ID: 1149392065

View in Genome Browser
Species Human (GRCh38)
Location 17:56202084-56202106
Sequence ACCCTTTTCCAGAGGCCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 243}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149392058_1149392065 8 Left 1149392058 17:56202053-56202075 CCCCATTCATCCAGTCCTTTAAT 0: 1
1: 0
2: 4
3: 26
4: 279
Right 1149392065 17:56202084-56202106 ACCCTTTTCCAGAGGCCAGAAGG 0: 1
1: 0
2: 0
3: 23
4: 243
1149392057_1149392065 16 Left 1149392057 17:56202045-56202067 CCTATCTTCCCCATTCATCCAGT 0: 1
1: 0
2: 1
3: 27
4: 246
Right 1149392065 17:56202084-56202106 ACCCTTTTCCAGAGGCCAGAAGG 0: 1
1: 0
2: 0
3: 23
4: 243
1149392062_1149392065 -7 Left 1149392062 17:56202068-56202090 CCTTTAATCTTTTCCAACCCTTT 0: 1
1: 0
2: 3
3: 28
4: 427
Right 1149392065 17:56202084-56202106 ACCCTTTTCCAGAGGCCAGAAGG 0: 1
1: 0
2: 0
3: 23
4: 243
1149392059_1149392065 7 Left 1149392059 17:56202054-56202076 CCCATTCATCCAGTCCTTTAATC 0: 1
1: 0
2: 1
3: 22
4: 230
Right 1149392065 17:56202084-56202106 ACCCTTTTCCAGAGGCCAGAAGG 0: 1
1: 0
2: 0
3: 23
4: 243
1149392060_1149392065 6 Left 1149392060 17:56202055-56202077 CCATTCATCCAGTCCTTTAATCT 0: 1
1: 0
2: 0
3: 30
4: 350
Right 1149392065 17:56202084-56202106 ACCCTTTTCCAGAGGCCAGAAGG 0: 1
1: 0
2: 0
3: 23
4: 243
1149392061_1149392065 -2 Left 1149392061 17:56202063-56202085 CCAGTCCTTTAATCTTTTCCAAC 0: 1
1: 0
2: 0
3: 17
4: 216
Right 1149392065 17:56202084-56202106 ACCCTTTTCCAGAGGCCAGAAGG 0: 1
1: 0
2: 0
3: 23
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149392065 Original CRISPR ACCCTTTTCCAGAGGCCAGA AGG Intronic
901492291 1:9602689-9602711 ACCCCTGTGCAGAGGCCAGAAGG - Intronic
903027954 1:20442977-20442999 ACTCTTCTCCAGTAGCCAGAGGG + Intergenic
903888396 1:26554500-26554522 CCCCGTGCCCAGAGGCCAGAAGG - Intronic
906332246 1:44896217-44896239 AACATTTTTCAGAGGTCAGAAGG + Intronic
906670387 1:47649973-47649995 ACTCTATTCCAGAGGCCAAGAGG - Intergenic
906938493 1:50235289-50235311 ACCGTCTTCCAGACCCCAGAAGG + Intergenic
907401281 1:54226331-54226353 ACCCTCATCCTGTGGCCAGAGGG - Intronic
908329124 1:63052956-63052978 ACCCTTATCCAAAGACCAAAGGG + Intergenic
908403815 1:63794569-63794591 ACCTGTTATCAGAGGCCAGAGGG + Intronic
909459148 1:75889475-75889497 ACCCTTTTCTAAGAGCCAGAGGG + Intronic
909815961 1:79994234-79994256 TGCCTTTTCCAAAGGGCAGAAGG + Intergenic
909838294 1:80285706-80285728 ACCTTTTTTGAGAGGCCTGAAGG - Intergenic
909920565 1:81376285-81376307 ACACTTTTCCAGAGCTGAGAAGG + Intronic
911777617 1:101834607-101834629 ACTCTTTTACAGTGGCCTGAAGG - Intronic
912521228 1:110246206-110246228 AGCCTTTTCCAGATCCCAGAAGG + Intronic
912602397 1:110949931-110949953 AACCTTCTCCAGAGGTCAAATGG + Exonic
912696139 1:111843514-111843536 ACCCATTCCCAGAGGCCACCTGG - Intronic
914884976 1:151577296-151577318 TCCCTTTCCCAGAGGCTAGGGGG + Intronic
915015431 1:152728553-152728575 TGCTTTTGCCAGAGGCCAGAGGG + Intergenic
915692071 1:157699647-157699669 ACCAATATCCAGAGACCAGAGGG + Intronic
917864160 1:179177328-179177350 CCTCTTTGGCAGAGGCCAGAAGG - Intronic
918446747 1:184624383-184624405 TTCCTTTTCCAGATGCTAGAAGG - Exonic
918905359 1:190485257-190485279 TCCCTTTTCCAGATTCTAGAGGG - Intergenic
919256830 1:195137054-195137076 ACTTTTTTCAAGAGGCCTGAAGG - Intergenic
923913852 1:238481426-238481448 ACCCTAGTGCACAGGCCAGATGG + Intergenic
1062860661 10:806781-806803 TCCCGTTTCCTGAGGCCAGTGGG - Intergenic
1063927170 10:10991766-10991788 ACTTTTTTCAAGAGGCCACAGGG - Intergenic
1064712703 10:18142372-18142394 ATCCTCTGGCAGAGGCCAGATGG - Intronic
1064991465 10:21260288-21260310 CCACTTTTCCAAAGGCCAGAAGG + Intergenic
1065890366 10:30116230-30116252 AGCCCTTTGCAGATGCCAGAGGG + Intergenic
1066450517 10:35524069-35524091 TCCCTTTCCCAGAGGCTACATGG + Intronic
1067440390 10:46306023-46306045 ACCCCTTTCCAGGGCCCACAAGG + Intronic
1067509192 10:46881456-46881478 ACCCCTATCCTGAGGCCAAAGGG + Intergenic
1067653061 10:48170399-48170421 ACCCCTATCCTGAGGCCAAAGGG - Intronic
1068211841 10:53930644-53930666 AACTTTTTTCAGAGGCCTGAAGG - Intronic
1069552023 10:69371013-69371035 ACCCTTATCCTGATGCTAGAGGG + Intronic
1071491900 10:86141883-86141905 AGCCTTTGCCAGGGGCCTGAAGG - Intronic
1072009319 10:91289805-91289827 TCCCTCTTCCAGTGGCCAGGAGG - Intergenic
1072230507 10:93410350-93410372 AACCTTTTCCTGAGTGCAGAGGG - Intronic
1073027949 10:100502062-100502084 ACCCTTTACCAGAGGCTCAAAGG - Intronic
1073580431 10:104660571-104660593 ACCATTTTCCCTAGGTCAGAAGG - Intronic
1079504602 11:21139381-21139403 GACCTTTGCCAGAGGCCTGAAGG - Intronic
1080188256 11:29518216-29518238 ACCCATTTCCAGAGACCCTAGGG - Intergenic
1080691829 11:34564856-34564878 ACCCTGTTCCAGAGAGGAGAGGG - Intergenic
1081869112 11:46375298-46375320 ACCCCTGGCCAGAGGGCAGAGGG - Intronic
1083645248 11:64168296-64168318 ACCATTTTCCAGACTGCAGATGG - Intergenic
1083961260 11:66016206-66016228 CCCCTTGCCCTGAGGCCAGAAGG + Intergenic
1084019300 11:66408551-66408573 CCCCTCTTGCAGACGCCAGAGGG + Intergenic
1084420548 11:69058441-69058463 ACCCCCTCCCAGAGGACAGAGGG - Intronic
1084918016 11:72445411-72445433 TACTTTTTCCAGAGGCCTGAAGG + Intergenic
1085773279 11:79343157-79343179 TCCCTCTTCCAGGGGCCAGGAGG - Intronic
1089157007 11:116410240-116410262 ACCCACTTCGAGAGGGCAGATGG + Intergenic
1089764432 11:120752510-120752532 ACCCCTTCCCTGAGCCCAGAGGG + Intronic
1090242309 11:125192752-125192774 TCCCTGTTTCAGAGGCCACAGGG + Intronic
1090504870 11:127300286-127300308 ACCCTGTGCCAGAGGCCCCAAGG + Intergenic
1091449421 12:563149-563171 ATCCTTCTCCAGGGGCCAGTCGG - Exonic
1091568843 12:1667048-1667070 AGCCTTTGCCTGAGGCCAGTGGG + Intergenic
1092740416 12:11623323-11623345 ACCCAGTTTCTGAGGCCAGAGGG - Intergenic
1095386518 12:41657288-41657310 ACCAATTTTCAGAGACCAGATGG - Intergenic
1096569293 12:52511765-52511787 ACCACCTTCCAGAGGCAAGATGG - Intergenic
1100929090 12:99585486-99585508 ACCGTTCTCCAGACCCCAGAAGG - Intronic
1101997624 12:109536155-109536177 ACTCTTTTCCAGAAGCCTGGGGG - Exonic
1102172249 12:110851337-110851359 AGCCTCTTGCAGAGGCGAGATGG + Intronic
1102876858 12:116455660-116455682 AACCTTGTCCAGAGGCTACAGGG + Intergenic
1103705155 12:122867380-122867402 ACCCTGCCCCAGAGGCCAGTGGG - Exonic
1103791699 12:123476733-123476755 TCCCACTTCCGGAGGCCAGAAGG - Intronic
1104400795 12:128474469-128474491 ACCATTTGCCAAATGCCAGATGG + Intronic
1107373960 13:39782179-39782201 GCTCTTTTCAAGAGGCCAGAGGG + Intronic
1111718334 13:91909873-91909895 AGCCTTTTCAAGGGGGCAGAGGG + Intronic
1113862566 13:113498757-113498779 TGCATTTTCCAGAGGCCAGATGG + Intronic
1114645952 14:24256194-24256216 ACCTTGTTCCAGAGGCCACCAGG - Intronic
1116278527 14:42869951-42869973 ATCCTTTTCCTGAGTCCAGCAGG + Intergenic
1117517053 14:56512278-56512300 AGCCTTATCCACAGGCCACATGG - Intronic
1118337677 14:64867826-64867848 ACCCTGTTGCCCAGGCCAGAGGG - Intronic
1120295631 14:82636697-82636719 ACCCTGCTCAAGAGGCCAGAAGG - Intergenic
1122815146 14:104308462-104308484 GCTGTTTGCCAGAGGCCAGAGGG + Intergenic
1123682579 15:22773331-22773353 AACCTTCTCCAGAGGACAGGAGG + Intronic
1123762555 15:23444117-23444139 AACCTTCTCCAGAGGACAGGAGG + Intronic
1124115316 15:26837068-26837090 ACTTTTTTTAAGAGGCCAGAAGG + Intronic
1124334328 15:28845855-28845877 AACCTTCTCCAGAGGACAGGAGG + Intergenic
1125531793 15:40418380-40418402 AACCTCATCCAGAGGCCAGAGGG - Exonic
1126147046 15:45484548-45484570 AACCTTTTCCAGATGCTACAGGG - Exonic
1127291714 15:57577405-57577427 AACCTTTTCCAGACTCCAGAAGG + Intergenic
1127967123 15:63930756-63930778 ACCCTTATAAAGAGGCCCGAGGG + Intronic
1128145589 15:65330837-65330859 GCCCTTGGCCAGAGGCCAGAGGG - Intronic
1131867081 15:96722522-96722544 AGCCTTTCCCAGGGGCCAGGAGG + Intergenic
1133953952 16:10423586-10423608 ATCTTTTTCCAGAGGACAGTGGG - Intronic
1134123098 16:11598490-11598512 TTTCTTTTCCTGAGGCCAGAAGG + Intronic
1136713483 16:32258809-32258831 ACCTTTTTAAAGAGTCCAGATGG - Intergenic
1136754428 16:32670622-32670644 ACCTTTTTAAAGAGTCCAGATGG + Intergenic
1136813685 16:33199743-33199765 ACCTTTTTAAAGAGTCCAGATGG - Intronic
1136820161 16:33309823-33309845 ACCTTTTTAAAGAGTCCAGATGG - Intergenic
1136826724 16:33366362-33366384 ACCTTTTTAAAGAGTCCAGATGG - Intergenic
1136831790 16:33465133-33465155 ACCTTTTTAAAGAGTCCAGATGG - Intergenic
1137662038 16:50216116-50216138 AGCTTCTTCCAGAGTCCAGAGGG - Exonic
1141051462 16:80768580-80768602 ACCCTTATAGAGAGGCTAGAGGG - Intronic
1141593053 16:85081412-85081434 TCCTTTTTCCTGAGGCCAAATGG - Intronic
1202992261 16_KI270728v1_random:22717-22739 ACCTTTTTAAAGAGTCCAGATGG - Intergenic
1203056575 16_KI270728v1_random:930953-930975 ACCTTTTTAAAGAGTCCAGATGG + Intergenic
1144480702 17:15626867-15626889 GCCCCTTTCCAGAGGTCACAGGG + Intronic
1144917606 17:18736874-18736896 GCCCCTTTCCAGAGGTCACAGGG - Intergenic
1147368416 17:39974614-39974636 GCCCTTTTCCAGGGGACAAAGGG - Intronic
1148789349 17:50164617-50164639 ATCCTTTGGCAGAGGCAAGAAGG + Intronic
1149392065 17:56202084-56202106 ACCCTTTTCCAGAGGCCAGAAGG + Intronic
1150573964 17:66413472-66413494 TCCCTTCCCCAGAGGTCAGAGGG + Intronic
1151424718 17:74023535-74023557 AGCCAATCCCAGAGGCCAGAGGG + Intergenic
1151683105 17:75631956-75631978 TCCCATTGCCAGAGGACAGAGGG - Intronic
1151700580 17:75740613-75740635 ATCTGTTTCCAGAGGGCAGAAGG + Intronic
1152772089 17:82176314-82176336 ACACAATTCCAGAGGCTAGAAGG - Intronic
1152780520 17:82225735-82225757 ACCATTTTCCAGATCCCAGCAGG - Intergenic
1156024008 18:32631091-32631113 AGCCAATGCCAGAGGCCAGAAGG - Intergenic
1156581713 18:38384635-38384657 ACTCTTGACCAAAGGCCAGAGGG - Intergenic
1157598205 18:48876523-48876545 TCTCTGTTTCAGAGGCCAGAGGG - Intergenic
1157598218 18:48876593-48876615 CTCCTGTTTCAGAGGCCAGAGGG - Intergenic
1157627406 18:49061987-49062009 ACCCTTTCCCAGAGGCAAACTGG - Intronic
1160755747 19:756316-756338 AACCAATTACAGAGGCCAGAGGG + Intronic
1160964864 19:1742881-1742903 ACCCTTGTCCAGTGGCCAAAAGG - Intergenic
1161466037 19:4431093-4431115 ACCCCTTTCCAGATTCCATAAGG + Intronic
1161851174 19:6738928-6738950 TCCCTTCTCCAGGGCCCAGATGG + Intronic
1166870343 19:45866896-45866918 ACCCTTCTCCAGAGACAATAAGG + Intronic
1168011504 19:53537452-53537474 ACCCCACTCAAGAGGCCAGACGG + Intronic
1168012610 19:53545513-53545535 ACCCCACTCAAGAGGCCAGACGG + Intronic
1168097198 19:54122658-54122680 ACCCCCTCCCAGAGGCCTGAGGG + Intronic
1168521524 19:57054731-57054753 AACTTTTTCCAGAGGGCAGCAGG - Intergenic
1168715005 19:58521825-58521847 CCCCTATCCCAGAGGACAGAGGG + Intronic
925654612 2:6132627-6132649 TCCCTGTTACAGAGGTCAGAGGG - Intergenic
925876331 2:8314134-8314156 AGCCTTTGCCAGAGCTCAGATGG - Intergenic
926087712 2:10030401-10030423 TGCCCTTACCAGAGGCCAGAGGG + Intergenic
926969333 2:18451406-18451428 AGCCTGTTCAGGAGGCCAGAAGG - Intergenic
927562748 2:24084971-24084993 ACTCTTTTCCAGAGGCTAAAAGG - Exonic
928868773 2:35950169-35950191 AGCCTTGTCCAGAAACCAGAGGG + Intergenic
934045711 2:88171005-88171027 ACCCTATTCCAGAGTAGAGAAGG - Intronic
937357814 2:121209237-121209259 ACCCCTTTCCACAGGCCCCAAGG + Intergenic
937793141 2:125983816-125983838 ACCTTTTGCCAAAGACCAGATGG + Intergenic
941288844 2:163649435-163649457 ACCCTGCTGCAGAGGCCACATGG + Intronic
942227954 2:173832940-173832962 ACCCTTCTTCATAGGGCAGATGG - Intergenic
942276539 2:174327564-174327586 ACGCCCTTCCAGAGTCCAGATGG - Intergenic
944216852 2:197264759-197264781 AACCTTTTCCAGACTCCTGAGGG + Intronic
945014444 2:205500362-205500384 ACCATTTTCCAAAGGAGAGATGG - Intronic
945024962 2:205611633-205611655 GCTCATTTCCAGAGGCCAGAAGG - Intronic
945152377 2:206804656-206804678 ACCCTGTTCCAGAGCTGAGAAGG - Intergenic
945606348 2:211937624-211937646 ATCCTTCTTCACAGGCCAGAAGG + Intronic
945969080 2:216218778-216218800 TCCCTTTGCCAGTGGGCAGAAGG - Intergenic
947758805 2:232588406-232588428 ACCCTTTTACAGAGGACAGGTGG + Intergenic
947801166 2:232929057-232929079 GTCCTTTTCCGGAGGCCAGCCGG + Intronic
1169778286 20:9280246-9280268 TCTCCTTTCCAGAGGCCAGAAGG - Intronic
1170813290 20:19691987-19692009 GCCCTTTAAGAGAGGCCAGAGGG + Intronic
1171053895 20:21887273-21887295 CCCCTTTGACTGAGGCCAGAGGG + Intergenic
1171086460 20:22242573-22242595 CCCCACTGCCAGAGGCCAGAAGG - Intergenic
1171120571 20:22565381-22565403 ACCCTTTTACAAAGGCCAAATGG + Intergenic
1172625289 20:36343170-36343192 TCACTTTCACAGAGGCCAGAGGG - Intronic
1175697256 20:61111836-61111858 ACCCAGTCCCTGAGGCCAGAGGG + Intergenic
1177912830 21:27053592-27053614 ACCCTTTTCTATTTGCCAGAAGG + Intergenic
1178549174 21:33520926-33520948 CATCTGTTCCAGAGGCCAGAAGG + Exonic
1178679852 21:34664845-34664867 ACTCTTTTGCCCAGGCCAGACGG - Intergenic
1180138403 21:45876027-45876049 ACCCTTTTTCATGGGCCAGTAGG + Intronic
1180174078 21:46079050-46079072 ACCCTTTCTCAGAGGCATGAAGG - Intergenic
1184128020 22:42501196-42501218 AGCCTTTCACAAAGGCCAGAGGG - Intergenic
1184136811 22:42554511-42554533 AGCCTTTCCCAAAGGCCAGAGGG - Intronic
1184913869 22:47553630-47553652 TCACTGTTCTAGAGGCCAGAAGG - Intergenic
1185032811 22:48453625-48453647 CCCCATGTCCATAGGCCAGAGGG + Intergenic
950884700 3:16353225-16353247 AATCTTTCCCAGAGGCCAAAAGG + Intronic
952434229 3:33256412-33256434 ACCCCTTTCTAGAGGCTAGCGGG + Intergenic
953616210 3:44493030-44493052 CCCAGTTTCCACAGGCCAGATGG + Intergenic
954377614 3:50203426-50203448 GCCTTCTTCCAGAGGCTAGAGGG - Intergenic
955531052 3:59873518-59873540 ACCCTTGGCTAGAGGACAGATGG - Intronic
955585866 3:60476867-60476889 AGCCTTTTCCAGAAGACAAAGGG + Intronic
955806222 3:62737814-62737836 ACCCTTCAGCAGAGGCCTGATGG - Intronic
956845053 3:73175015-73175037 ACCCTTTTCCAGGCTGCAGATGG + Intergenic
957372776 3:79317132-79317154 TCCCATTTCCTAAGGCCAGAAGG + Intronic
960515639 3:118599483-118599505 TGCCTTTTCCAGAGGCCCTATGG + Intergenic
961095296 3:124149790-124149812 AAGCTTTTGCAGAGGACAGATGG - Intronic
961333915 3:126158873-126158895 TCCCTCTTCCAGAACCCAGATGG + Intronic
962302978 3:134259609-134259631 AAAATTTTCCAGAGGGCAGAGGG - Intergenic
966042940 3:175514072-175514094 ACTCTTTTCCAGAAACAAGATGG + Intronic
966971668 3:185050530-185050552 ACCCTTTGCCAGAGGTCGGAGGG + Intronic
969209219 4:5673589-5673611 ATTCTTTTCCAGAGACAAGAAGG - Intronic
969479062 4:7437480-7437502 ACCCCTTCCCAGAGGCCAGGGGG + Intronic
969953809 4:10867171-10867193 ACACTTTTACAGGGACCAGATGG - Intergenic
970601867 4:17647175-17647197 ACCCTTCTCCACAGGCCTGTGGG - Intronic
971437052 4:26638759-26638781 TACCTTTTCCAGAGGCCAGTTGG + Exonic
973251726 4:48067695-48067717 TCCCTTTTCCAGAAACCTGAAGG - Exonic
974070821 4:57121942-57121964 TCCATTGTCCAAAGGCCAGATGG - Intergenic
976329600 4:83814093-83814115 ACTCCTTTCCAGAAGACAGATGG + Intergenic
976431692 4:84969078-84969100 CCCTTTGTGCAGAGGCCAGATGG + Intergenic
978074383 4:104511040-104511062 AGCCTTTGCAAGAGGCTAGATGG + Intergenic
981004964 4:139865465-139865487 AACCTTTTACAGAGGTCAAAGGG - Intronic
981725701 4:147844958-147844980 AACCTTTCCCAGAGCCCACAAGG + Intronic
983118576 4:163851223-163851245 AGTCATTTCCAGAGGCTAGAGGG + Intronic
984451186 4:179904960-179904982 ACCCTCTTTCAGAGGGTAGAGGG - Intergenic
986056595 5:4143325-4143347 ATCCTTTTCCAGATGCCGGTCGG - Intergenic
986393188 5:7303867-7303889 AACCTTCTCCAGAGGACAGGAGG + Intergenic
988818165 5:34854694-34854716 AGCCTTTTCCAGCAGCCAAAAGG + Intronic
989675268 5:43965929-43965951 ACCCCTTTCCAGAGGAGTGAAGG + Intergenic
991226414 5:64278298-64278320 ATCCTTTCCCAGAGACTAGATGG + Intronic
992106255 5:73451341-73451363 AACCTTTCCCAGAGGCGAGCCGG + Intergenic
992645359 5:78806756-78806778 ATCACATTCCAGAGGCCAGAGGG - Intronic
992885140 5:81151212-81151234 ATGCCTCTCCAGAGGCCAGAGGG - Intronic
995702863 5:114955444-114955466 ACCATCCTCCAGAGCCCAGAAGG + Intergenic
997293159 5:132752281-132752303 AACATTTTCCAGAGGCTACAAGG - Intronic
1001097498 5:168787057-168787079 CCCCTTTTCCAGACGCCACTGGG + Intronic
1002133672 5:177095883-177095905 ACCCTTCCCCAGAGGGGAGAGGG + Intronic
1002313382 5:178328138-178328160 ACCCTTGGCCAAAGGGCAGAGGG - Intronic
1002334733 5:178469859-178469881 TCCCCTGTGCAGAGGCCAGAAGG + Intronic
1004545737 6:16596768-16596790 AGCCCTTTCCAAAGGCAAGATGG + Intronic
1004631391 6:17425096-17425118 ACCCATTTCCACAGGCCCAAAGG - Intronic
1006595321 6:35188900-35188922 ACCCTGTTCCAGAAGCCTGAGGG - Intergenic
1006601899 6:35231838-35231860 ACCTGTATCCAGCGGCCAGAAGG + Exonic
1011034307 6:82956710-82956732 GCCATTTCCCAGAGGCAAGATGG + Intronic
1012464144 6:99498745-99498767 GCCGTTCTCCAGAGGCCATATGG + Intronic
1015356022 6:132277898-132277920 GCCCTTTTCCACAGAACAGATGG - Intergenic
1016165090 6:140931924-140931946 AGACTTTTGCAGAGACCAGAGGG + Intergenic
1016984600 6:149885533-149885555 CCCCTAATCCAGAGGCCAGTTGG + Intronic
1018230792 6:161673374-161673396 ACCCTTTCCCAGTTTCCAGAAGG - Intronic
1018780532 6:167059884-167059906 TCCCTTTTCCAGAGGTTGGAGGG + Intergenic
1019345060 7:525611-525633 CCCCTCCTCCAGAGGCCAGGAGG - Intergenic
1021912665 7:25401763-25401785 AACCTCTTCCTGAGGACAGAAGG - Intergenic
1022509685 7:30927168-30927190 AGGCTTCTCCAGATGCCAGATGG - Intergenic
1023101487 7:36722592-36722614 ACTATTTTCCAGAGACCTGAAGG - Intronic
1024874798 7:54009418-54009440 TCCCATTTCCAGAGGCAACATGG - Intergenic
1026518778 7:71096796-71096818 ACCACAGTCCAGAGGCCAGAAGG - Intergenic
1029120381 7:98263812-98263834 CCCCGTTTCCAGAGGTCAAAGGG + Intronic
1035368414 7:158363107-158363129 GCCCTTTCCCTGGGGCCAGATGG + Intronic
1035395689 7:158533573-158533595 TCCCTATCCCAGGGGCCAGAGGG + Intronic
1035521740 8:280232-280254 AGCCTTTTCCAGCTTCCAGAGGG + Intergenic
1035759647 8:2060246-2060268 ACGCTTGTCCAGGAGCCAGAAGG + Intronic
1036694660 8:10966730-10966752 ACCCTATTCTAGAGGTCTGAGGG - Intronic
1037672664 8:21028658-21028680 ACCCTTTTTCAAAGGAAAGAAGG + Intergenic
1038276357 8:26124450-26124472 AACCTTTACCAGTGGCCAGGAGG - Intergenic
1039263082 8:35794206-35794228 ACACATTTACAGAGGGCAGAGGG - Intronic
1041018860 8:53617944-53617966 TTCCTTTTCCAGAGGACACAGGG + Intergenic
1041374714 8:57202371-57202393 ACGCTTTACCAGAGGCCGGTCGG - Intergenic
1042151290 8:65788272-65788294 ACCCTTCTCCAGATGGCAAATGG + Intronic
1042869576 8:73386106-73386128 ACACTGTTCCATAGGTCAGAAGG - Intergenic
1043785714 8:84397175-84397197 GGCCTTTTCCAGATCCCAGAAGG - Intronic
1044870448 8:96614706-96614728 AAACTTTCCCAGAGGCCAGTTGG - Intergenic
1045639274 8:104229674-104229696 GCCATTTTCCATAGGCCACATGG - Intronic
1046634836 8:116662804-116662826 TCCCTTGTCCATAGGCCAAAGGG - Intronic
1046942392 8:119943661-119943683 ACCAGTTTCCAGAGCCCAAAGGG - Intronic
1048107469 8:131427395-131427417 ACCATTCTCCAGACCCCAGAAGG - Intergenic
1049014512 8:139910122-139910144 ATCCTTTTCCAGGGGCCACCTGG - Intronic
1049446810 8:142635031-142635053 CCCCTTAGGCAGAGGCCAGATGG - Intergenic
1049585638 8:143431206-143431228 ACCCGTGTCCAGAGGCCCGGAGG - Intergenic
1050829130 9:9989631-9989653 GCCCTTTTCCAGTGTCCAGGAGG - Intronic
1051149748 9:14067549-14067571 TCCGTCTTGCAGAGGCCAGAGGG - Intergenic
1051610566 9:18957797-18957819 ACTCTTTCCCTGAGGCCAGTTGG - Intronic
1051678646 9:19583826-19583848 AGCCCTTTCCATAGGACAGAAGG + Intronic
1051692460 9:19730126-19730148 ACACTTGTTCAGAGGCCTGAAGG - Intronic
1052965345 9:34336321-34336343 ACCCCATTCCAGAAGCCAAAAGG - Exonic
1054946302 9:70799513-70799535 CTCCTTTTCCAGAGGAAAGAAGG - Intronic
1055059022 9:72049752-72049774 ACCCTTTTGCAGAGGTCTGAAGG - Intergenic
1055411392 9:76033804-76033826 GCCCTTTTAAAGAGGCCTGAGGG - Intronic
1055751758 9:79514189-79514211 AGCATTGTCCAGAGACCAGAAGG + Intergenic
1056346231 9:85698301-85698323 ATCCTTTTCCAAATGCCAGATGG + Intronic
1059659904 9:116390482-116390504 AACTTTATCCAGAGGCCAGTGGG + Intronic
1060144755 9:121242437-121242459 CCCTTTTTCCAGAGGACAGCAGG - Intronic
1060488137 9:124062556-124062578 ACCCTTTCCCAGAGGGCAGTGGG - Intergenic
1062093186 9:134689271-134689293 ACCTTTTTCCCAAGGGCAGAAGG - Intronic
1186178851 X:6953506-6953528 ACCAATTTCCTGAGGCCATAGGG + Intergenic
1188693943 X:33164813-33164835 ACTCTCCTACAGAGGCCAGATGG + Intronic
1189988983 X:46577030-46577052 ACCCTTCTTCACAGGCCTGAGGG + Intronic
1190310496 X:49113930-49113952 TCCCTTATCCATAGGCCTGAGGG - Exonic
1190733033 X:53236901-53236923 GCCCTTTGCCATAGGCTAGAAGG - Intronic
1194680981 X:96852282-96852304 AGCTTTTTCCAGTGGCCAGTTGG + Intronic
1195664910 X:107420359-107420381 CCCCTTAGGCAGAGGCCAGAAGG - Intergenic
1196102999 X:111866970-111866992 ACCCTCTCCCACAGGCCACACGG - Intronic
1202018178 Y:20434462-20434484 AACCAGTTCCAGAGACCAGAAGG - Intergenic