ID: 1149388706

View in Genome Browser
Species Human (GRCh38)
Location 17:56168801-56168823
Sequence TGTTCCAATTAGGGTGATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 165}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149388706_1149388709 -10 Left 1149388706 17:56168801-56168823 CCAACATCACCCTAATTGGAACA 0: 1
1: 0
2: 2
3: 9
4: 165
Right 1149388709 17:56168814-56168836 AATTGGAACAGTTACTTTAGAGG 0: 1
1: 0
2: 0
3: 21
4: 178
1149388706_1149388714 11 Left 1149388706 17:56168801-56168823 CCAACATCACCCTAATTGGAACA 0: 1
1: 0
2: 2
3: 9
4: 165
Right 1149388714 17:56168835-56168857 GGGGTAGAGGCTATTTGGAAAGG 0: 1
1: 0
2: 0
3: 17
4: 137
1149388706_1149388712 -2 Left 1149388706 17:56168801-56168823 CCAACATCACCCTAATTGGAACA 0: 1
1: 0
2: 2
3: 9
4: 165
Right 1149388712 17:56168822-56168844 CAGTTACTTTAGAGGGGTAGAGG 0: 1
1: 0
2: 1
3: 19
4: 135
1149388706_1149388717 21 Left 1149388706 17:56168801-56168823 CCAACATCACCCTAATTGGAACA 0: 1
1: 0
2: 2
3: 9
4: 165
Right 1149388717 17:56168845-56168867 CTATTTGGAAAGGGAGGTTGAGG 0: 1
1: 0
2: 0
3: 28
4: 277
1149388706_1149388710 -9 Left 1149388706 17:56168801-56168823 CCAACATCACCCTAATTGGAACA 0: 1
1: 0
2: 2
3: 9
4: 165
Right 1149388710 17:56168815-56168837 ATTGGAACAGTTACTTTAGAGGG 0: 1
1: 0
2: 0
3: 12
4: 208
1149388706_1149388711 -8 Left 1149388706 17:56168801-56168823 CCAACATCACCCTAATTGGAACA 0: 1
1: 0
2: 2
3: 9
4: 165
Right 1149388711 17:56168816-56168838 TTGGAACAGTTACTTTAGAGGGG 0: 1
1: 0
2: 1
3: 13
4: 171
1149388706_1149388715 12 Left 1149388706 17:56168801-56168823 CCAACATCACCCTAATTGGAACA 0: 1
1: 0
2: 2
3: 9
4: 165
Right 1149388715 17:56168836-56168858 GGGTAGAGGCTATTTGGAAAGGG 0: 1
1: 0
2: 0
3: 15
4: 163
1149388706_1149388718 30 Left 1149388706 17:56168801-56168823 CCAACATCACCCTAATTGGAACA 0: 1
1: 0
2: 2
3: 9
4: 165
Right 1149388718 17:56168854-56168876 AAGGGAGGTTGAGGAGTGAATGG 0: 1
1: 0
2: 6
3: 57
4: 590
1149388706_1149388716 15 Left 1149388706 17:56168801-56168823 CCAACATCACCCTAATTGGAACA 0: 1
1: 0
2: 2
3: 9
4: 165
Right 1149388716 17:56168839-56168861 TAGAGGCTATTTGGAAAGGGAGG 0: 1
1: 0
2: 0
3: 16
4: 174
1149388706_1149388713 6 Left 1149388706 17:56168801-56168823 CCAACATCACCCTAATTGGAACA 0: 1
1: 0
2: 2
3: 9
4: 165
Right 1149388713 17:56168830-56168852 TTAGAGGGGTAGAGGCTATTTGG 0: 1
1: 0
2: 0
3: 4
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149388706 Original CRISPR TGTTCCAATTAGGGTGATGT TGG (reversed) Intronic
900363617 1:2301567-2301589 TGCTCCAATTATGGGGATGGAGG - Intronic
909570358 1:77103161-77103183 TGTTCCATTATTGGTGATGTTGG + Intronic
911001639 1:93171714-93171736 TTTTAGAATTAGGGTAATGTTGG - Intronic
914341259 1:146762422-146762444 GGTTCCAACAAGGGTGATGTGGG + Intergenic
914346375 1:146802652-146802674 TTTTGGAATTAGGGTGATGCTGG - Intergenic
914776769 1:150742924-150742946 TGTTGGTAGTAGGGTGATGTAGG + Intronic
914838955 1:151231917-151231939 GGTTACAATCAGGGCGATGTGGG + Intronic
915251633 1:154593702-154593724 TGTTCTAAATTGGGTCATGTTGG + Intronic
916778186 1:167991864-167991886 TAATCCAGTTAGGGTGAGGTGGG + Intronic
917593350 1:176500203-176500225 TGTTCCAATTTCAGAGATGTGGG - Intronic
919386645 1:196931906-196931928 TTTTGGCATTAGGGTGATGTTGG + Intronic
919397535 1:197069463-197069485 TGTGCCAATCAGCGGGATGTGGG - Intergenic
920178576 1:204118640-204118662 TGTTAGAATTTGGGAGATGTTGG - Intronic
920929878 1:210377356-210377378 TTTTCCAATTTGAGAGATGTGGG + Intronic
921378862 1:214503643-214503665 TGATCCCACTAGTGTGATGTTGG + Intronic
921426033 1:215002107-215002129 TGTCCCAATTAGTGAGATTTTGG + Intergenic
922377315 1:224981272-224981294 TTTTGGAATTAGGGTGATGCTGG + Intronic
922658226 1:227404723-227404745 TTTTGGAATTAGGGTGATGCTGG - Intergenic
922852297 1:228743424-228743446 CGTTCCAACTAGGATGATGGGGG - Exonic
924473210 1:244361613-244361635 TGATCCAATCAGGGTAATGCGGG - Intronic
1065518514 10:26548947-26548969 TTTCCCATTCAGGGTGATGTTGG + Intronic
1068070398 10:52186735-52186757 TTTTCAAATGAGGGTGATTTTGG - Intronic
1068827578 10:61456310-61456332 TCTTTCAATTTGGGTGATTTTGG + Intergenic
1073114902 10:101086435-101086457 TGCTTCAATTAGGGAGATGGAGG - Intergenic
1074671400 10:115796178-115796200 TGTCCCAAGCAGGGTGATGACGG - Intronic
1075982450 10:126752362-126752384 TTTTGGTATTAGGGTGATGTTGG + Intergenic
1079171787 11:18103551-18103573 TGTGCAAATTTGGGGGATGTAGG - Intronic
1079332573 11:19545995-19546017 TGTTCCAAGTAGGTTGGGGTAGG + Intronic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1082949752 11:58800327-58800349 TTTTGCTATTAGGGTGATGCTGG - Intergenic
1085215142 11:74823369-74823391 AGTTCCAATAAAGTTGATGTTGG - Intronic
1089575005 11:119435672-119435694 TGTTGCAATTGGGGTGAGCTGGG + Intergenic
1091384910 12:87389-87411 TGTTTCAAATAGGGAGATTTGGG + Intronic
1092041212 12:5386213-5386235 TCTTCCATTTATGGTAATGTGGG + Intergenic
1092693552 12:11143977-11143999 TGTTCCAGTTGAGGTGATGGAGG + Intronic
1092718043 12:11411844-11411866 TGTACCAATCAGCGGGATGTGGG - Intronic
1095344125 12:41129123-41129145 TTTGCAAATTAGGGTGATATTGG + Intergenic
1095759238 12:45809719-45809741 TGCTCAAATTAGGCTTATGTGGG + Intronic
1095784758 12:46097818-46097840 TTTTGGAATTAGGGTGATATTGG - Intergenic
1095932365 12:47640306-47640328 TGTTGGTATTAGGGTGATGCTGG - Intergenic
1096160070 12:49368661-49368683 AGTTTCAATTAAGGTGATTTGGG + Intronic
1098215826 12:68217125-68217147 TTTTCCAATTAGTTTGATTTGGG - Intronic
1104220964 12:126784823-126784845 TGATCCCATTAGGGTAATTTAGG - Intergenic
1105543271 13:21333104-21333126 TGTTCCAATTATGATGAATTAGG + Intergenic
1108713408 13:53056238-53056260 TGGTCCAGTTTGGGGGATGTGGG - Intergenic
1108884999 13:55169199-55169221 CGTTCCATTTAGTATGATGTTGG - Intergenic
1109124598 13:58503872-58503894 TCTACCAATTAGTGGGATGTGGG - Intergenic
1109178279 13:59181991-59182013 TGTTCTTGTCAGGGTGATGTTGG - Intergenic
1111963523 13:94836991-94837013 TGTTGGTATTAGGGTGATGCTGG - Intergenic
1114259587 14:21026691-21026713 TGCTCCAAATTGGGGGATGTAGG - Intronic
1117771987 14:59142838-59142860 TGTTCCTATCTGTGTGATGTTGG - Intergenic
1118162603 14:63305345-63305367 TTTTGGTATTAGGGTGATGTTGG - Intergenic
1118531827 14:66714963-66714985 TTTTGGTATTAGGGTGATGTTGG + Intronic
1119032370 14:71202799-71202821 TGAGGCAAGTAGGGTGATGTGGG + Intergenic
1127050454 15:55077936-55077958 TTTTCGTATTAGGGTGATGCTGG - Intergenic
1131350342 15:91693822-91693844 TTTTCAAATTAGGGTAATTTTGG + Intergenic
1133426157 16:5691636-5691658 TGCTCCAATGAGAGTCATGTTGG + Intergenic
1133644142 16:7747205-7747227 TGTTCCAGAGAGGGTGAGGTTGG + Intergenic
1138245147 16:55462023-55462045 TATTCCAATTAGGGTCAAGCTGG + Intronic
1139257735 16:65559187-65559209 TGTTCCAACAGGGGAGATGTTGG - Intergenic
1139987604 16:70912616-70912638 TTTTGGAATTAGGGTGATGCTGG + Intronic
1139993022 16:70954986-70955008 GGTTCCAACAAGGGTGATGTGGG - Intronic
1141363958 16:83425162-83425184 TGTTCCATTCAGGTTAATGTCGG - Intronic
1146535835 17:33650964-33650986 TGTTACCATTAGGGTGAACTAGG + Intronic
1149388706 17:56168801-56168823 TGTTCCAATTAGGGTGATGTTGG - Intronic
1150053110 17:61984817-61984839 TGTTCCAATGATGGTGGTGTAGG + Exonic
1153606895 18:6843222-6843244 TGTCCCAGTGAGGGTGTTGTAGG - Intronic
1156789765 18:40956519-40956541 TCTTCCGATTGGGGTGAGGTGGG + Intergenic
1168395728 19:56046445-56046467 TGTTGGTATTAGGGTGATGCTGG + Intronic
929037037 2:37703697-37703719 TTTTGGTATTAGGGTGATGTTGG + Intronic
932523771 2:72442287-72442309 TTTCCCATTTAGTGTGATGTTGG - Intronic
934887973 2:98041181-98041203 TGATCCACAGAGGGTGATGTTGG - Intergenic
936715313 2:115180521-115180543 TCTTCTAATTACGGTGATATAGG + Intronic
940118091 2:150232602-150232624 TGTTTTAACTGGGGTGATGTAGG - Intergenic
943321626 2:186451128-186451150 AGTTCAAATTTGGATGATGTGGG + Intergenic
943523948 2:188993349-188993371 TTTTACCATTAGGGTGAAGTTGG + Exonic
943621024 2:190148492-190148514 TTTTGGTATTAGGGTGATGTTGG + Intronic
944008696 2:194944431-194944453 TTTTCCAATTTGAGTGATGTAGG + Intergenic
944489559 2:200244241-200244263 TGAGTCAATTAAGGTGATGTTGG - Intergenic
945826051 2:214721258-214721280 TTTTGGTATTAGGGTGATGTTGG - Intergenic
946036781 2:216749532-216749554 TTTTGGTATTAGGGTGATGTTGG - Intergenic
946088834 2:217201848-217201870 TGCTTCAATTAAGGTCATGTTGG + Intergenic
947456760 2:230261939-230261961 TGTTGGTATTAGGGTGATGCTGG + Intronic
1169600150 20:7249303-7249325 GGTTCCAATTAGAGTAATGAAGG - Intergenic
1175056356 20:56202248-56202270 TGTTGCAAATAAGGTGATGTTGG + Intergenic
1177039292 21:16086949-16086971 TGTTCTGATTAAGGTGATATTGG - Intergenic
1178209887 21:30517565-30517587 TTTTCCAATTAGGGTTATGTAGG + Intergenic
1178512935 21:33221913-33221935 TTTTACCATTAGGGTGATGCTGG + Intergenic
1182846797 22:33438013-33438035 TTTTCCAATAAGGGTTCTGTCGG + Intronic
1182995032 22:34804058-34804080 TGTTCCAAGTAGAGTAATTTGGG - Intergenic
949715722 3:6929077-6929099 TGTTCCATTCAGTGTGATATTGG + Intronic
951938328 3:28048903-28048925 TTATCCAAAAAGGGTGATGTTGG + Intergenic
954133041 3:48569750-48569772 TTTGCCCAATAGGGTGATGTTGG - Exonic
956950555 3:74277272-74277294 TGTTAGTATTAGGGTGATGCTGG - Intronic
958545271 3:95540126-95540148 TGTTCCCATTAGGGGGATGTGGG + Intergenic
958823277 3:99001204-99001226 TTGCCCATTTAGGGTGATGTTGG + Intergenic
959454096 3:106537699-106537721 TGTTTGTATTAGGGTGATGCTGG - Intergenic
966215753 3:177500471-177500493 TGTCCCAGTTTGGTTGATGTTGG - Intergenic
967613768 3:191540056-191540078 TTTTCCAATTAGCGAAATGTGGG - Intergenic
970083726 4:12321140-12321162 TGTTCCAATGATGGAGTTGTAGG - Intergenic
970219654 4:13797619-13797641 TGTACCAATTAGAGTGCTGGTGG + Intergenic
970617815 4:17783951-17783973 TGTTATAAAAAGGGTGATGTTGG + Intergenic
970963738 4:21903802-21903824 TGTACACATTAGGGTGATATGGG - Intronic
973782736 4:54304297-54304319 TTTTGGTATTAGGGTGATGTTGG - Intergenic
973787358 4:54345113-54345135 TTTTGGTATTAGGGTGATGTTGG - Intergenic
974801539 4:66824954-66824976 TGATGTTATTAGGGTGATGTTGG + Intergenic
977088561 4:92637898-92637920 TATTCCAGCTAGGGTAATGTGGG + Intronic
977822848 4:101495938-101495960 TTTTGGTATTAGGGTGATGTTGG - Intronic
978204549 4:106065011-106065033 TGTTAGAAGTAGGGTAATGTGGG + Intronic
981173871 4:141657987-141658009 TGTTCAATTTATGGTGATGCTGG - Intronic
983212507 4:164973296-164973318 TATGCCAATTAGCGTAATGTTGG - Intronic
985093202 4:186385089-186385111 TTTTGCTATTAGGGTGATGCTGG - Intergenic
985284340 4:188319752-188319774 TTTTGATATTAGGGTGATGTTGG - Intergenic
986924294 5:12728060-12728082 TTTTCCACTTAGTGTAATGTTGG - Intergenic
987965497 5:24866909-24866931 TGTTCCAAGTTGTGTGTTGTGGG + Intergenic
988432559 5:31136408-31136430 TGTTTCAATTAGTGTGACATTGG - Intergenic
988820243 5:34876730-34876752 TTTTGGAATTAGGGTAATGTTGG - Intronic
990672384 5:58147586-58147608 TGTTCCATTATTGGTGATGTTGG - Intergenic
994270855 5:97774670-97774692 TTTTGGTATTAGGGTGATGTTGG - Intergenic
995955619 5:117773060-117773082 TTTTGGTATTAGGGTGATGTTGG - Intergenic
996835060 5:127782302-127782324 TTTTGGTATTAGGGTGATGTTGG + Intergenic
998708582 5:144794090-144794112 TTTTCCTATTAGGGTGATACTGG + Intergenic
998864167 5:146478399-146478421 TGTTACAAGTAGGGAGATGAGGG - Intronic
999261857 5:150243300-150243322 GGTTCCGATTTGGGGGATGTGGG - Intronic
1003063459 6:2880942-2880964 TTTTGCTATTAGGGTGATGTTGG - Intergenic
1003408713 6:5844674-5844696 TGTTCCAATTATGATGAATTAGG - Intergenic
1004344287 6:14833849-14833871 TTTTCCTCTTAGGGTGATGGTGG - Intergenic
1007972827 6:46069727-46069749 TTTTGCTATTAGGATGATGTTGG - Intronic
1011524788 6:88252855-88252877 TGTGCCAGTTAGTGTGATGGAGG + Intergenic
1012794093 6:103737903-103737925 TTTTGGAATTAGGGTGATGGTGG - Intergenic
1018549070 6:164973223-164973245 TGTTCAAATTAGAGTGATAAAGG - Intergenic
1018649670 6:165982472-165982494 TAGTCCAATTAGGGTGACATTGG + Intronic
1018954666 6:168400751-168400773 TGTTACGAGTTGGGTGATGTTGG - Intergenic
1025569664 7:62544875-62544897 TGTTCCCTTGAGGCTGATGTTGG + Intergenic
1030336485 7:108333472-108333494 TCTTCCAGCTAGGGTGATTTTGG - Intronic
1031302117 7:120073763-120073785 TTTTCCATTTAGTATGATGTTGG - Intergenic
1031472865 7:122188406-122188428 CTTTCCTATTAGAGTGATGTTGG - Intergenic
1031529263 7:122856244-122856266 TATTCCAATGAGGCTTATGTTGG - Intronic
1032432559 7:131873616-131873638 TGTGCAAACTAGGGTGATGAGGG - Intergenic
1032981831 7:137292837-137292859 TATTCCATTTAGGGTCAAGTGGG + Intronic
1034025876 7:147703205-147703227 TGTTCTAATTAGAGTGATCTGGG - Intronic
1035582093 8:746894-746916 TGCCCCTGTTAGGGTGATGTCGG + Intergenic
1038390995 8:27200948-27200970 TTTTCTAATTTGGCTGATGTAGG - Intergenic
1043106031 8:76111177-76111199 TGTTCCACATATGGTGGTGTTGG - Intergenic
1043464320 8:80489419-80489441 TTTTCCAAATAGGGCTATGTTGG + Intronic
1044193681 8:89349737-89349759 TTTTCCATTTAGTATGATGTCGG + Intergenic
1044789270 8:95830122-95830144 TTTTGCCATTAGGGTAATGTTGG - Intergenic
1044957991 8:97501869-97501891 TGTTTCAATTAAGGTGATCAGGG + Intergenic
1045263358 8:100596844-100596866 TGCTCCAAAGAGGGTGATGTGGG + Intronic
1045986266 8:108252829-108252851 TGTTACCATTAGGGTGAATTGGG + Intronic
1046155680 8:110286985-110287007 TGCTCCAATGATGATGATGTGGG - Intergenic
1046161534 8:110373392-110373414 TGTTGCAATGATGGTCATGTCGG + Intergenic
1051362987 9:16298101-16298123 TTTTGGCATTAGGGTGATGTTGG - Intergenic
1051588763 9:18754517-18754539 TGTCCCAATTTGGGTGATAAAGG + Intronic
1051843347 9:21423629-21423651 TTTTGGTATTAGGGTGATGTTGG + Intronic
1052277880 9:26698865-26698887 TTTTGGAATTAGGGTGATGCTGG - Intergenic
1052278990 9:26711387-26711409 TGTTTAAATTAGGGTGCTATCGG - Intergenic
1052783673 9:32808013-32808035 TTTTGCAATTAGGGTAATGCTGG - Intergenic
1053377920 9:37623948-37623970 TTTGCAGATTAGGGTGATGTGGG + Intronic
1053456150 9:38234420-38234442 TGTTGAAATGAGGGTGGTGTGGG + Intergenic
1055141078 9:72877580-72877602 TTTTGGTATTAGGGTGATGTTGG - Intergenic
1055378467 9:75678401-75678423 TGTTCTTATTAGGGCAATGTTGG - Intergenic
1057911253 9:99022079-99022101 TGTTCTCTTTAGGGTGATGCTGG + Exonic
1058222752 9:102323503-102323525 TTTTGCAATTAGGGTAATGCTGG - Intergenic
1060383527 9:123200402-123200424 TTTTCTAATTAGGGTGATACTGG + Intronic
1061272864 9:129553489-129553511 TCTCCCAAGCAGGGTGATGTTGG + Intergenic
1188512593 X:30952626-30952648 TGTTAAAATTAGGGTAATCTGGG + Intronic
1188736205 X:33719461-33719483 AATTCCAATTTGGGTGATGCAGG + Intergenic
1189455825 X:41188688-41188710 TGGGCAAATCAGGGTGATGTTGG - Intronic
1190109058 X:47578218-47578240 TGTTCCCCTGATGGTGATGTGGG - Intronic
1191589453 X:62865758-62865780 TTTTCCATTCAGTGTGATGTTGG + Intergenic
1191684999 X:63880455-63880477 TTCTCCATTTAGTGTGATGTTGG - Intergenic
1192978503 X:76313470-76313492 TTTTGGTATTAGGGTGATGTTGG + Intergenic
1193785101 X:85751224-85751246 TTTTGGTATTAGGGTGATGTTGG + Intergenic
1196276744 X:113774966-113774988 TGTTCTATTTAGATTGATGTAGG + Intergenic
1198886083 X:141339288-141339310 TTTTGGTATTAGGGTGATGTTGG - Intergenic
1201984083 Y:19944054-19944076 TTTTCCATTTAGAGTGATGTTGG + Intergenic