ID: 1149387574

View in Genome Browser
Species Human (GRCh38)
Location 17:56157083-56157105
Sequence TTTTGAGGAGAGCACTGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149387568_1149387574 15 Left 1149387568 17:56157045-56157067 CCTCTCTAGGTCTCCAAAACAGT 0: 1
1: 0
2: 0
3: 16
4: 142
Right 1149387574 17:56157083-56157105 TTTTGAGGAGAGCACTGTACTGG 0: 1
1: 0
2: 0
3: 10
4: 129
1149387572_1149387574 2 Left 1149387572 17:56157058-56157080 CCAAAACAGTGGGATTCAGAGGT 0: 1
1: 1
2: 0
3: 18
4: 213
Right 1149387574 17:56157083-56157105 TTTTGAGGAGAGCACTGTACTGG 0: 1
1: 0
2: 0
3: 10
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149387574 Original CRISPR TTTTGAGGAGAGCACTGTAC TGG Intronic
900345328 1:2207762-2207784 GTTTGGGGAGAGCTCTGTCCCGG + Intronic
900552214 1:3262562-3262584 TTTTGAGGAGAGGAGTGGCCAGG - Intronic
901665490 1:10823984-10824006 TTTTAAGGAAAGCACCGTTCTGG - Intergenic
902619687 1:17643701-17643723 TTTTCACGAGAGCCCTGTGCAGG - Intronic
904999003 1:34653392-34653414 TTATGAGGTGAGCAGTGTGCAGG - Intergenic
912851362 1:113128000-113128022 TTTAGAAGAGAGAACTGGACAGG - Exonic
915438405 1:155927051-155927073 TTTTGTGAAGAGCAAAGTACAGG - Intronic
916038755 1:160944382-160944404 TTTTTAGGAGATCCCTGAACTGG - Intergenic
916632216 1:166628590-166628612 TTTTGAAGACAGCACTGTAGAGG + Intergenic
917517066 1:175716977-175716999 TTCTGAGGAGGGCTCTGTAATGG - Intronic
919229206 1:194751698-194751720 TTTTTTTGAGAGCACTGTAAAGG + Intergenic
920500379 1:206481573-206481595 CTTTGAGCAGAGCTCTGTCCAGG + Intronic
921544443 1:216457597-216457619 TTTAGAGGAGAGGACTGTATAGG + Intergenic
921886738 1:220314605-220314627 TGATGAGTAGAGCACTGAACAGG + Intergenic
922474558 1:225898338-225898360 TGTTAACGAGAGCACTGTAGGGG + Intronic
1062885943 10:1016040-1016062 TTTAGAGGAGAGCACGGGTCAGG + Intronic
1062994570 10:1853769-1853791 TTTTGAGGGGAGAATTCTACTGG + Intergenic
1070686797 10:78490885-78490907 TCTTGAGGAGAGGACTGTAGTGG + Intergenic
1071295483 10:84216407-84216429 GTTTCAGGAGAGGACTGTGCTGG + Exonic
1072206281 10:93207891-93207913 TGATGAGCAGAGCACTGAACAGG + Intergenic
1078805067 11:14690894-14690916 TTTTGAGGAAAGCAAGGTCCAGG + Intronic
1083680564 11:64349807-64349829 TGTTGGAGAGAGCACTGTGCTGG + Intronic
1087323622 11:96694453-96694475 TTTTGAGAAGAGCATTTTCCAGG + Intergenic
1087898070 11:103609804-103609826 TTTTGAGGATAGCAGAGTCCAGG - Intergenic
1089088751 11:115848165-115848187 TTGTGATGAGAGCAATGTCCTGG - Intergenic
1090153532 11:124411526-124411548 TCTTGAGGAAAGCACTGTTTAGG + Intergenic
1090958423 11:131534650-131534672 TTTTGGGGACAGCACAGGACTGG + Intronic
1091612577 12:2023916-2023938 TCTTGAAAAGAGCACTGCACCGG + Intronic
1096018031 12:48296283-48296305 TTTTGCGCCGAGCACTGTTCTGG + Intergenic
1102008813 12:109605806-109605828 GGTTGAGGAGAGCACTGTGCAGG + Intergenic
1106758435 13:32844904-32844926 TGGTGAGGAGAGCACCCTACAGG - Intergenic
1116966019 14:51016007-51016029 TACTGAGGAGACAACTGTACCGG - Intronic
1118742967 14:68754468-68754490 AACTGAGGAGAGCACTGTCCCGG - Intergenic
1119864653 14:77963248-77963270 TTTAGAGGAGAGCACAGGATAGG - Intergenic
1120071194 14:80105272-80105294 GTTTGAGGAGAGAACTCCACTGG + Intergenic
1123824690 15:24069267-24069289 GCATGAGGAGGGCACTGTACAGG - Intergenic
1135131287 16:19855739-19855761 ATTTGTGGAGAGCATTGTTCTGG - Intronic
1136076994 16:27823991-27824013 TTTAGAGGAGAGCCTTATACAGG + Intronic
1142646206 17:1315482-1315504 TTTTCTGGAGAGCTCTGTCCTGG - Intergenic
1143514007 17:7410423-7410445 TTCTGTGGAGGGCATTGTACTGG - Intronic
1146935774 17:36811774-36811796 TCTTGGGGAGAACACTGGACTGG + Intergenic
1147039679 17:37708863-37708885 TTCTGAGGGGAGCACTGACCCGG - Intronic
1148375955 17:47146577-47146599 TTTTGAGGAGAGTACTCAAAGGG + Intronic
1149387574 17:56157083-56157105 TTTTGAGGAGAGCACTGTACTGG + Intronic
1152430683 17:80246869-80246891 TCTTGAGGCGAGCACTGACCCGG + Intronic
1153824104 18:8859049-8859071 TTTTGAGAAGTGCCCTGTTCAGG - Intergenic
1157589998 18:48830696-48830718 TTCTGAGCAGAGCCCTGGACAGG - Intronic
1158444716 18:57509528-57509550 GTATGAAGAGAGCACTGGACTGG - Intergenic
1159523985 18:69564267-69564289 TTTTGAGGTTTTCACTGTACTGG - Intronic
1161527202 19:4763773-4763795 TTTTGTGCCGAGCACTTTACGGG - Intergenic
1164540879 19:29120736-29120758 TTTTGAGGAGATGACTTCACAGG - Intergenic
1166432774 19:42741086-42741108 TTGTGAGGAGAGGCCTGTGCTGG + Intronic
1167379887 19:49132706-49132728 TTTTGAGGAGAGGGCTGGAGTGG + Intronic
925264988 2:2560727-2560749 TCTTAAGGAGAGCACTGAGCAGG - Intergenic
926297867 2:11581619-11581641 TGGTGGGGAGAGCACTGGACTGG - Intronic
929126009 2:38523369-38523391 ATTTGAGGACATCACTGTCCAGG - Intergenic
931170082 2:59793822-59793844 TTTTGAGGAGAGAATTTTCCAGG + Intergenic
932321464 2:70825200-70825222 TTTTGAGGAGCCCACTGGTCAGG - Intergenic
939978885 2:148754849-148754871 TATAGAGGAAAGCACTGTTCTGG + Intronic
942372056 2:175295659-175295681 TTTTCAGGAGAGTGCTGTAGAGG + Intergenic
943424474 2:187713577-187713599 TTTTGAGGAGATCAACATACTGG - Intergenic
944297010 2:198077036-198077058 TTTTGAGGATAGCCCTCTCCTGG + Intronic
944310296 2:198225557-198225579 TTTGGAGGAGAGACCTGTACAGG + Intronic
944634489 2:201661554-201661576 TTTTGAGAACAGCACTGCAGAGG - Intronic
947817094 2:233044908-233044930 TTTGGAGGACATCACTGTACGGG - Intergenic
948486294 2:238283396-238283418 GTCTGAGGTGAGCACTTTACTGG - Intronic
1170683354 20:18546754-18546776 TTGTGAGAAGAGCCCTGGACCGG + Intronic
1182038271 22:27216342-27216364 TTTGGAGGAGAACACTGGTCTGG + Intergenic
1182205516 22:28620861-28620883 TTTTGAGGAGAGGAATGAGCAGG - Intronic
1183743766 22:39681894-39681916 TTTGTAGGAGAGCAGTGTAGGGG - Intronic
1183998378 22:41653539-41653561 TGATGAGCAGAGCACTGAACAGG - Exonic
1185207716 22:49549606-49549628 TTTGGAGGAGAGCACCGCTCTGG - Intronic
954450338 3:50568038-50568060 ACTTGGGGAGAGCACTGGACTGG + Intronic
957309117 3:78496802-78496824 TTTTGAGGAGATCAAGATACAGG + Intergenic
963347288 3:144110217-144110239 CTATTACGAGAGCACTGTACTGG - Intergenic
963393035 3:144693661-144693683 TTTTGAGAAGAGCAATATAAGGG - Intergenic
963529885 3:146461889-146461911 TTTTCAGGAGTGCCCAGTACTGG + Exonic
964424317 3:156535218-156535240 TTCTGAGGATAGCACTTGACTGG + Intronic
966594794 3:181716016-181716038 TTTTTAGGATAACATTGTACTGG + Intergenic
970135894 4:12923558-12923580 TTTTCAGCAGAGCTCTGTAATGG - Intergenic
974700049 4:65431480-65431502 TTTTGAGGAAAGGAATGTGCTGG - Intronic
975739214 4:77412442-77412464 TTTTGAGGAAGGCAGTATACAGG + Intronic
977408034 4:96625064-96625086 TTGTGAGAAGTGCACTGAACTGG - Intergenic
977640908 4:99357261-99357283 CTTTGTGGAGAGCAGTGTAAAGG + Intergenic
977788252 4:101066259-101066281 TTTAAAGAAGAGCACTGGACTGG + Intronic
978952670 4:114580037-114580059 TTTGGTGGAGAGTTCTGTACAGG + Intergenic
983115872 4:163815406-163815428 TTATGAGTAATGCACTGTACTGG + Intronic
989290338 5:39757484-39757506 TTGTGAAGAAAGCACTGTAGAGG + Intergenic
989415152 5:41165981-41166003 TATTGAGCAGAACACTTTACTGG - Intronic
990030927 5:51257943-51257965 TTTTGAGGAGAGAATTTTAATGG - Intergenic
990770082 5:59233657-59233679 ATTTGAGGAGAGTGCTATACTGG - Intronic
990780906 5:59361978-59362000 TTTTCAGGGCAGCACTGTATAGG + Intronic
993109131 5:83633598-83633620 TTGGCAGGAGAGCACTGTTCAGG - Intergenic
993117865 5:83738956-83738978 TTTTGATGAGAGGACTGTTTTGG + Intergenic
993729201 5:91402457-91402479 GTTTGAAGACAGCACTGCACTGG - Intergenic
994157145 5:96516276-96516298 TTTTGAACAGAGCAATGTATTGG - Intergenic
994357304 5:98808073-98808095 TTTTTATGACAGCACTGTGCTGG - Intergenic
995136884 5:108688638-108688660 TTTTGAGGAGTGCATGGTAGTGG - Intergenic
999717971 5:154377226-154377248 TTTTGATGAGGGCAGTGTGCTGG + Intronic
1003642736 6:7889024-7889046 CTTTGGTGAGAGAACTGTACAGG + Intronic
1004268788 6:14175353-14175375 TTTTGTGGAGAGCATTGGACTGG + Intergenic
1006947074 6:37791688-37791710 TTCTGGGAAGAGCACTGGACTGG + Intergenic
1007340775 6:41190291-41190313 TTTTGAGGAGGGGAGGGTACAGG - Exonic
1007446936 6:41913998-41914020 TATAGATGAGAGAACTGTACTGG + Intronic
1007773321 6:44208523-44208545 TTTTGAGGAGGGCAGTTTAGGGG - Intergenic
1012902845 6:105027799-105027821 TTTTGAAGAAAGAACTGTAAAGG + Intronic
1015684480 6:135844241-135844263 GTTTGAGAAGAGCATTGTACTGG + Intergenic
1016002879 6:139060273-139060295 TCTTGAGGACAGCACTGAATAGG - Intergenic
1016544067 6:145201033-145201055 TTTTGAGGAAAGGAGTGGACAGG + Intergenic
1017299450 6:152838970-152838992 GTTTGATGAGAGCACTGAGCAGG + Intergenic
1019377334 7:699809-699831 TTGTTAGGAGAGCACTGGAAAGG + Intronic
1019740052 7:2668239-2668261 GTTTGGGGGGAGCACTGGACTGG + Intergenic
1023131921 7:37012038-37012060 TTCTGTGGAGAGCACTGGTCTGG - Intronic
1026240387 7:68569208-68569230 TTTTGGGGAGTGAAGTGTACAGG - Intergenic
1028131339 7:87177892-87177914 TTCTGAAGACAGCGCTGTACTGG - Intronic
1028226190 7:88255255-88255277 TTTTCTGGTGAGCACTCTACTGG + Intergenic
1029215203 7:98943078-98943100 TTTTAATGAAAGCACTGTCCCGG - Intronic
1032346907 7:131124825-131124847 GTTTGAGGAGAGCACAGCAGGGG - Intronic
1034218497 7:149426313-149426335 CTTTGGGGAGAGCACTGTTATGG - Intergenic
1035377103 7:158412894-158412916 TGTTGAGGAGGGCACTGGATGGG - Intronic
1035767497 8:2119015-2119037 TCTTGAGATCAGCACTGTACGGG + Intronic
1036281975 8:7408240-7408262 TTTTCAGAAGAGGACTGTAAGGG + Intergenic
1036339494 8:7903331-7903353 TTTTCAGAAGAGGACTGTAAGGG - Intergenic
1037474143 8:19239713-19239735 TTTTCAGGCCAGCACTTTACTGG + Intergenic
1041988534 8:63955924-63955946 TTTTGAGGAGATCATTGTATTGG + Intergenic
1045046601 8:98285084-98285106 TTCTAAGGAGAGTACTGTTCAGG + Intronic
1047256692 8:123218736-123218758 TTTTGAGGAGAGTACTAGAAAGG + Intergenic
1051750134 9:20332660-20332682 TTTTGACCAGAGCACTTCACAGG - Intergenic
1056408573 9:86301446-86301468 TTCTGAGGTGTGCACTGTATGGG + Exonic
1057368460 9:94447005-94447027 TTTTGAGGAAACCACTGCAGAGG + Intronic
1058116021 9:101085123-101085145 CTTTGAGGATACCACTGTAATGG + Intronic
1058862959 9:109135309-109135331 TTTTGAGGAGAGAAGTCTGCAGG - Exonic
1060702648 9:125771880-125771902 TTTTGAGGAGAGTAGTGCAAGGG + Intronic
1060888818 9:127175403-127175425 GTGTGAGCAGAGCACTTTACAGG - Intronic
1187208306 X:17203917-17203939 CTTTGAGGACAGCACAGTCCAGG - Intergenic
1189268585 X:39735009-39735031 GTTTGAGGGGAGCACTGGACTGG - Intergenic
1189314418 X:40044069-40044091 TTTTGATAAGAACACTGTAGAGG + Intergenic
1189473384 X:41331559-41331581 TTTTGAGTAGAGCCGAGTACAGG - Intergenic
1194917081 X:99720007-99720029 TAATGAGCAGAGCACTGAACAGG + Intergenic
1199682022 X:150231739-150231761 TGATGAGCAGAGCACTGAACAGG + Intergenic