ID: 1149392522

View in Genome Browser
Species Human (GRCh38)
Location 17:56206371-56206393
Sequence CTGTATACATCCATCTACTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 107}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149392522_1149392523 17 Left 1149392522 17:56206371-56206393 CCTTAGTAGATGGATGTATACAG 0: 1
1: 0
2: 0
3: 5
4: 107
Right 1149392523 17:56206411-56206433 TTACTAGATTTGAGAAGCACAGG 0: 1
1: 0
2: 1
3: 15
4: 178
1149392522_1149392524 21 Left 1149392522 17:56206371-56206393 CCTTAGTAGATGGATGTATACAG 0: 1
1: 0
2: 0
3: 5
4: 107
Right 1149392524 17:56206415-56206437 TAGATTTGAGAAGCACAGGATGG 0: 1
1: 0
2: 1
3: 27
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149392522 Original CRISPR CTGTATACATCCATCTACTA AGG (reversed) Intronic
904778974 1:32930528-32930550 CTGTATAGTTCCAGCTACTCAGG - Intergenic
905995228 1:42375698-42375720 CTGTATAGTTCCAGCTACTCGGG - Intergenic
906252718 1:44323345-44323367 CTGTGTACGTCCCTCCACTAAGG - Intronic
908343927 1:63211769-63211791 CTGCTTCCATCCAACTACTATGG + Intergenic
917200489 1:172509389-172509411 CAGAATACATCCAACCACTAAGG + Intergenic
919531745 1:198729781-198729803 CTATACACATTCAACTACTAGGG - Intronic
919579471 1:199353801-199353823 CTGTATAAATACATCAAATAAGG - Intergenic
919582525 1:199394270-199394292 CTTTATCCATCCATCTTTTATGG + Intergenic
921759750 1:218899460-218899482 CTGAATACATCCATGTACATAGG + Intergenic
1065473224 10:26104793-26104815 ATGTATACATCCATTAACTAGGG - Intronic
1067347729 10:45448926-45448948 CTGTATTCACCCATCAACTTAGG - Intergenic
1067527046 10:47045358-47045380 CTGTATACATGCATCTGCATGGG - Intergenic
1067550644 10:47233234-47233256 CTGCATACATCCATGTATTAGGG - Intergenic
1068653607 10:59551585-59551607 CTGTAGACAACCATCTTCCAGGG + Intergenic
1069005782 10:63316045-63316067 CTGTAGAGTTCCATCTACTTGGG + Intronic
1074084788 10:110201438-110201460 CTGTATAAATCCTGCTACTCAGG + Intergenic
1078735759 11:14019149-14019171 CTCCATACATCCAAATACTATGG - Intronic
1079305096 11:19314968-19314990 CTGAATATATTCATCTCCTAGGG - Intergenic
1080188234 11:29518084-29518106 ATGTATACACACATCTACTGTGG - Intergenic
1081506196 11:43719538-43719560 CCTCATACACCCATCTACTATGG + Intronic
1083517560 11:63274502-63274524 CTATATACATCCCTCCCCTAGGG + Intronic
1086021215 11:82232053-82232075 TTGTATACATGAATGTACTAAGG - Intergenic
1086382312 11:86268979-86269001 CTGTATAAATCCATCAACAGGGG - Intronic
1097461326 12:59866211-59866233 GTGTATACATACATATACTTAGG + Intergenic
1100572431 12:95855677-95855699 TTGTATACAACCATCTAAAAAGG - Intergenic
1105554101 13:21429138-21429160 CAGTATACTTGTATCTACTATGG + Intronic
1109034896 13:57244093-57244115 ATTTATCCATTCATCTACTATGG - Intergenic
1111600003 13:90460833-90460855 ATTTATCCATCCACCTACTAAGG + Intergenic
1111961908 13:94820984-94821006 CTGTATACTTTCTTCTACTTGGG + Intergenic
1113739580 13:112701982-112702004 CTGTCTCCATCCATCTCCTCAGG - Intronic
1115192400 14:30759719-30759741 CTATAAACATCCATGTACTTTGG + Intergenic
1115735518 14:36324153-36324175 CTTTATACATACCTCTAATATGG - Intergenic
1115760031 14:36571062-36571084 ATGTATACATGCATTTAATATGG + Intergenic
1118983560 14:70734468-70734490 CTGCTTATATCCATCTACCAGGG + Exonic
1120657203 14:87205982-87206004 CTTTATACATGCATCCTCTAGGG + Intergenic
1120838232 14:89060189-89060211 CTATATACATTCCTTTACTAAGG + Intergenic
1123112127 14:105877551-105877573 CTTTATCCATGCATCAACTATGG - Intergenic
1126450991 15:48809424-48809446 CTTTGTACTTTCATCTACTACGG - Intronic
1127404790 15:58631275-58631297 ATGAAGACAACCATCTACTACGG + Intronic
1130018394 15:80205013-80205035 CTTTATACATCCTTCTAATCTGG + Intergenic
1141855070 16:86675327-86675349 CTTTATACTTCCTTCTATTAAGG + Intergenic
1143900139 17:10168144-10168166 CTTTAAATATCCATCAACTAAGG + Intronic
1149392522 17:56206371-56206393 CTGTATACATCCATCTACTAAGG - Intronic
1149875297 17:60226556-60226578 TTATATACATTCATGTACTATGG - Intronic
1151312368 17:73301350-73301372 CTTTATTTATCCATCTACAAGGG - Intronic
1151858389 17:76738714-76738736 CTGTAACCATCCAAGTACTAAGG - Intronic
1153156456 18:2155198-2155220 CTGTTTAGATGCATTTACTATGG - Intergenic
1159677817 18:71307859-71307881 TTGAATACATTCATCTACTGAGG - Intergenic
1161402042 19:4070561-4070583 CTGTCTACATCTATCCACCAAGG - Intergenic
929175341 2:38969864-38969886 CTGTATAGATCCTTCTAGAATGG - Intronic
930127402 2:47812711-47812733 CTGTATACATGCATCTGTAAGGG + Intronic
935403115 2:102681102-102681124 CTGTTTGTATCCATCTCCTATGG - Intronic
936443641 2:112578236-112578258 CTGTTTTCATCCATCTACACAGG - Intergenic
942312059 2:174665141-174665163 CTGCATACATCCCTATAATATGG + Intronic
943759234 2:191590763-191590785 CTGTATAATTCCAGCTACTTGGG - Intergenic
945808910 2:214524099-214524121 CTGTATATAACAATATACTATGG - Intronic
1170284018 20:14684837-14684859 ATGAATACAGCCATCCACTAAGG - Exonic
1174234939 20:49081913-49081935 ATGTATACATACATATACAATGG + Intronic
952395959 3:32921055-32921077 CTGAAGCCATCCATCTACTAGGG + Intergenic
952520924 3:34156744-34156766 CTGTAAAGATCCATCAACAAGGG - Intergenic
957831513 3:85527259-85527281 GTCTATACTTCCATCTACTCAGG + Intronic
959680103 3:109085850-109085872 CTTTATGCATTCATCCACTATGG - Intronic
962359741 3:134728029-134728051 CTTTGTCCATCTATCTACTAGGG - Intronic
963290505 3:143482365-143482387 TTGTATAAATCCATGTACTGTGG + Intronic
965550200 3:169956654-169956676 CTTTGTACATCCATCTACCATGG - Intergenic
966440402 3:179938533-179938555 CTGTCTGCATCCATCCACTGGGG + Intronic
967858003 3:194132931-194132953 CTGTCTACATCCAGCTCCTCTGG - Intergenic
969574460 4:8028903-8028925 ATTTATACATCCATGGACTATGG - Intronic
975598087 4:76069331-76069353 CTGTATAGATCTGTCTACTCTGG + Intronic
976309230 4:83593504-83593526 CTGAATACATCCAACTCTTAAGG + Intronic
981077393 4:140604735-140604757 CTGTATATATTCACCCACTAGGG - Intergenic
982042808 4:151411756-151411778 CTGTGTACATCTGTCTTCTAGGG + Intronic
982265093 4:153531155-153531177 CAGTGTACATGCATCCACTAGGG - Intronic
989958583 5:50383633-50383655 CTTTATCCATTCATCTACTGAGG - Intergenic
993534388 5:89064208-89064230 CTGGCTACATTCATTTACTATGG - Intergenic
1000155169 5:158543546-158543568 TTGTATACATTCATCTAATTCGG - Intergenic
1000517826 5:162261441-162261463 CTTTATACATTGATCTATTATGG - Intergenic
1000662542 5:163953260-163953282 CTGTATACATTTATCTATTTTGG + Intergenic
1004113529 6:12745213-12745235 CTTCATACATCCAACTGCTATGG - Intronic
1008217011 6:48804787-48804809 CTGTAATCATCCATTAACTAAGG + Intergenic
1008677964 6:53841581-53841603 CTGGATACTTCCATCAACCATGG - Intronic
1010435845 6:75829949-75829971 CTGTATTCACCCTGCTACTAAGG - Intronic
1011260588 6:85466054-85466076 CTGGATACACCCATCTCCTTGGG - Intronic
1013685569 6:112577583-112577605 CTTTATCCATTCATCTATTATGG - Intergenic
1019906929 7:4071879-4071901 CTGTGTACACACATCTACCAAGG - Intronic
1020111320 7:5449532-5449554 CTGTCTAGAACCATCTACTGAGG - Intronic
1020334743 7:7054224-7054246 CTCAAAACATCCATCTGCTACGG + Intergenic
1021000267 7:15320734-15320756 TTGTATGCATCCATTTATTAAGG - Intronic
1022864631 7:34405107-34405129 CTTTCTACATCCATCTCCTCCGG - Intergenic
1024799217 7:53057106-53057128 CTGTATATATCCCTCTCTTAAGG - Intergenic
1025851107 7:65244663-65244685 CTATACACATCTATATACTACGG + Intergenic
1026580064 7:71608335-71608357 CTGGCTCCATCCATCTACCAGGG + Intronic
1031354391 7:120773061-120773083 CTGTATATCTCCATTTACTTAGG + Intergenic
1039131827 8:34273594-34273616 CTGTGTACATACATGTACTGTGG + Intergenic
1039301788 8:36217280-36217302 ATGTATGCATCCGTCTTCTATGG - Intergenic
1051961087 9:22763530-22763552 CTTTATACATTCAACTACTGAGG - Intergenic
1052477392 9:28977661-28977683 CTGTATACATACATGTAAAATGG + Intergenic
1055446862 9:76393138-76393160 CTGAAAAAATCCATCTACTCTGG - Intronic
1056157116 9:83849484-83849506 CAGTATACAAACAGCTACTATGG - Intronic
1056353423 9:85774628-85774650 CAGTATACAAACAGCTACTATGG + Intergenic
1058889061 9:109345316-109345338 CTGCATTTATCCAGCTACTATGG + Intergenic
1186219866 X:7338581-7338603 ATGTCTACATCCTTCTCCTAGGG - Intronic
1186640456 X:11449737-11449759 CTTGATGCATCCATCTACTAAGG - Intronic
1188478783 X:30615587-30615609 CTATATACATCCTTCTTCTTTGG - Intergenic
1188918862 X:35947060-35947082 CTGGATAAATTCATCTCCTAGGG + Intronic
1194370696 X:93067494-93067516 CTTTATCCATCCCTCTACTTTGG - Intergenic
1196170013 X:112576974-112576996 CTGTAAGCATCAATCTTCTATGG - Intergenic
1196971967 X:121119611-121119633 CTCTATATATCTGTCTACTAAGG - Intergenic
1198059590 X:133032022-133032044 CTGTTTATATCCAGCTACTCGGG + Intronic
1198207789 X:134484508-134484530 ATATATACATCCATTTATTATGG - Intronic
1199916478 X:152347097-152347119 CTTTATCCAATCATCTACTATGG - Intronic
1200678488 Y:6179387-6179409 CTTTATCCATCCCTCTACTTTGG - Intergenic
1201952122 Y:19577067-19577089 CTGTCAACATCCATAAACTATGG - Intergenic