424 CACATTATGGAAGTTGTATTAGG - Intronic
925852766 2:8098980-8099002 TGCATGATGGATGGGGAATTTGG - Intergenic
927341322 2:21986522-21986544 AGCCTTATGCATGGAGGATTTGG - Intergenic
927795281 2:26042657-26042679 AGCACTCTGGATGGTCTTTTGGG - Intronic
928008534 2:27584950-27584972 AGCATTATGAAGGATGGATTTGG + Intronic
933051473 2:77608136-77608158 AGCATTATACAGGATGTATTGGG + Intergenic
933948489 2:87308608-87308630 AGCACAATGGAAGGCGTATTGGG - Intergenic
934086799 2:88516614-88516636 AGCATTATGGAGGGTCTAGCAGG + Intergenic
936331710 2:111552987-111553009 AGCACAATGGAAGGCGTATTGGG + Intergenic
937941314 2:127288249-127288271 AGCCTTAGGGGTTGTGTATTTGG - Intronic
938093509 2:128447870-128447892 AGCATTATGGTTGGGGTAGGTGG + Intergenic
939436987 2:142189909-142189931 ATCATTAAGGATGGAGGATTTGG + Intergenic
939718314 2:145614212-145614234 AGGAGTATGGAAGGTGTGTTGGG + Intergenic
941314238 2:163972739-163972761 AGCTATATAGATGGTGTGTTTGG + Intergenic
942403992 2:175633722-175633744 AGCTCTGTGGACGGTGTATTAGG + Intergenic
945423353 2:209666588-209666610 AGTATTTTTGATGTTGTATTAGG - Intronic
945826698 2:214729404-214729426 AGCATTTTAGATGTTGGATTAGG + Intronic
947947630 2:234120175-234120197 AGCATCATAGTTGGTGAATTAGG - Intergenic
1169740066 20:8882525-8882547 AGCAATATGGATTGTACATTTGG + Exonic
1171742755 20:28920850-28920872 AGCATTTTGGAAGCAGTATTTGG - Intergenic
1176324632 21:5380335-5380357 AGCATTTTGGAAGCAGTATTTGG + Intergenic
1176482188 21:7310751-7310773 AGCATTTTGGAAGCAGTATTTGG + Intergenic
1176761377 21:10797138-10797160 AGCATTTTGGAAGCAGTATTTGG + Intergenic
1177284719 21:19035061-19035083 AGCTTTGTCGATGGAGTATTAGG - Intergenic
1180401074 22:12425973-12425995 AGCATTTTGGAAGTAGTATTTGG + Intergenic
1181907149 22:26207806-26207828 AGCATAAAGGATGGTGGATGAGG - Intronic
949249166 3:1962068-1962090 AGAATAATGGATGGTGAATTTGG - Intergenic
949598851 3:5577232-5577254 AGGATTTTGGATTTTGTATTTGG + Intergenic
952079287 3:29738557-29738579 AGCATTATTGGTGCTGAATTAGG + Intronic
953811637 3:46117582-46117604 AGGATTATGAATGGAGTCTTTGG + Intergenic
955189271 3:56745141-56745163 ACCATAATGGCTGGTGGATTGGG - Intronic
957523466 3:81350667-81350689 AACATTATGGTTGGTGAGTTAGG + Intergenic
957656667 3:83087103-83087125 AGGTATTTGGATGGTGTATTAGG - Intergenic
958086771 3:88819320-88819342 AGGTTTTTGTATGGTGTATTTGG + Intergenic
958605424 3:96352142-96352164 AGCATCATGGGTGTTTTATTTGG - Intergenic
960324031 3:116273154-116273176 AGCAGTTTGGCTGGTGTAGTAGG - Intronic
962572678 3:136726814-136726836 TGGATTATGTAGGGTGTATTTGG - Intronic
963374504 3:144446788-144446810 AGAATTAAGGATGGTGTCTGAGG + Intergenic
964794071 3:160479009-160479031 TGCATTAAGGATGGTGGTTTGGG - Intronic
964948922 3:162262878-162262900 AACATTATGGATGTAGTAATTGG + Intergenic
967307853 3:188076344-188076366 AGCATTATGGAGGGTGTCTCTGG + Intergenic
973115067 4:46446709-46446731 TGCATTGTGGATGGTATCTTTGG + Intronic
974148046 4:57969990-57970012 TGCATAATGGATGGTATGTTGGG - Intergenic
975051024 4:69865127-69865149 AGCATTTTGGATTTTGGATTTGG - Intergenic
978332619 4:107630885-107630907 AGTATTTTGGATTGTGGATTGGG - Intronic
978347486 4:107787574-107787596 AGCATAATGTATAGTTTATTAGG - Intergenic
980680806 4:136157077-136157099 ACCCTTATGGATGGAGTTTTTGG - Intergenic
980857543 4:138457447-138457469 AGCATCATGGTTGGTGTACAGGG - Intergenic
984626622 4:182014692-182014714 AGCAGTATGGATGGGGCACTGGG + Intergenic
987466730 5:18280683-18280705 AGCATGATGGAAGGTGTGATGGG + Intergenic
987533668 5:19155523-19155545 AACATTCTGGATGGTATTTTGGG - Intergenic
987599588 5:20049710-20049732 AGTTTTATGGATGGTTTATAGGG - Intronic
987860541 5:23481660-23481682 AGGATTATGGTTTGTATATTTGG - Intergenic
988207002 5:28150724-28150746 AGCCTTATAGGTAGTGTATTTGG - Intergenic
989684886 5:44073960-44073982 ATCTTTCTGGATGGAGTATTGGG + Intergenic
993198411 5:84781217-84781239 CGCATTGTGGAAGGTGAATTGGG + Intergenic
993592625 5:89813311-89813333 AGCATTATTGATGGTGCATTGGG - Intergenic
995847299 5:116508114-116508136 AGCATTCTGCATGGTTCATTTGG - Intronic
998874312 5:146583980-146584002 ATCATTTTGGCTGCTGTATTTGG - Intronic
999341442 5:150777167-150777189 AGAATAATGGATGCTGTGTTGGG - Intergenic
1004028738 6:11845422-11845444 AGCATTTTGGATTTTGAATTTGG + Intergenic
1004371300 6:15054745-15054767 AGCAGAATGGATGCCGTATTAGG + Intergenic
1005068279 6:21840258-21840280 AGCATCATGGATTATGTTTTTGG - Intergenic
1006825351 6:36930723-36930745 AGCTACATGGATGGTGAATTGGG - Intergenic
1009488638 6:64258828-64258850 AGCATTTTGGGTGTTGAATTAGG - Intronic
1010591098 6:77712990-77713012 AGCATTATTGATGGAGCATTAGG + Intronic
1013054758 6:106572883-106572905 AGCATTATGCCTGGTGTTGTGGG - Intronic
1013652190 6:112206839-112206861 AGCATTCCAGGTGGTGTATTTGG + Intronic
1016604440 6:145903846-145903868 GGCATTTTGGATGGTGAAGTAGG - Intronic
1016791023 6:148066932-148066954 AGAATGATGGTTGTTGTATTTGG - Intergenic
1016951490 6:149585012-149585034 AGCATTTTGGATTTTGGATTAGG + Intronic
1019454448 7:1118430-1118452 ATGGTTATTGATGGTGTATTGGG - Intronic
1021592746 7:22281556-22281578 AACATCATGGTTGGTTTATTTGG - Intronic
1024064038 7:45718357-45718379 AGCATTGTGGAAGGTGAATGGGG - Exonic
1024838345 7:53552073-53552095 AGCACTCGGGATGGTGTCTTCGG - Intergenic
1028209494 7:88055759-88055781 AGCGTTATGAAAGGTGTGTTAGG - Intronic
1031187534 7:118501620-118501642 AGCATTTTGGCTGGGGTATATGG + Intergenic
1039949704 8:42160058-42160080 AGCATTCTGGATTTTGGATTTGG - Intronic
1045584470 8:103517336-103517358 AGCATAGTGCATGGTGTCTTTGG + Intronic
1045939604 8:107724404-107724426 ATATTTATGGATGGTTTATTTGG - Intergenic
1048749621 8:137657482-137657504 AGCATAATGCATGGGGAATTGGG - Intergenic
1050861665 9:10441142-10441164 AGCTTTGTGGATGGTGGACTAGG - Intronic
1055660469 9:78498546-78498568 AGCATTATGTATTGTTCATTTGG + Intergenic
1057449883 9:95148686-95148708 AGCATTATGCATGGTTCATTTGG - Intronic
1060860147 9:126947413-126947435 AGCATTTTGGATTTTGGATTTGG + Intronic
1061469437 9:130812115-130812137 AGCATTTTGGGAGGTGGATTAGG + Intronic
1203382427 Un_KI270435v1:68637-68659 AGCATTTTGGAAGCAGTATTTGG + Intergenic
1187483615 X:19681179-19681201 AGCATTTTGGATTTTGGATTAGG + Intronic
1188840416 X:35010692-35010714 AGAAAAATGGATAGTGTATTAGG + Intergenic
1188919121 X:35949881-35949903 AGCATTATGGATTTCATATTAGG + Intronic
1189514887 X:41703285-41703307 AACATTTTGGATGATGTATACGG - Intronic
1196742006 X:119033347-119033369 ACCATTATGGATGGTGTCTCTGG - Intergenic
1200524582 Y:4256523-4256545 AGCATTAAGGATGGTAGATAGGG + Intergenic