ID: 1149393255

View in Genome Browser
Species Human (GRCh38)
Location 17:56213521-56213543
Sequence CAAGGAAAACAGAGGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 910
Summary {0: 1, 1: 0, 2: 2, 3: 83, 4: 824}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149393245_1149393255 14 Left 1149393245 17:56213484-56213506 CCCTCATTCATATGTGGGAGTGT 0: 1
1: 0
2: 0
3: 61
4: 2681
Right 1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG 0: 1
1: 0
2: 2
3: 83
4: 824
1149393246_1149393255 13 Left 1149393246 17:56213485-56213507 CCTCATTCATATGTGGGAGTGTG 0: 1
1: 0
2: 0
3: 20
4: 189
Right 1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG 0: 1
1: 0
2: 2
3: 83
4: 824

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149393255 Original CRISPR CAAGGAAAACAGAGGGAGGC AGG Intronic
900322521 1:2092203-2092225 GTAGGAAAACAGGGGGAGGGCGG - Intronic
900613688 1:3554955-3554977 CAGGGAAAAGACAGGGCGGCTGG + Intronic
901460644 1:9389220-9389242 TAAGGAATAGAGTGGGAGGCAGG - Intergenic
901588634 1:10319918-10319940 CAAGGAAAAGAGACAAAGGCAGG - Intronic
901653713 1:10757292-10757314 CAAGGAAAAGAGAGGGCCCCAGG - Intronic
901964979 1:12859194-12859216 CAGCGATACCAGAGGGAGGCAGG - Exonic
902005125 1:13225900-13225922 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902024350 1:13371694-13371716 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902141042 1:14355624-14355646 CAAGGAGAACACATGGACGCAGG - Intergenic
902223345 1:14980847-14980869 GGAGGAAAAATGAGGGAGGCAGG + Intronic
902232468 1:15036515-15036537 GAAGCAAGGCAGAGGGAGGCAGG + Intronic
902460721 1:16574468-16574490 CAAGGAAAACAGAGGCTACCTGG + Exonic
902724491 1:18325746-18325768 CTGGGAAAACAGATGGAGACAGG - Intronic
902841473 1:19076870-19076892 CCAGTAACACAGAGGGAGGCTGG - Exonic
902936613 1:19769319-19769341 CAAGGAGAGCAGAGAGAGGAGGG - Intronic
903535901 1:24066175-24066197 CAAGAAAAATAGAGTAAGGCAGG - Intronic
903786938 1:25867601-25867623 CAAGGAAAAGAGATTCAGGCAGG + Intronic
904521520 1:31099732-31099754 CAAGGAAAGCAGGGGAAGGGAGG - Intergenic
904810004 1:33157276-33157298 CCTGGGAAACAGAGGGAGACTGG + Intronic
904811048 1:33163701-33163723 CAAGGAAAACAGAGGGCCTGAGG + Intronic
905346352 1:37313575-37313597 CAAGGCAAACAAAGAGATGCTGG - Intergenic
905392966 1:37650063-37650085 ATAGGAAAACTGAAGGAGGCTGG + Intergenic
905542094 1:38767939-38767961 CAAGGGAGGCAGAGGGAAGCTGG - Intergenic
905592072 1:39172914-39172936 CAAGGACAAAAAAGGGAGGAGGG - Intronic
906017975 1:42599968-42599990 GAAGGAAGAGAGAGTGAGGCAGG + Intronic
906047986 1:42847111-42847133 CAAGGAAGTCAGAGGGTCGCAGG - Intronic
906290209 1:44614779-44614801 CAGGGACAAGGGAGGGAGGCTGG - Intronic
906291039 1:44619318-44619340 CAAAGAAGCCAGAGGGAGGCTGG + Intronic
906472215 1:46140580-46140602 TAAGAAAAACAGAGGGAGATTGG + Intronic
906858182 1:49330909-49330931 CATGGAGAACAGAGGAAAGCAGG + Intronic
907676418 1:56521712-56521734 AAAGGAAGAGAGAGGGAGGGAGG - Intronic
907915145 1:58861379-58861401 GAAGGAAGAGAGAGGGAGGCAGG + Intergenic
908241032 1:62189107-62189129 CAAGAAAAAATGAGGGAGGCCGG - Intergenic
910067900 1:83175330-83175352 CAAAGCAATAAGAGGGAGGCAGG + Intergenic
910206702 1:84755393-84755415 CAAGAAAACCAAAGGGCGGCAGG - Intergenic
910752570 1:90649791-90649813 CAAAGAAAACAGAGGTAGATGGG + Intergenic
910772959 1:90848188-90848210 CAAGGAAAAGAGTGGGATGGGGG - Intergenic
911099507 1:94083753-94083775 GAAGGAAAACAGAGTGCAGCTGG + Intronic
911282192 1:95943671-95943693 AAAGGAAAAGAAGGGGAGGCAGG - Intergenic
911540831 1:99156356-99156378 CAAGGAGAACAGATGGACACAGG - Intergenic
912653493 1:111463541-111463563 CAAGTAAAACAGAGAGAGAGAGG + Intergenic
913126029 1:115791128-115791150 CAAGGCAACCAGAAGGATGCTGG + Intergenic
913372345 1:118114994-118115016 CAAGGAAGAGACAGGGAGTCGGG - Intronic
913577664 1:120193485-120193507 CAGGAAAAAGAGAGTGAGGCGGG - Intergenic
913604697 1:120454111-120454133 CAAGGAAAACAGAGGCTACCTGG - Intergenic
913630506 1:120704855-120704877 CAGGAAAAAGAGAGTGAGGCGGG + Intergenic
913641568 1:120816824-120816846 CAAGGAAAACAGAGGCTACCTGG - Exonic
914083845 1:144435092-144435114 CAAGGAAAACAGAGGCTACCTGG + Exonic
914189864 1:145400370-145400392 CAAGGAAAACAGAGGCTACCTGG + Exonic
914211714 1:145586072-145586094 CAAGGAAAACAGAGGCTACCTGG + Intergenic
914276915 1:146133504-146133526 CAAGGAAAACAGAGGCTACCTGG + Exonic
914365897 1:146977668-146977690 CAAGGAAAACAGAGGCTACCTGG - Exonic
914456413 1:147841146-147841168 CAGGGAACCCAGAGGGAGGCGGG - Intergenic
914486547 1:148115774-148115796 CAAGGAAAACAGAGGCTACCTGG + Exonic
914537959 1:148584452-148584474 CAAGGAAAACAGAGGCTACCTGG + Exonic
914559577 1:148804916-148804938 CAGGAAAAAGAGAGTGAGGCGGG - Intergenic
914586877 1:149070915-149070937 CAAGGAAAACAGAGGCTACCTGG + Exonic
914613256 1:149325307-149325329 CAGGAAAAAGAGAGTGAGGCGGG + Intergenic
914627964 1:149480881-149480903 CAAGGAAAACAGAGGCTACCTGG - Intergenic
915212549 1:154321309-154321331 TAAGGACAACAGAAGGAGCCAGG - Intronic
915342998 1:155186380-155186402 GAAGGAGAGCAGAGGGAGGAGGG - Intronic
915346707 1:155201249-155201271 CAGGGAAAATATAGGGAGGAGGG - Intronic
915716565 1:157950148-157950170 GAGGGGAAACAGAGGGAGGGAGG + Intergenic
916105190 1:161424527-161424549 AAAGAAAAAGGGAGGGAGGCAGG - Intergenic
916982708 1:170155359-170155381 AAAGGAAAAAAGAGAGAGGAAGG - Intronic
917621114 1:176796904-176796926 AAAAGAAAATAGAGGGAGGAAGG - Intronic
917644846 1:177019712-177019734 ATAGAAATACAGAGGGAGGCTGG + Intronic
917812044 1:178668424-178668446 AAAGGAGAAGGGAGGGAGGCAGG + Intergenic
918283497 1:183028705-183028727 CAAGGAAAACCAAAGGAGTCTGG - Intronic
918660465 1:187081781-187081803 GAAGGAAAAGGGAGGGAGGGAGG - Intergenic
918780836 1:188697884-188697906 AAAGAAAAACAAAGGGTGGCCGG - Intergenic
919432810 1:197517909-197517931 CAAACAAAACATGGGGAGGCTGG - Intronic
919613511 1:199776674-199776696 AAAGGAATAAAGAGGGAGGAAGG - Intergenic
920578896 1:207086045-207086067 GAAGGGGAGCAGAGGGAGGCAGG + Intronic
920667602 1:207975340-207975362 GAAAGAAACTAGAGGGAGGCTGG + Intergenic
921183705 1:212652257-212652279 TAAAGAAAGCAGAGGGAGCCTGG + Intergenic
922033538 1:221826705-221826727 GAAAGAAAAGAGAGGGAGGGAGG + Intergenic
923114535 1:230922667-230922689 AATGGAAAACAGAGAGAGGTGGG - Intronic
923321923 1:232842785-232842807 CAAAGGAAACAGATGGAGGATGG + Intergenic
923776098 1:236979877-236979899 CAAGGACACCAGAGGAAAGCAGG + Intergenic
924584787 1:245352685-245352707 CAAGGAAAAGTGATAGAGGCAGG + Intronic
924846797 1:247782530-247782552 CAAGGGAGACAGATGTAGGCTGG + Intergenic
1063149253 10:3321824-3321846 CACGGAAGAAAGATGGAGGCCGG - Intergenic
1063218093 10:3942219-3942241 AAAGAAAAAGAGAGAGAGGCAGG + Intergenic
1063872088 10:10428658-10428680 CAAGGAAAAGAGTGGGAAGAGGG - Intergenic
1064033713 10:11899251-11899273 CAAGGAAAACAGCGGGCCTCTGG + Intergenic
1064054033 10:12082330-12082352 GAAAGAAAACAGAATGAGGCGGG - Intronic
1064844670 10:19638310-19638332 CAGGGAAAACAAAAGGAGGTGGG + Intronic
1065037267 10:21652555-21652577 ATATGAAAACAGAGGGAGACTGG + Intronic
1065268772 10:24004966-24004988 CAAGGAAAAGAGATGGATGGTGG + Intronic
1065298520 10:24299881-24299903 GAAGGAAAACAGAGGCAGTTTGG - Intronic
1066102816 10:32132919-32132941 AAAGGCAAAAAGAGGGAGACAGG - Intergenic
1066174888 10:32893278-32893300 TAAGAGCAACAGAGGGAGGCGGG + Intergenic
1066239861 10:33523152-33523174 CAGGGAAAAAAGTGGGAAGCTGG + Intergenic
1067297229 10:44981874-44981896 CTAGGGAAACCGAGGGAGGTTGG + Intronic
1067383274 10:45794837-45794859 CAAAGAAAACAGAAAGAAGCTGG - Intergenic
1067432835 10:46255171-46255193 CAAGGAAAGCAGATGGGGGCAGG + Intergenic
1067440431 10:46306314-46306336 CAAGGAAAGCAGGTGGGGGCAGG - Intronic
1067462448 10:46467653-46467675 AAAGGAAGACGGAGGGAGGGAGG + Intergenic
1067624748 10:47916984-47917006 AAAGGAAGACGGAGGGAGGGAGG - Intergenic
1067748197 10:48952348-48952370 CACTGTAATCAGAGGGAGGCTGG - Intronic
1067890980 10:50135385-50135407 CAAAGAAAACAGAAAGAAGCTGG - Intergenic
1068425700 10:56860770-56860792 CATGGAAGACAGATGTAGGCTGG + Intergenic
1068731075 10:60358440-60358462 GAAGTAAAACACAGTGAGGCAGG - Intronic
1069095444 10:64253864-64253886 AAAAGAAAAAAGAGAGAGGCAGG - Intergenic
1070050521 10:72884914-72884936 CAAAGATAACAGAGTGAGGGAGG - Intronic
1070307744 10:75249690-75249712 CAAGAAAAGGAGAGGAAGGCTGG - Intergenic
1071116891 10:82232450-82232472 CAAGCAACACAGAGGGAGTGGGG - Intronic
1073043732 10:100624041-100624063 GAAGGAAAACAGAGGGCTTCTGG - Intergenic
1074905315 10:117857508-117857530 CAATGCAAACCTAGGGAGGCTGG - Intergenic
1075077359 10:119360104-119360126 CGAGGGAATCTGAGGGAGGCAGG + Intronic
1075968047 10:126629866-126629888 CAAGGAAAAGTGAGGGTGGTGGG + Intronic
1076037328 10:127210724-127210746 AAAGGAAAACAAAAAGAGGCAGG - Intronic
1076620071 10:131781341-131781363 CAGGCACAACAGAGGGATGCAGG + Intergenic
1076839547 10:133039297-133039319 CAAGGAAAACAGCGGGGCTCAGG - Intergenic
1078062884 11:8059862-8059884 CAAGGAGACCAGAAGGAGGCTGG + Intronic
1078079851 11:8196037-8196059 CAAGGAAAGCAAATGGAAGCAGG + Intergenic
1078646886 11:13148802-13148824 CCTGGAAAAGAAAGGGAGGCTGG + Intergenic
1078720657 11:13880678-13880700 CAAGGTAATGAGAGGGAAGCTGG - Intergenic
1078725313 11:13924852-13924874 CAAGGAGAAAAGAGGAAGGAAGG - Intergenic
1079049113 11:17137761-17137783 AAAGGAAAGCAGAGGAAGGGTGG - Intronic
1079088328 11:17463016-17463038 TGAGGAAGAGAGAGGGAGGCGGG + Intronic
1079110818 11:17604183-17604205 CAAGAAATACAGAGGATGGCAGG + Intronic
1079826399 11:25200956-25200978 GAAGGAAAGAAGAGGGAGGGAGG + Intergenic
1080915969 11:36659914-36659936 CAAGGAGAAAAGAGGGATGAAGG + Intergenic
1081019158 11:37921823-37921845 GAAGGTAAACAGAAAGAGGCAGG - Intergenic
1081612276 11:44569690-44569712 CAAGGTAAAAATAGGGAGGTAGG - Intronic
1082008373 11:47433883-47433905 AGAGGAAGACAGAGGGAGGGAGG + Intergenic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1083089316 11:60183970-60183992 CAAGGAAACCAGAGCCAGTCAGG + Intronic
1083447062 11:62715202-62715224 CAAGGAAAACAGGGGCTGTCGGG - Exonic
1083477022 11:62921403-62921425 AAAGGGAAAGAGAGGGAGGGAGG + Exonic
1083629772 11:64089514-64089536 CATGGATAACAGGAGGAGGCTGG - Intronic
1083840380 11:65301145-65301167 CAAGGCAAAGAGAGGGAGGGAGG + Intronic
1084286198 11:68132608-68132630 GAAGGAAGACAGAGAGAAGCTGG + Intergenic
1084343698 11:68528055-68528077 CAGAGAAAACAGAGACAGGCAGG - Intronic
1084683546 11:70680727-70680749 CCAGGGAAAGAGAGAGAGGCTGG - Intronic
1084894939 11:72259278-72259300 TAAGGAATACAAAGGGAGGCAGG - Intergenic
1085202419 11:74709670-74709692 CACTGAAAAGATAGGGAGGCAGG + Intronic
1085435350 11:76494626-76494648 AAAGGAAAGGAGAGGAAGGCAGG - Intronic
1085681185 11:78576647-78576669 GAAGGAAGAGAGAGGGAGGGGGG - Intergenic
1086571632 11:88291504-88291526 CAAGAAAAGAAGAGGGAGGGAGG + Intergenic
1086585574 11:88447802-88447824 AAAGAAAAAAAAAGGGAGGCGGG + Intergenic
1086853039 11:91833584-91833606 GAAGGAAAAAAGAAAGAGGCAGG + Intergenic
1087078918 11:94151223-94151245 GAAGGAAAATAGAGAGAGGAGGG - Intronic
1087596680 11:100262736-100262758 CAAGGAAAACACATGGACACAGG + Intronic
1087761762 11:102110469-102110491 CAGGGAAAAGAAAGGGAGGAAGG + Exonic
1088449663 11:109967899-109967921 CAAGGAAGAAAGATGAAGGCCGG - Intergenic
1088690610 11:112323480-112323502 CAAGGAAAACACATGGACACAGG - Intergenic
1088970383 11:114769760-114769782 CAAGGAAAACACATGGACACAGG + Intergenic
1089012198 11:115140396-115140418 CATGGAAAAAAGAGGAAGGGTGG - Intergenic
1089061639 11:115630637-115630659 CAAGGAACAGAGAGGGTCGCCGG - Intergenic
1089128756 11:116195515-116195537 CCAGGAAACCAGAGGGAGTCAGG + Intergenic
1089352982 11:117831895-117831917 CCAGGAAAACAGAGGTCAGCTGG - Intronic
1089702884 11:120255863-120255885 CAAGGTCACCAGAGGGAGGAAGG - Intronic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090926145 11:131252012-131252034 CAAGAGAAACAGGGTGAGGCAGG - Intergenic
1091250740 11:134141756-134141778 CAAGGGGCACAGAGGGAGGCAGG + Intronic
1091534362 12:1391591-1391613 CAGGGAAAGCCGAGGGAGGCAGG - Intronic
1091590911 12:1842573-1842595 CGAGGAGAAAAGAGGGAAGCTGG - Intronic
1091703775 12:2680318-2680340 CAAGGAGAAAAGAGTGAGTCAGG - Intronic
1092290493 12:7157244-7157266 GAACAAACACAGAGGGAGGCAGG - Intronic
1092505093 12:9090516-9090538 GAAGGAGAACAGAGGGAGAATGG + Intronic
1092585253 12:9893700-9893722 CAAAGAAAAAAAAGGGAGGGAGG - Intronic
1093439387 12:19176208-19176230 GGAGGAAGACAGAGGGAGGGAGG - Intronic
1093727279 12:22529071-22529093 CAAGGAAAACCGGGGTGGGCAGG + Intronic
1094246897 12:28308561-28308583 CAAGGAAAAGAGAGGAAGAAGGG - Intronic
1095097113 12:38154757-38154779 CAGGGAAAAAAGCGGAAGGCCGG + Intergenic
1095323899 12:40863943-40863965 GAAGGAGAAGAGAGGGAGGGAGG - Intronic
1095659759 12:44717862-44717884 CAAGGAGACCAGAGTGATGCAGG + Intronic
1095861658 12:46924273-46924295 CAAGGAAAAGGGAAGGAGGTAGG + Intergenic
1096279584 12:50240906-50240928 CAAGGAAGAGAGAGAGAGGGAGG + Intronic
1096413457 12:51393016-51393038 AAAGAAAAAAGGAGGGAGGCGGG - Intronic
1096418477 12:51434690-51434712 CTAGAGAAACAGAGGGAGGGAGG - Intronic
1097313633 12:58149199-58149221 CAAGAAAGAGAGAGGGAGGAAGG - Intergenic
1098301854 12:69062369-69062391 CCAGGATCACAGAGGGAGTCAGG + Intergenic
1098809446 12:75067782-75067804 TTATGAAAACAGAAGGAGGCAGG - Intronic
1099003790 12:77213422-77213444 CAAGAAAAAAAGTGGGAGGGAGG - Intergenic
1099924156 12:88997016-88997038 AAGGGAAAAGAGAGGGAGGGTGG + Intergenic
1100165189 12:91909030-91909052 CAAGGAAAAGGGTGGGAGGAGGG + Intergenic
1100616771 12:96236942-96236964 CAAGGAACACCAAGGGTGGCTGG - Intronic
1101047124 12:100820057-100820079 AAAGGGAAATAGAGGGAGGGAGG - Intronic
1101291623 12:103376353-103376375 CAATGAAAACACACGGACGCAGG + Intronic
1101498823 12:105281844-105281866 AAGGGAAAACAGAAGGAGCCTGG + Intronic
1101857595 12:108456832-108456854 CCAGGGACACAGCGGGAGGCCGG - Intergenic
1102068175 12:109996131-109996153 CCAGGAAAGCAGAGGGGAGCGGG + Intronic
1102153287 12:110703681-110703703 CAAAAAAAAAAGAGAGAGGCGGG - Intronic
1102300469 12:111767334-111767356 CCTGGAAAACAGACCGAGGCTGG - Intronic
1102422672 12:112816334-112816356 CATAGAAAACACAGGCAGGCTGG + Intronic
1102508461 12:113398666-113398688 CAAGGAAGAGAGAGGGCGCCTGG - Intronic
1102974218 12:117194849-117194871 CAAAGAAAAGAGAGAGAGGAAGG - Intergenic
1103318765 12:120077951-120077973 GAGGGAAACCAGAGGGACGCAGG - Intronic
1103405582 12:120672731-120672753 CAAAGAAACCCAAGGGAGGCTGG + Intergenic
1103514511 12:121498624-121498646 CAAAGAAAACAAAGGGGGGTGGG - Intronic
1103622237 12:122194621-122194643 AAAGGAAGAAAGAGGGAGGGAGG - Intronic
1103741868 12:123096566-123096588 GAAGGAAGAAAGAGGGAGGAAGG + Intronic
1103994583 12:124820777-124820799 CACAGAAAACAGTGGGGGGCAGG + Intronic
1104382747 12:128322151-128322173 CAAGAGAGACAGATGGAGGCTGG - Intronic
1104657122 12:130581614-130581636 CAAAGAGAACAGAGGAAGGAAGG - Intronic
1104737252 12:131143232-131143254 GAAGGAAGTCAGAGGGCGGCAGG - Intergenic
1104938921 12:132385731-132385753 CAGGGAAAACACAGAGAGGCTGG + Intergenic
1104988619 12:132611542-132611564 CAAGGAGCAGAGAGAGAGGCAGG + Intergenic
1105461534 13:20594187-20594209 CAAGGGAAACAAAGAGAAGCTGG - Intronic
1105618766 13:22046768-22046790 CAACGAATACAGTGGGAGGGAGG - Intergenic
1106216483 13:27706448-27706470 AAATGAAAAAAGAGGGAGGCAGG - Intergenic
1106449314 13:29865419-29865441 CAAAGAAAATAGAGTCAGGCAGG + Intergenic
1106704506 13:32266374-32266396 CAAGGAAACCAGAGATACGCAGG - Intronic
1107274606 13:38664158-38664180 ACATGAAAACAGAGGGTGGCAGG - Intergenic
1107315423 13:39126424-39126446 CAGGGAGAAGAGAGGTAGGCAGG + Intergenic
1107401974 13:40077970-40077992 CAGGTAGAAGAGAGGGAGGCAGG + Intergenic
1107595532 13:41959926-41959948 CAAGGAAAACTGGGGGTTGCGGG + Intronic
1107688479 13:42928066-42928088 CAAGGACCACAGATAGAGGCTGG - Intronic
1108074118 13:46661103-46661125 CCAGGAAAACAGTGGAAGGAGGG - Intronic
1108320363 13:49283657-49283679 CAAGAGAAGCAGAAGGAGGCAGG + Intronic
1108502835 13:51084133-51084155 CAAGGAATCCAGATGGAGTCAGG + Intergenic
1108707472 13:53002668-53002690 CAAAGAAAGCAGTGGCAGGCAGG - Intergenic
1108902403 13:55428022-55428044 CAAGGAAAAGGGTGGGAGGGGGG + Intergenic
1109006603 13:56885492-56885514 CATGGAACAGAGAGGGAGGAAGG + Intergenic
1109873995 13:68374120-68374142 AAAGGAAAAGAGAGGGAGGTAGG + Intergenic
1110386072 13:74912192-74912214 GAAGGAACATAGAGGGAGGTAGG + Intergenic
1110410045 13:75194925-75194947 CAAGGGCAACAGAGGAAGGTTGG - Intergenic
1110833349 13:80056867-80056889 CAAGGTAAACATGGGGATGCAGG - Intergenic
1110917597 13:81042596-81042618 AAAGGAAGAGAGAGGGAGGGGGG + Intergenic
1110977030 13:81851420-81851442 TAAGGAAAACAGAAGGAAGAAGG + Intergenic
1111123667 13:83884389-83884411 CAAGGAAAACAGAAAAATGCTGG + Intergenic
1112632914 13:101181319-101181341 CACGGATAAGAGAGGGAGGCTGG + Intronic
1113262914 13:108585567-108585589 GAAGGAAAACAAAGGGAGAAGGG + Intergenic
1113296449 13:108964189-108964211 CAAGGAAAAAAGAGCAAGGGTGG - Intronic
1113432712 13:110264454-110264476 TAAGAACAACAGAGGGAGGACGG + Intronic
1113699009 13:112369344-112369366 CAAGGAAAACAGATGAGTGCTGG + Intergenic
1113709920 13:112456450-112456472 GAAAGAAACCAGAGGCAGGCAGG + Intergenic
1114180697 14:20365240-20365262 CAAGAAAGAGAGAGGGAGGGCGG - Intergenic
1114537316 14:23431315-23431337 GGAGAAAAACAGAGGGAGGGAGG + Intronic
1114630400 14:24155846-24155868 AAAGGGAAGCAGAGGGAGGGAGG + Intronic
1115054667 14:29108814-29108836 GAAAGAAAAAAGAGGGAGGGAGG + Intergenic
1116175768 14:41468704-41468726 CAATGAGAAAAGAAGGAGGCTGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117732447 14:58736940-58736962 CAAGGTAATCAGAGAGAGACCGG + Intergenic
1118478777 14:66143367-66143389 CAAAGAAAACAGAGAGGGGATGG + Intergenic
1118637278 14:67759264-67759286 AAAGGAAAACACAGAAAGGCAGG + Intronic
1118971889 14:70643751-70643773 CTGGGAAGACAGAGGTAGGCTGG - Intronic
1119355059 14:73999497-73999519 CAAAAAAAACAAAGGTAGGCCGG + Intronic
1120312909 14:82854287-82854309 CAAGGAAGTCAGAGGGAGTCTGG - Intergenic
1120335734 14:83151772-83151794 GAAGGAAATGAAAGGGAGGCAGG + Intergenic
1121006773 14:90495730-90495752 CAAGGAAAACAGTGGGATGATGG + Intergenic
1121260008 14:92559161-92559183 CAAGGAAGAGAGAAGGGGGCCGG - Intronic
1122141198 14:99664101-99664123 CAAGGACAAAAGCAGGAGGCTGG - Intronic
1122221007 14:100239139-100239161 GAAGGAAGGCAGAGGGAGGAAGG - Exonic
1122823143 14:104357038-104357060 CAAGGAAAGCCGAGGGAGATTGG + Intergenic
1122868400 14:104621368-104621390 GAAGGAAAAGAGAGGAAGGAAGG + Intergenic
1122917935 14:104867354-104867376 CAGGGAACACAGAGGCAGGGCGG - Intronic
1123887067 15:24736605-24736627 CAAGGAAAACAGAGATTGGAGGG - Intergenic
1124060710 15:26291435-26291457 CAAGGAAAGCAGAGGTTAGCAGG - Intergenic
1124408186 15:29410585-29410607 TCAGGAAGGCAGAGGGAGGCAGG - Intronic
1124515163 15:30361612-30361634 CAAGGAGATCAAAGGGACGCAGG - Exonic
1124633715 15:31352011-31352033 CAAAAAAAAAAAAGGGAGGCGGG + Intronic
1124727759 15:32169115-32169137 CAAGGAGATCAAAGGGACGCAGG + Intronic
1125145243 15:36459930-36459952 AAAAGAAAACAAAAGGAGGCTGG + Intergenic
1125617813 15:41031450-41031472 GAAGGAAAAGAGAGGGAAGGAGG + Intronic
1125834775 15:42739435-42739457 TAGGGAAAAAAGAGGGAGGGGGG - Exonic
1125968220 15:43891274-43891296 CAAATAAAACAGAGAGGGGCAGG + Intronic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1126988071 15:54337921-54337943 AAAGTAAAACAGAGGAAGGATGG - Intronic
1127446362 15:59067223-59067245 AAAAGGAAACGGAGGGAGGCAGG - Intronic
1127608063 15:60609907-60609929 CAATGAAAACAGAAGCAGGGAGG + Intronic
1127633547 15:60848373-60848395 TAAGGGAAAAAGAGGGAGGAAGG + Intronic
1128341839 15:66827712-66827734 CAAGGAGAACAGAGGAAAGAAGG - Intergenic
1128526553 15:68416061-68416083 GAAGTAGAAGAGAGGGAGGCAGG - Intronic
1128732011 15:70027455-70027477 GAAGGATGACAGAGGGAGGCTGG + Intergenic
1128763103 15:70232380-70232402 CAAGGAAAAGGGAAGCAGGCCGG - Intergenic
1128768475 15:70265303-70265325 CCAGGAAGACAGAGGCAGGCAGG - Intergenic
1129239591 15:74243574-74243596 GAAGGGTGACAGAGGGAGGCAGG + Intronic
1129288648 15:74546197-74546219 CAAAGCAATCAGTGGGAGGCGGG - Intronic
1129959024 15:79666470-79666492 CAAGTATGACAGAGGGAGACAGG + Intergenic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130812114 15:87390517-87390539 AAAGCAAGACAGAGGCAGGCTGG + Intergenic
1131393362 15:92067305-92067327 CACGGGAAGCAGAGGGAGGAGGG - Intronic
1132435345 15:101796452-101796474 CAAAGAGCACAGAGGGAGGCTGG - Intergenic
1132630024 16:912767-912789 CAAAGAAAACAGAAGCAGGTGGG - Intronic
1132758161 16:1495998-1496020 CAGGGAAAACAGAGCGAGCATGG - Intronic
1132924350 16:2420758-2420780 GAAGGAAAAGAGAGAGAGGGAGG - Intergenic
1132932308 16:2464890-2464912 GAGAGAAAACAGAGGGAGCCAGG - Exonic
1133723359 16:8515663-8515685 AAAGGAAGAGAGAGGGAGGGAGG - Intergenic
1133814087 16:9183206-9183228 CCAGGAAGCCAGAGGGAGTCGGG + Intergenic
1133941835 16:10315927-10315949 TGAGGAAAACAGTGGGAGGCAGG - Intergenic
1134229489 16:12417833-12417855 CAAGAAAAACAGGGAGAGGCAGG - Intronic
1134754850 16:16657975-16657997 CAAGGAAAAAAGAGCCAGGAAGG + Intergenic
1134760303 16:16708720-16708742 CAATGAAAACACATGGACGCAGG - Intergenic
1134985768 16:18650485-18650507 CAATGAAAACACATGGACGCAGG + Intergenic
1134991211 16:18701158-18701180 CAAGGAAAAAAGAGCCAGGAAGG - Intergenic
1135031686 16:19043866-19043888 CAAAGAAAACAAAAGCAGGCCGG - Intronic
1135339805 16:21635898-21635920 CAAGGAGGACTGAGGAAGGCCGG + Intronic
1135542606 16:23343521-23343543 GAAGGAAGAAAGAGGGAGGGAGG + Intronic
1135594328 16:23730106-23730128 AAAGGGAAACAGGGTGAGGCAGG - Intergenic
1135894440 16:26386138-26386160 CAGGGAAAGCAGAGTGAGGCTGG - Intergenic
1135999230 16:27278317-27278339 AAAGAAAAAGAGAGGGAGGGAGG + Intronic
1136012447 16:27372588-27372610 AAAGGCCAGCAGAGGGAGGCAGG - Intergenic
1136574397 16:31114912-31114934 AAAAGAAAAAAGAGGGAGGAAGG - Intergenic
1137362353 16:47830328-47830350 CAAGGCAAACAGAGTCTGGCTGG - Intergenic
1137396363 16:48118276-48118298 CAGAGAAAACCGAGGGAGGAGGG - Intronic
1137616331 16:49849670-49849692 GGAGGTAAACAGAGGGAGGCAGG + Intronic
1137720053 16:50622490-50622512 GAAGGCAAACAGAGGGAAGGAGG - Intronic
1137727159 16:50664858-50664880 AAAGGAAAATGGAAGGAGGCTGG - Intergenic
1137742118 16:50788550-50788572 TGAGGAGAATAGAGGGAGGCTGG + Intronic
1137820392 16:51439129-51439151 AAAAGAAAAAAGAGGGAGGAAGG + Intergenic
1137926223 16:52545605-52545627 AAAGAAAAAGAGAGGGAGGAGGG + Intronic
1138053876 16:53812107-53812129 CAAGGAAACAAGAGACAGGCTGG - Intronic
1138127193 16:54448457-54448479 CGCAGAAAACAGAGGCAGGCAGG - Intergenic
1138378367 16:56582667-56582689 CAAGGAAAAACGAGGGAGGGAGG + Intergenic
1138613452 16:58145814-58145836 AAAAGAAAAAAGGGGGAGGCCGG - Intergenic
1139445490 16:66995678-66995700 CAAGGAAAACAGATGCATGTGGG + Exonic
1139599307 16:67976975-67976997 CAAGGAACCCAGAGGCAGGGTGG - Intronic
1140045409 16:71437365-71437387 AAAGGAAAAGAAAGGGAGGGAGG + Intergenic
1140257516 16:73349758-73349780 GAGGGAAAAAAGAGGGAGGAAGG - Intergenic
1141138428 16:81481869-81481891 AAAAAAAAAAAGAGGGAGGCGGG - Intronic
1141740297 16:85887197-85887219 CAAGGAAGACTGAGGGTGCCCGG + Intergenic
1141767759 16:86070101-86070123 CACCGAAGCCAGAGGGAGGCAGG + Intergenic
1142312974 16:89324641-89324663 CATGGAAGAAAGATGGAGGCTGG - Intronic
1142786964 17:2231899-2231921 AGAGGAAAACAGAGGGAGCCAGG + Intronic
1142875239 17:2848479-2848501 GAAGGAAAAGAGAGAGATGCAGG - Intronic
1142905787 17:3040958-3040980 CAGGGAAACCAGAGAGAGCCAGG - Intergenic
1143179493 17:4975153-4975175 CAAGGACAAGAAGGGGAGGCAGG + Intronic
1143373173 17:6453059-6453081 AAAGGAAGACAGAGAGAGGAAGG - Exonic
1143955475 17:10664840-10664862 CAAGGACAAAAAAAGGAGGCAGG + Intergenic
1144580554 17:16456633-16456655 GAGGGAACACAGAGGGAGGCAGG + Intronic
1146382071 17:32338154-32338176 GAAGGAAAACATGGGAAGGCAGG - Intronic
1146804109 17:35851445-35851467 TAAGAAAAAAAGAGGGAGGATGG + Intronic
1147499405 17:40948470-40948492 CAAAGGAAACAGAGAGAGGGAGG - Intergenic
1147575128 17:41594593-41594615 GAAGGAGGACAGAGGGAGGGAGG + Intergenic
1147844263 17:43393850-43393872 CAGGGAACACTGAGGCAGGCAGG - Intergenic
1147874553 17:43611867-43611889 CAAGGAGGACAGAGGAAGGGAGG - Intergenic
1147879304 17:43643634-43643656 CCAGGAGAACAGAGGGAAGCCGG - Exonic
1147992773 17:44345240-44345262 CAATGGAAACTGAGGTAGGCGGG + Intronic
1148081307 17:44968740-44968762 CCAGGAAAACAGAGGGACTGGGG + Intergenic
1148378271 17:47170187-47170209 AAAGGAAGACAGAGAGAGGGAGG - Intronic
1148514272 17:48201328-48201350 CAAGGAAGAGAGAGAGAGGGAGG - Intronic
1148545518 17:48515938-48515960 GAAGGAAAAGGGAGGGAGGAAGG + Intergenic
1149189417 17:54041251-54041273 CAAGAAAGAGAGAGGGAGGGAGG + Intergenic
1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG + Intronic
1150242554 17:63646933-63646955 AAAGGAAAGCTGAGGGTGGCAGG - Intronic
1150365154 17:64576204-64576226 CAAAAAAAAGAGAGGGAGGGAGG + Intronic
1150455193 17:65301650-65301672 CAAAGAAAAGATAGGGAGTCAGG - Intergenic
1151345812 17:73500562-73500584 GGAGGAGAACAGAGGGAGGATGG - Intronic
1151444269 17:74152972-74152994 TAAGAAAAACAGAGAGAGGGTGG + Intergenic
1151547114 17:74799925-74799947 CAAGGTAAACCGTGGGAGGGCGG - Intronic
1152025226 17:77804670-77804692 CAGGGAAAACTGTGGGAGCCTGG - Intergenic
1152372085 17:79894993-79895015 GAAGGAAGAAAGAGGGAGGAAGG - Intergenic
1152715062 17:81895513-81895535 CAAGGTCAAGAGATGGAGGCCGG + Intronic
1152715081 17:81895592-81895614 CAAGGTCAAGAGATGGAGGCCGG + Intronic
1153883967 18:9446688-9446710 AAAGGAAAAGAGAGGGAGGGAGG - Intergenic
1154038743 18:10833154-10833176 CAAGGAACACAGTGGCAGGATGG + Intronic
1155010135 18:21769166-21769188 AAAGGATAACAGAGGTAGGTGGG - Intronic
1155680852 18:28483698-28483720 CAGGGAAAGAAGTGGGAGGCAGG + Intergenic
1156165031 18:34408112-34408134 CAAGGAAAACACATGGACACAGG - Intergenic
1156550477 18:38011143-38011165 CAAAGAAGACAGAAGGAGGGAGG + Intergenic
1157111879 18:44828309-44828331 CAATGAAAACAAAGGGACTCAGG + Intronic
1157241597 18:46015032-46015054 CAAGGGAGTCAGAGGGATGCAGG + Intronic
1157531294 18:48423113-48423135 TAAGGAAAAGAAAGGCAGGCGGG - Intergenic
1157824736 18:50802542-50802564 CAGGTAAACCAGAGGGAGGAGGG + Intronic
1157951058 18:52037643-52037665 AAAGGAAAAGAGAGAGAGGAAGG + Intergenic
1158065267 18:53399607-53399629 CAAAGAAATCAGAGGGGGCCGGG + Intronic
1158127739 18:54120716-54120738 CAAAGGAAACAGAAGAAGGCTGG + Intergenic
1158544823 18:58387040-58387062 GAAGAAACACAGAGGGAGGCAGG - Intronic
1159161751 18:64651394-64651416 CAAGGAAAGCTGTGGGTGGCAGG - Intergenic
1159379896 18:67643481-67643503 CCTGGACAACAGAGGGAGACTGG - Intergenic
1159670663 18:71216994-71217016 CAAGGAATCCAGATGGAGGGTGG - Intergenic
1160338074 18:78060489-78060511 CAAGGAAAAACCAGGGAGCCAGG - Intergenic
1160483243 18:79262119-79262141 CAAGGAAAGGGGAGGGAGGGAGG - Intronic
1160684782 19:428657-428679 CAAAGAAAACAGATGCAGACAGG + Intronic
1160692806 19:467557-467579 CAAGGATAAGAGGGGGAGGGAGG + Intronic
1160716251 19:578144-578166 GGAGGGAAACTGAGGGAGGCGGG - Intronic
1160906526 19:1454017-1454039 CAGGGCCAGCAGAGGGAGGCAGG + Intronic
1161458408 19:4381556-4381578 CAGGGGGAACAGAGAGAGGCAGG - Intronic
1161458413 19:4381575-4381597 CAGGGTAGACAGAGAGAGGCAGG - Intronic
1161704573 19:5813236-5813258 AAAAAAAAACAGATGGAGGCTGG + Intergenic
1161737942 19:6002951-6002973 CAGGGACAACACAGGGAGGAGGG + Intronic
1162107778 19:8380947-8380969 CAAGGAGAACCGAGGAAGGTCGG - Intronic
1162226294 19:9225439-9225461 GAAAGAAAAGAGAGGGAGGGAGG + Intergenic
1162877813 19:13633905-13633927 GAAGGAAAAGAGAGAGAGGAAGG - Intergenic
1163504253 19:17695488-17695510 CAAAGAAAAAGGAGGGAGGGAGG + Intergenic
1163736246 19:18982822-18982844 CAAGAAATAGAGAGAGAGGCTGG + Intergenic
1163983183 19:20921073-20921095 AAAGAAAAACAGAAGCAGGCCGG - Intergenic
1164512856 19:28911710-28911732 CCAGGAAAGCAAAGTGAGGCAGG - Intergenic
1164573473 19:29390966-29390988 AAAGGAAGAAAGAGGGAGGGAGG + Intergenic
1164614832 19:29660894-29660916 AAAAGAAAACAGAAGCAGGCAGG - Intergenic
1164734757 19:30532636-30532658 AAAGGGAAGCTGAGGGAGGCCGG + Intronic
1164946912 19:32303209-32303231 CAAGGAAAAGAGAGAGAGAAAGG - Intergenic
1165742419 19:38211841-38211863 CAAGGGACAGAGAGGGAGGGAGG + Exonic
1166733136 19:45069791-45069813 CCTGGGGAACAGAGGGAGGCAGG - Intronic
1166870712 19:45868815-45868837 CCAGGAAAACATAGGCATGCTGG - Intronic
1166873361 19:45883780-45883802 CAAGGAGGACAGAGGGAAACTGG + Exonic
1167123390 19:47532468-47532490 GAAGGAAAACAGAGGAAGGGAGG - Intronic
1167390966 19:49194696-49194718 GAAAGAAAAGAGAGGGAGGAAGG - Intronic
1167433077 19:49464368-49464390 AGAGGAAAACAGACGGTGGCAGG - Intronic
1168296528 19:55379728-55379750 CAGTGAAGACAGAAGGAGGCCGG + Intronic
1168428303 19:56257310-56257332 CTGGGAGAACAAAGGGAGGCAGG + Intronic
1202677155 1_KI270711v1_random:18208-18230 CAAGGAAAACAGAGGCTACCTGG + Intergenic
925073214 2:987714-987736 CTAGGAAACCAAGGGGAGGCTGG + Intronic
925480170 2:4261645-4261667 AAAGAAAAACAGCGGGAAGCAGG + Intergenic
925575633 2:5357189-5357211 CATGGAAAATAGAGGGAGGGGGG + Intergenic
925862223 2:8190415-8190437 AAAGGAAAAGGGAGGGAGGATGG - Intergenic
926452626 2:13024126-13024148 CAATGGAAAGAGAGGGAGGGAGG + Intergenic
926512205 2:13795646-13795668 TAAGGAAAAAAGAGAGAGGCTGG - Intergenic
926570399 2:14523565-14523587 TAAGTAAAAGAGAGGCAGGCCGG + Intergenic
926968209 2:18439279-18439301 CAAGGAAAAAAGAGAAAGGCAGG - Intergenic
927451100 2:23210126-23210148 CATGGAAAACAGTGGGAGCCAGG - Intergenic
927464746 2:23328747-23328769 CAGTGAAACCAGAGGGAGGCAGG - Intergenic
927483373 2:23471800-23471822 CCAGGAAATCACAGGGAGGCAGG - Intronic
927553530 2:24017776-24017798 GAAGGAACCCAGAAGGAGGCAGG - Intronic
927972219 2:27312875-27312897 CTAAGAAAAAAGAGGGCGGCAGG + Intronic
928143287 2:28749605-28749627 CAAGTGAGGCAGAGGGAGGCCGG - Intergenic
928365875 2:30702092-30702114 GAAGGAAGAGAAAGGGAGGCAGG - Intergenic
928389300 2:30897111-30897133 CATGGAAAAAAGTGGGGGGCAGG - Intergenic
928679132 2:33680872-33680894 CCAGGAAGGCAGTGGGAGGCAGG + Intergenic
928704486 2:33933307-33933329 AAAGCAGAACTGAGGGAGGCAGG - Intergenic
929103165 2:38337087-38337109 CAAGAAAAAGAGAGGGAGGGAGG + Intronic
929104731 2:38353490-38353512 GAAGGAGAACAAAGTGAGGCTGG + Intronic
929120648 2:38481372-38481394 CAAGAAAAACAGATAGAGGAAGG + Intergenic
929928125 2:46231875-46231897 AAAGGAAAACAGAGGTACCCAGG + Intergenic
930606570 2:53499199-53499221 CGGGGAAAAGAGAGGGAGGCAGG + Intergenic
930822019 2:55655835-55655857 CAAGGTTAACAGAGAGAGGAAGG - Intronic
932296942 2:70632663-70632685 CCAGGAAAAGAGAGGGAGAAAGG - Intronic
932323536 2:70839072-70839094 GAAGGAGAAGAGAGGGAGGAGGG + Intergenic
932508927 2:72265447-72265469 CAATGAAAACACAGGGACACAGG - Intronic
932544282 2:72691205-72691227 CAAGGAACACAGAGGATTGCTGG + Intronic
932963847 2:76447191-76447213 TAAGGAAGACAGAGGGAAGCAGG - Intergenic
933156624 2:78982585-78982607 AAAGGAGAGCAGAAGGAGGCTGG - Intergenic
933570885 2:84010251-84010273 GAAGGAGGAGAGAGGGAGGCAGG + Intergenic
933691229 2:85181036-85181058 GAAGGAGAAAAGGGGGAGGCTGG + Intronic
933727201 2:85433702-85433724 CAAGGGAAGCAGATGGAGCCAGG - Intronic
933990244 2:87628651-87628673 CAAGGGAGACAGAGGGTGGAGGG + Intergenic
934050735 2:88208563-88208585 GAAGGAAGAGAGAGTGAGGCAGG + Intergenic
934516869 2:94993835-94993857 CAAGTAGAGCTGAGGGAGGCTGG + Intergenic
934950847 2:98574339-98574361 CGAAGAATACAGAGGGTGGCCGG + Intronic
935556841 2:104519356-104519378 GAAAGGAAACAGAGGGAGGGAGG + Intergenic
935635089 2:105243804-105243826 GGAGGAAAACGAAGGGAGGCAGG - Intergenic
935639140 2:105274275-105274297 CAAGGAAAGGACAGTGAGGCAGG + Intronic
935787238 2:106560333-106560355 CTGGGAAAAAAGAGGGAGGGAGG - Intergenic
935889236 2:107657855-107657877 CCAGGAAAACAAAGTGGGGCTGG - Intergenic
936303602 2:111322173-111322195 CAAGGGAGACAGAGGGTGGAGGG - Intergenic
936444955 2:112587917-112587939 CAAGGAGACCAGAGAGAGGCTGG - Intronic
937122409 2:119449989-119450011 GAAGGAAGAAAGAGGGAGGGAGG + Intronic
937489406 2:122350113-122350135 AATGGAAAACAGAAGAAGGCAGG - Intergenic
937757382 2:125556768-125556790 CAGGAGAAACAGAGAGAGGCAGG - Intergenic
937872030 2:126792810-126792832 CCAGGGAAACAGTGGGAGGCAGG + Intergenic
938227145 2:129625923-129625945 CAATGAGAACCGAGGGGGGCTGG + Intergenic
938657418 2:133448253-133448275 AAAAAAAAAAAGAGGGAGGCGGG + Intronic
938727498 2:134120790-134120812 GAAGGAAGAAGGAGGGAGGCTGG + Intronic
938964394 2:136375504-136375526 CAAGGAAAAAGGAGTGAGGAAGG + Intergenic
939697933 2:145350994-145351016 CAATGAAAAATGAGGGATGCAGG - Intergenic
940194106 2:151073887-151073909 CAAGGAAAACACATGGACACAGG - Intergenic
940638599 2:156326644-156326666 AAAGGAAAAGAAAGGGAGGAAGG - Intronic
940842896 2:158605000-158605022 CAAGGCGGACAGAGGGAGTCAGG + Intronic
940881907 2:158955062-158955084 TAAAAAAAAAAGAGGGAGGCTGG - Intergenic
941036678 2:160576351-160576373 CAAAGGAGACAGAGGGAGACAGG + Intergenic
941743224 2:169058747-169058769 CAATGAAAACAGATGGACCCAGG + Intergenic
941918568 2:170828149-170828171 CGAGGACAGCAGAGGGAGGAGGG - Intronic
941918704 2:170828733-170828755 CGAGGACAGCAGAGGGAGGAGGG - Intronic
941918735 2:170828853-170828875 CAAGGACCGCAGAGGGAGGAAGG - Intronic
942839497 2:180342077-180342099 AAAGGAAAATAGAAGGATGCTGG - Intergenic
942868176 2:180700179-180700201 CCAGGAAGCCAGAGGGAGCCAGG - Intergenic
942998146 2:182290552-182290574 TCAGGCAAGCAGAGGGAGGCTGG - Intronic
943011956 2:182460937-182460959 CAAGGAAAACAAAAGGTGGAGGG + Intronic
943374331 2:187055860-187055882 CATGGAAAACTGAGGGAAGTGGG - Intergenic
943667049 2:190619900-190619922 CAAGGAAAACACAGTATGGCAGG - Intergenic
943919152 2:193679978-193680000 CAAGGGAAACAGAGAAAGGAAGG + Intergenic
944486811 2:200215461-200215483 CAAGCCAAATAGAGGGAGGAAGG - Intergenic
944673064 2:202012205-202012227 AAAGAAAAAGAGAGGGAGGGAGG + Intergenic
944711460 2:202338502-202338524 CAAAGAAAAAGGAGGGAGGGAGG - Intergenic
944977592 2:205073599-205073621 CAAAGAAAACAGAAAGAGTCTGG - Intronic
945327006 2:208493545-208493567 CAAGGAAGATAGTGGGAGGCAGG + Exonic
945390336 2:209258200-209258222 CAAGGAGAACACAGGGACACAGG + Intergenic
945693066 2:213066316-213066338 CAACGGCAACAGAGGGAGGGAGG + Intronic
945739486 2:213642869-213642891 CATGGAAAAGAGATGTAGGCTGG - Intronic
945825159 2:214712803-214712825 CAAAGAAAAAAAAGGGAGGGTGG - Intergenic
945870653 2:215222553-215222575 AAAGGAAAACAGAAAAAGGCAGG + Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946426644 2:219601959-219601981 CAAGGAAAGAGGAGGGAGGAAGG - Intronic
946488655 2:220126193-220126215 GAAGCAAAAAAGAGGGAGACAGG + Intergenic
946724982 2:222653407-222653429 CAAGAAAAAAAGAGGAAGACTGG + Intronic
946884432 2:224209017-224209039 CAAGGAATACAGAGTGACGGTGG - Intergenic
946973696 2:225123450-225123472 GAAGGAAAAGAAAGGGAGGACGG - Intergenic
947082030 2:226409700-226409722 GAAGGCAAAGAGAAGGAGGCAGG + Intergenic
947107192 2:226679902-226679924 AAAGGGAAACAGAGTGAAGCGGG - Intergenic
947232634 2:227903373-227903395 AAAGGAAAGCAGGTGGAGGCTGG + Intronic
947603327 2:231467989-231468011 GAAGGAAGACAGAAGGAGGCTGG - Intronic
947669764 2:231928790-231928812 CAAGGAAAGCAAAGGGAGAGGGG - Intergenic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947785896 2:232819803-232819825 TAAGGAAAAAAGATGGAGGGTGG - Intronic
947941201 2:234057152-234057174 CAAGGTAAACAGATTGGGGCAGG - Intronic
1168805662 20:670986-671008 AAAGGAAAACAGAGGCTGGGAGG + Intronic
1168912683 20:1462355-1462377 CAAGAAAAAGGGAGGGAGGAGGG - Intronic
1168924782 20:1570511-1570533 AAAGGAAAAAAGAGAGAGGGAGG - Intronic
1169159067 20:3360982-3361004 CAATGACAGCAGAGGGTGGCAGG + Intronic
1169791427 20:9414336-9414358 CATGGAACACAGAGGCATGCAGG - Intronic
1170022308 20:11850106-11850128 GAAGGAAAAAAGAGGGAGAAAGG - Intergenic
1170856542 20:20061702-20061724 CATGGGGAACACAGGGAGGCGGG - Intronic
1170907517 20:20529072-20529094 CACGGAAACTAGAGGGAGGCAGG + Intronic
1170948857 20:20915948-20915970 CAAGGAAAAGAGAGAGAAGCAGG - Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171985615 20:31658906-31658928 CAAGGAAGAGAGAGGAAGGAAGG - Intergenic
1172477800 20:35252059-35252081 CAGGAAAAACAGAGTGAGGGTGG - Intronic
1172728200 20:37063806-37063828 CAAGAAAAAAAGAAAGAGGCCGG - Intronic
1172900928 20:38334408-38334430 CCTGGAAATCAGAGGGAGGATGG - Exonic
1173260844 20:41433983-41434005 CATGTAAACCAGAGGAAGGCAGG + Intronic
1173341401 20:42155828-42155850 CAGGGACAACAGAGGCAGGTAGG - Intronic
1173522123 20:43708097-43708119 AAAAGAAAACTCAGGGAGGCAGG - Intronic
1173576668 20:44116390-44116412 CCAGGGCAACACAGGGAGGCTGG + Intronic
1174198500 20:48790428-48790450 CAAGGAAAAAGGAGGGTGGAGGG + Intronic
1174552891 20:51374379-51374401 CAAGGAAAACAGATGGCCCCAGG - Intergenic
1175334246 20:58184830-58184852 CAATGGAAGCAGAGAGAGGCTGG + Intergenic
1175767827 20:61603426-61603448 CTAGGAAAACAAATGCAGGCAGG + Intronic
1175801166 20:61801747-61801769 GAAAGAAAGCAGAGAGAGGCTGG - Intronic
1175847363 20:62065800-62065822 CGAGGAAAAAAGATGGCGGCGGG - Exonic
1176007316 20:62873194-62873216 TGAGGAAGAAAGAGGGAGGCAGG + Intergenic
1176287296 21:5024849-5024871 CATGGAGAACAGAGGCAGGCAGG + Intronic
1176970013 21:15254103-15254125 CAGGGAAAACAGAGGAAAGGAGG + Intergenic
1177868564 21:26543132-26543154 CAAGGAGAACACAGGGACACAGG + Intronic
1177955104 21:27588486-27588508 CAAGGAAAAAAGATGGAAGAAGG + Intergenic
1178095802 21:29213553-29213575 CAAGGAATGCAGAGGGTTGCAGG - Intronic
1178277656 21:31253587-31253609 CATGGAAAAAAGAGGGTGGTGGG + Intronic
1178808588 21:35860169-35860191 GAGGGAAAAGAGAGGGAGGGAGG + Intronic
1178936970 21:36871448-36871470 GAAGGAAAACAAAGGGACACAGG + Intronic
1179059120 21:37963513-37963535 CAATGAAAACACAGGGACACAGG - Intronic
1179114282 21:38475726-38475748 CAACGAAGACAGAGTGTGGCAGG - Intronic
1179353469 21:40635463-40635485 AAAGAAAGAGAGAGGGAGGCAGG + Intronic
1179442669 21:41406282-41406304 CAAGGAAGAAAGAGGTTGGCTGG - Intronic
1179481006 21:41678702-41678724 CCTGGAAAACGGAGGGAAGCAGG - Intergenic
1179669865 21:42939122-42939144 CAAGGAAAAGGGAGGAAGGGTGG - Intergenic
1179801171 21:43812114-43812136 GAAAGAGAACAGAGGAAGGCCGG - Intergenic
1179869885 21:44238626-44238648 CATGGAGAACAGAGGCAGGCAGG - Intronic
1179992456 21:44955235-44955257 CTTGGAAAACAGAGAGAGACAGG + Intronic
1180133952 21:45848526-45848548 GCAGGACAACAGAAGGAGGCAGG - Intronic
1180320005 22:11311157-11311179 GAAGGGAGAGAGAGGGAGGCAGG - Intergenic
1180833314 22:18917362-18917384 CAAGGAAATAAAAGGGAAGCAGG + Intronic
1181410024 22:22712234-22712256 CAAAGGAAACAGAGAGAGGAGGG - Intergenic
1181455250 22:23055879-23055901 CATGGAGAACAGTGGGAGGGAGG + Intergenic
1181496483 22:23290075-23290097 CAAGGACAGCAGAGGGGGTCGGG - Intronic
1181803644 22:25362369-25362391 CTAGGGAAACGGAGGCAGGCAGG + Exonic
1181959213 22:26610836-26610858 CAAGGCAAACAGGGGAAGTCAGG + Intronic
1182014976 22:27032109-27032131 CAAGGGAGACAGAGAGAAGCTGG + Intergenic
1182282281 22:29224538-29224560 AATGAAAACCAGAGGGAGGCTGG - Intronic
1182325774 22:29511527-29511549 CCAGGAAAACAGAGGTGTGCAGG + Intronic
1182515249 22:30854946-30854968 CAAGGAGAACAGAGCGAAGTTGG + Intronic
1182546408 22:31079278-31079300 AGAGGAAGACAGAGGCAGGCGGG + Intronic
1182799290 22:33018345-33018367 CTAGGAAAAGACAGGAAGGCAGG + Intronic
1183063453 22:35348955-35348977 CAAGGAAAGCAGCTGGGGGCAGG + Intergenic
1183405324 22:37627720-37627742 AGAGGAAAACAGAAGGAAGCTGG - Intronic
1183473038 22:38019587-38019609 CAAGGCAGAGAGAGGGAGGGCGG + Intronic
1184003798 22:41694334-41694356 AATAGAAACCAGAGGGAGGCTGG + Exonic
1184195726 22:42926493-42926515 GAAGAAAAACAGTGGGAGGAAGG + Intronic
1184437194 22:44486458-44486480 CAAAGACCACAGAGCGAGGCTGG + Intergenic
1184892997 22:47390796-47390818 GAACGAAAGCAGCGGGAGGCGGG + Intergenic
1185209694 22:49563741-49563763 CAAGGAAGAGAGGGGGAGGAGGG + Intronic
1185359962 22:50400200-50400222 CAAGGGAAACACTGGGAGGAAGG + Intronic
1203283400 22_KI270734v1_random:142666-142688 CAAGGAAATAAAAGGGAAGCAGG + Intergenic
949153345 3:797877-797899 CAAGTAAAACAGAGATAGGTAGG - Intergenic
949205480 3:1433175-1433197 CAGGAAAAACAGAGAGAGGGAGG - Intergenic
949677055 3:6467446-6467468 AAAGGAAAAGGGAGGGAGGGAGG + Intergenic
949808751 3:7983560-7983582 CAATGAAAACAGAGAGAGGCTGG + Intergenic
949838756 3:8297637-8297659 CATGGCAAAGAGAGGGAGGGGGG + Intergenic
950038687 3:9905517-9905539 GAAAGAAAAGAGAGAGAGGCAGG + Intronic
950046983 3:9954429-9954451 CAAGGAAAACAGAGCTGGTCAGG - Intergenic
950058727 3:10051082-10051104 CAAAAAAAAAAGAGTGAGGCCGG + Intronic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
950875439 3:16267283-16267305 GAAGGATAACAGAGGGAGAGGGG - Intronic
950935112 3:16831685-16831707 GAAAGAAAAAAGAGGGAGGGAGG + Intronic
951233750 3:20210874-20210896 CAAGGAAAAGTGAAGGAAGCAGG - Intergenic
952277793 3:31894296-31894318 CAAGGAGGACAAGGGGAGGCAGG + Intronic
952433277 3:33246927-33246949 GAAAGAAAAGAGAGGGAGGGAGG - Intergenic
952655073 3:35776420-35776442 CAGGGAAAGCAGAGGAAGGGTGG + Intronic
952881533 3:37989038-37989060 CCAGAGACACAGAGGGAGGCTGG + Intronic
953019243 3:39103441-39103463 CAAGCAAAGCAGAGGCAGGTTGG + Intronic
953180680 3:40591578-40591600 CAAGGGAAAAAGATGTAGGCTGG + Intergenic
953439256 3:42904123-42904145 GAAGGAAAAGGGAGGGAGGAAGG - Intronic
953474703 3:43195474-43195496 CAAGGGAAACAGAGGTGGGGAGG - Intergenic
953859794 3:46533761-46533783 GAAAGAAAAGAGAGGGAGGGAGG - Intronic
953907858 3:46877304-46877326 CAGAGAAATCAGAGGGGGGCTGG - Intronic
954181598 3:48885507-48885529 CAAGAAAAACAGAACAAGGCTGG + Intronic
954541689 3:51397239-51397261 GAAGGAAAACAGGGTGGGGCGGG + Exonic
954631427 3:52049705-52049727 AAAGGAAGAGAGAGGGAGGGGGG + Exonic
954792518 3:53143782-53143804 AGAGGAAAATGGAGGGAGGCAGG - Intergenic
955054211 3:55441713-55441735 TGAGGATAACAGAGGGAGGCTGG + Intergenic
955400936 3:58591173-58591195 GAAGGAGAACAGAGAGACGCTGG + Intronic
955776208 3:62436503-62436525 CATTGAAAACAGAGACAGGCAGG - Intronic
957411502 3:79847175-79847197 AAAGAAAAAAAGAGAGAGGCAGG - Intergenic
957532019 3:81452652-81452674 CAAGGACAACAGAGGCAGATGGG + Intergenic
957548371 3:81670250-81670272 CAACGAAAGCAGAGGGAGTGTGG + Intronic
957979766 3:87494144-87494166 CTAGGAAAAGAGAGGAAGGAAGG + Intergenic
958159079 3:89793242-89793264 CAAGGCAAACAGAGAGATCCAGG - Intergenic
958208340 3:90434480-90434502 AAAGGAAAACAAAAAGAGGCAGG - Intergenic
960063531 3:113348002-113348024 CAAGGAGGACAGAGGAAGGTTGG - Intronic
961591941 3:127987826-127987848 CCAGGAAACTAGAGAGAGGCTGG + Intergenic
961723291 3:128909841-128909863 AAGGGAAAACAGAAGGTGGCTGG + Intronic
962413441 3:135161598-135161620 CAAGACAAAGAGAGGCAGGCAGG + Intronic
962960537 3:140307333-140307355 CAAGGAGAGCAGGAGGAGGCCGG - Intronic
963019175 3:140855858-140855880 TATGGAAAACACAGAGAGGCAGG - Intergenic
963024445 3:140904905-140904927 TAAGGAAGACAGAGGCAAGCAGG + Intergenic
963108410 3:141665605-141665627 GAAGGAAAGGAGAGGGAGGGAGG + Intergenic
963108448 3:141665751-141665773 GAAGGAAAGGAGAGGGAGGGAGG + Intergenic
963108528 3:141666001-141666023 GAAGGAAAGGAGAGGGAGGGAGG + Intergenic
963240994 3:143002097-143002119 GGAGGGAAACTGAGGGAGGCCGG - Intronic
963631001 3:147729652-147729674 CAGGAAAAAGAGAGGGAGGCAGG + Intergenic
963918851 3:150886726-150886748 CCAGGGAAGCAGAGGGAGGAGGG - Intronic
964439335 3:156689808-156689830 CCAGGCAAACAATGGGAGGCAGG - Intronic
964705167 3:159610547-159610569 TAATGAAAACAGAGGGAGGTAGG - Intronic
964729857 3:159853182-159853204 CAAGGAAAGGCCAGGGAGGCTGG + Intronic
964858701 3:161175729-161175751 ACAGGAAAGCAGAGGGAGGCTGG + Intronic
964993952 3:162851002-162851024 CATAGAAAGAAGAGGGAGGCCGG - Intergenic
965074817 3:163962977-163962999 GAAGGAAGAGAGAGGGAGGGAGG - Intergenic
965749384 3:171960502-171960524 TAAGAAAAGCAAAGGGAGGCCGG + Intergenic
965954212 3:174348668-174348690 GAAGGAAAAGAGAGAGAGGAAGG + Intergenic
966191542 3:177276298-177276320 CAACAAAAACACAGGGAGGCAGG - Intergenic
966423431 3:179756445-179756467 CAAAAAATACAGAGAGAGGCTGG + Intronic
966882268 3:184357274-184357296 GAAGAACAGCAGAGGGAGGCAGG + Intronic
967043468 3:185715431-185715453 CCAGGTAAACACCGGGAGGCAGG + Intronic
967182622 3:186919584-186919606 CAAGGACCACAGAGGTAGGGAGG - Intergenic
967198540 3:187050615-187050637 GAAGGAAAAGAGAGAGAGGAAGG + Intronic
967607324 3:191462980-191463002 AAAAGAAAAAAGAGGGAGGGAGG - Intergenic
967963885 3:194945560-194945582 CAAGGAGAAGAGAGGGGGGAAGG + Intergenic
969297232 4:6277356-6277378 ACAGAAAAGCAGAGGGAGGCAGG - Intronic
969353866 4:6613825-6613847 GAAGGAAAAAAGAGGGAGGGAGG + Intronic
970872313 4:20830024-20830046 AAAGGAGAACTGAGGGAGGGAGG - Intronic
971500002 4:27308430-27308452 CAAGGAAAACTGAGACAGGAAGG - Intergenic
971699781 4:29956164-29956186 CAAGGAAAACAGCTGAAGGAGGG - Intergenic
971866597 4:32180106-32180128 CAATTCAAACAGAGGGAGGCAGG + Intergenic
972409335 4:38777154-38777176 TAAGGGAAACAGAGAGAGACTGG + Intronic
973582369 4:52357054-52357076 GAAGGAAAAGAGAGGGAAGACGG - Intergenic
973620450 4:52721292-52721314 CAGGGAAAACAGACTCAGGCTGG + Intergenic
974345706 4:60678430-60678452 CAAGTAATACAGAGGTAGTCAGG + Intergenic
974799739 4:66801610-66801632 AAGGGAAAAAAGAGGCAGGCAGG - Intergenic
974924299 4:68278306-68278328 GAAGGAAAAAAAAGGGAGGTAGG - Intergenic
975099903 4:70500984-70501006 CATGGAAGAAAGAGGAAGGCTGG + Intergenic
976424583 4:84887202-84887224 CCAGGGAAACACAGGAAGGCTGG + Intronic
977029644 4:91865457-91865479 AAAGTAAAACAGAGGAAGACTGG + Intergenic
977591044 4:98827588-98827610 CAAGGACAACAGAGGGCAGAGGG - Intergenic
977993776 4:103477776-103477798 CAAGGAATACAGAGGAAGATGGG + Intergenic
978957989 4:114638520-114638542 CAAGGAAAACAGATGGAGGGAGG - Intronic
978973044 4:114834133-114834155 CAAACAAGACAGAGGGAGGAGGG + Intronic
979046329 4:115870280-115870302 GAAGGAAGATAGAGAGAGGCTGG - Intergenic
982018618 4:151181067-151181089 CATGAAAAATAGAGGTAGGCCGG - Intronic
983024903 4:162724518-162724540 CAGGGTAAACAGATGGGGGCTGG - Intergenic
983285226 4:165731039-165731061 CAATGAGAACACAGGGAGACAGG + Intergenic
983429709 4:167633079-167633101 CAATGAGAACACAGGGATGCAGG + Intergenic
983658767 4:170110753-170110775 AAAGAAAAAAAGAGGGAGGAAGG - Intergenic
984220913 4:176973404-176973426 CAGGGAAAACACAGGGAAACTGG + Intergenic
984241003 4:177219214-177219236 CAAGGGAAAAAGAGGGAGTAGGG - Intergenic
984401495 4:179271421-179271443 AAGGGAAAAGAGAGGGAGGCAGG - Intergenic
984885742 4:184447823-184447845 CAAGGAATAATGAAGGAGGCAGG + Intronic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985233658 4:187849416-187849438 GAAGGAAGAGAGAGGGAGGGAGG - Intergenic
985519953 5:369533-369555 CAAGTGACACAGAGGGAGCCCGG - Intronic
986416774 5:7536771-7536793 CAAGGAGAACACAGGGACACAGG + Intronic
986668703 5:10125240-10125262 CAAGGAACACAGAGGATTGCTGG + Intergenic
987255094 5:16142622-16142644 CTAACAAAAAAGAGGGAGGCCGG - Intronic
987432166 5:17848091-17848113 GAGGGAAAAGAGAGTGAGGCAGG + Intergenic
987639533 5:20594865-20594887 CAATGAAAACACATGGACGCAGG - Intergenic
987729606 5:21752017-21752039 CGAGGTAAACAGAGAGAGTCTGG + Exonic
987764040 5:22202112-22202134 GGAGGAAAAGAGAGGGAGGGAGG - Intronic
987982515 5:25104735-25104757 CAAGGTAAACACAGAGAGTCAGG + Intergenic
988405167 5:30815007-30815029 CAAGGGAGACAGATGTAGGCTGG + Intergenic
988627476 5:32893047-32893069 CAATGAGAACACAGGGAGACAGG - Intergenic
988953638 5:36291593-36291615 CAAGGAAAACACATGGACACAGG - Intronic
990352528 5:54933285-54933307 CAAGGGAAAGAGAGGAAGGCAGG - Intergenic
990353455 5:54941468-54941490 GAAGGGAAACAGAGGGTAGCAGG - Intergenic
990466238 5:56074375-56074397 CAAGAAAGAAAGAGAGAGGCTGG - Intergenic
990510117 5:56481896-56481918 CAAGGAAAAAAGAGAGGGGTAGG + Intronic
991507339 5:67339148-67339170 GGAGGAAGACAGAGGGAGGGAGG - Intergenic
991523156 5:67523704-67523726 CAATGAGAACAGAGGGACACAGG - Intergenic
991898765 5:71435190-71435212 GGAGGAAAAGAGAGGGAGGGAGG - Intergenic
992658662 5:78936060-78936082 GAAGGGAAAGAGAGGGAGGGAGG - Intronic
992872686 5:81022620-81022642 TGGAGAAAACAGAGGGAGGCAGG - Intronic
994626348 5:102224896-102224918 CAAGGAAAAGAGAGGGAAGAAGG + Intergenic
994650439 5:102520259-102520281 ATAGAAAGACAGAGGGAGGCTGG + Intergenic
995470599 5:112498062-112498084 CAAGGAAAAGAGAGAGACGGAGG - Intergenic
996338037 5:122406261-122406283 CAAGAAAGACAGGGGGAGGAGGG - Intronic
996570386 5:124927536-124927558 AAAGGACAGCAGAGTGAGGCTGG - Intergenic
996614371 5:125422734-125422756 CATGGAAGGCAGAGGGAGGTGGG - Intergenic
998516873 5:142763835-142763857 ATGGGAAAACAGAGGGAGCCAGG - Intergenic
998583742 5:143404697-143404719 TAAGGAAAGCAGGGGGCGGCAGG + Intronic
998615353 5:143734468-143734490 AAAGTAATACAGAGTGAGGCAGG - Intergenic
1000085063 5:157881509-157881531 CAAGGAGAACCGAGGAAGGTCGG - Intergenic
1000348901 5:160337342-160337364 CAATGACAAAAGAGGGAGACAGG - Intronic
1001359565 5:171067974-171067996 GAAGGAAAAGAGAGGGAGAAAGG - Intronic
1001977911 5:176015464-176015486 GAAGGAGAAAAGAGGGAGGAAGG - Intronic
1002098187 5:176844366-176844388 CCAGGAGAACAGAGTGAGGCTGG - Intronic
1002239509 5:177828298-177828320 GAAGGAGAAAAGAGGGAGGAAGG + Intergenic
1002434092 5:179220762-179220784 CAAGGGAAACTGAGGTTGGCAGG - Intronic
1002658814 5:180775918-180775940 CTAGAAAGAAAGAGGGAGGCAGG + Intergenic
1002909881 6:1481686-1481708 CAGGGAATGCAGAGGGAGGCTGG - Intergenic
1003528258 6:6916540-6916562 GAAGGAAAGCAGAAGGAGGCAGG + Intergenic
1003745546 6:8997619-8997641 AAAGAAAAAGAGAGGGAGGGAGG - Intergenic
1003754414 6:9100576-9100598 GAAGGAAGAAAGAGGGAGGAAGG - Intergenic
1003759687 6:9162752-9162774 AAAGGAAGAAAGAGGGAGGGAGG + Intergenic
1003876812 6:10445194-10445216 CAAGGAAAATAAATGGAGACAGG - Intergenic
1003902259 6:10665511-10665533 CAAAGAAATCAGAGAGGGGCTGG - Intergenic
1004332098 6:14731193-14731215 AAGGGAATACAGAGGGAGACAGG - Intergenic
1004396310 6:15248721-15248743 CAATGACAACAGAGTGCGGCCGG - Intronic
1004572211 6:16858203-16858225 AAAGAAAAAGAGAGGGAGGGAGG + Intergenic
1004632629 6:17436565-17436587 AGAGGAAGAGAGAGGGAGGCGGG + Intronic
1004748668 6:18538573-18538595 CAAGGCAAAGAAAGGGAGGGAGG - Intergenic
1004945601 6:20609326-20609348 GAGGGAAAAGAGAGGGAGGAGGG - Intronic
1005300554 6:24466046-24466068 CAAAAGAAACAGATGGAGGCTGG + Intronic
1005699702 6:28388129-28388151 CAAGGAACCCAGAGTGAGTCTGG - Intronic
1006112158 6:31754020-31754042 AAAAAAAAAAAGAGGGAGGCCGG - Intronic
1006201222 6:32293327-32293349 CAAGAAAAGAAGAGTGAGGCAGG - Exonic
1006411370 6:33875790-33875812 AAATGAAAACAGACAGAGGCCGG + Intergenic
1006437813 6:34035317-34035339 GAAGGAGAACAGGGGGAGGATGG + Intronic
1007480906 6:42149208-42149230 AGAGGAAAACAGAGGTAGCCGGG - Intergenic
1007600273 6:43076806-43076828 CCAGAAAAACTCAGGGAGGCTGG - Exonic
1007834214 6:44662392-44662414 CAAGGAAAAGAGAGAGGGGGTGG - Intergenic
1008157384 6:48033484-48033506 GAAGGAAAAAAGGGGAAGGCCGG - Intronic
1008404703 6:51105772-51105794 AAGGGAAAACAGAGGGTGGGTGG + Intergenic
1008497945 6:52152090-52152112 GAAGGAAAGAAGAGGGAGGGAGG + Intergenic
1008627843 6:53335332-53335354 CAGGGAAGCCAGAGGGAGACAGG - Intronic
1008731057 6:54483108-54483130 CAAGGAACACAAAGGGTTGCTGG + Intergenic
1009000405 6:57706330-57706352 CAATGAAAACACATGGACGCAGG + Intergenic
1009442639 6:63699883-63699905 GAAAGAAACCTGAGGGAGGCCGG - Intronic
1009938357 6:70260003-70260025 CAAGGCAAAGACAGGGAGGATGG - Intronic
1010258928 6:73793167-73793189 CCAAGAAAACAGAGGGAGCCAGG + Intronic
1011109088 6:83816789-83816811 CAAGGAATACATAGGGAATCTGG + Intergenic
1011143293 6:84184605-84184627 CAAAGGAAACAGAGTGAGGTTGG - Intronic
1011606054 6:89106888-89106910 CAAGGAGTAAAGAGGGAGGGTGG - Intronic
1011686825 6:89830152-89830174 GAAGGACCACAGAGGGACGCAGG - Intronic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012669493 6:102024232-102024254 AAAGAGAAACAGAGGTAGGCTGG + Intronic
1012734301 6:102919649-102919671 AAAGAAAAAGAGAGGGAGGAGGG + Intergenic
1012848262 6:104417219-104417241 AAAGGAAAAGAGATGGAGGTAGG - Intergenic
1013241114 6:108246626-108246648 TAAGAAAAAAAAAGGGAGGCAGG - Intronic
1013858212 6:114601588-114601610 CAAGGTAAATTGAGGGAGGCAGG + Intergenic
1014175818 6:118330260-118330282 CATGGAAGAAAGAGGTAGGCTGG + Intergenic
1014332991 6:120094737-120094759 CTAGAAAAACAGAGTTAGGCAGG + Intergenic
1014529018 6:122537360-122537382 CAAGGAAAACACATGGACACAGG - Intronic
1014748460 6:125228218-125228240 AAAGGAAAGAAGAGGGAGGGAGG + Intronic
1015079675 6:129208704-129208726 GAAGGAAAAGGGAGGGAGGGAGG + Intronic
1015178951 6:130341128-130341150 AAAGAAACACAGAGGGAGGGAGG + Intronic
1015282688 6:131450797-131450819 CCAAGAAAACAGAAGGAGGTTGG - Intergenic
1015571884 6:134630214-134630236 CAAGGAGAACACATGGAGACAGG - Intergenic
1016184496 6:141182458-141182480 CAATGAAAACACAGGGACACAGG + Intergenic
1016532545 6:145074939-145074961 AAAGGAAGAGAGAGGGAGGAAGG + Intergenic
1016625159 6:146158279-146158301 GAAGGAAACAAGAGGGAGGATGG + Intronic
1017274439 6:152549481-152549503 TATGGAAAACAGAGTGAGGGAGG - Intronic
1018099082 6:160420580-160420602 CTAGGACAACAGAGGGACTCAGG + Intronic
1018381388 6:163261125-163261147 CCGGGAAGACAGAGGGAGGAGGG - Intronic
1018568444 6:165182686-165182708 CAAGGAAAACTGATTCAGGCTGG + Intergenic
1018855272 6:167670157-167670179 CAACTGAGACAGAGGGAGGCTGG + Intergenic
1018857974 6:167689107-167689129 AAAGGAACACAGCGGGTGGCAGG - Intergenic
1018993293 6:168691380-168691402 CAAGGAGAACACATGGACGCAGG + Intergenic
1018999395 6:168736112-168736134 GAAGGAAAAGAGAGGGAGGGAGG - Intergenic
1019896762 7:3989084-3989106 ATAGGATAACAGAGGGAGGCCGG - Intronic
1020630889 7:10637957-10637979 CAAGAGGAACAGAGGCAGGCAGG + Intergenic
1020777596 7:12474026-12474048 CAAGGAAAAGAGATGGAGTCAGG + Intergenic
1021505957 7:21385349-21385371 CAGGTATAACAGAGGGAGGCAGG - Intergenic
1022162628 7:27726936-27726958 CCAAAAAAAGAGAGGGAGGCAGG + Intergenic
1022335426 7:29417257-29417279 AAAGGAAGAGAGAGGGAGGAAGG + Intronic
1022520794 7:31005674-31005696 GAAGGAGAGAAGAGGGAGGCAGG + Intergenic
1023065497 7:36373553-36373575 GTAGGAAAAGAGAGGTAGGCAGG + Intronic
1023333690 7:39146339-39146361 GCAGGAAGGCAGAGGGAGGCAGG + Intronic
1023751014 7:43372514-43372536 AAAGGAAAACAGTGGGGAGCGGG - Intronic
1024356824 7:48422097-48422119 GAAGGAAGAAAGAGGGAGGAAGG + Intronic
1024462232 7:49670571-49670593 TGAGGGAAACCGAGGGAGGCTGG - Intergenic
1024920153 7:54546320-54546342 AAAGGAAAATAGCGGGAGGAGGG + Intronic
1026015831 7:66669909-66669931 CAACGAGAACAGAGGGAAGTGGG - Intronic
1026018670 7:66692316-66692338 CATGGGTAAGAGAGGGAGGCAGG - Intronic
1026231162 7:68485329-68485351 AAAGGAAAAGGGAGGGAGGGAGG + Intergenic
1026822079 7:73556855-73556877 CAGGGAAATTAGAGGGAGGCTGG + Intronic
1026881732 7:73910382-73910404 CATGGGTAAGAGAGGGAGGCAGG + Intergenic
1028309533 7:89313804-89313826 CAAGGAAAAGAAAGGGAAGGTGG - Intronic
1028519311 7:91712250-91712272 CAGACAAAAAAGAGGGAGGCTGG + Intronic
1028538291 7:91913916-91913938 GAAGGAAAACAGAGGCAGGGAGG + Intergenic
1028940415 7:96515823-96515845 CAATGAGAACACAGGGACGCAGG + Intronic
1029412897 7:100426976-100426998 GAAGGAGAAGAGAGGGAGGGAGG - Intronic
1029412922 7:100427040-100427062 GAAGGATAAGAGAGGGAGGGAGG - Intronic
1030365504 7:108641374-108641396 GAAAGAAAAAAGAGGGAGGGAGG - Intergenic
1030380365 7:108803965-108803987 CAGGGAGGAGAGAGGGAGGCAGG - Intergenic
1030906285 7:115187407-115187429 CAATGAAAACAGATGGACACAGG - Intergenic
1032486593 7:132292265-132292287 CAGGTAAATCAGAGGGAGGCTGG + Intronic
1032501262 7:132401904-132401926 TAAGCAAAAGAGGGGGAGGCTGG + Intronic
1032547107 7:132753136-132753158 AAAGGAACAAAAAGGGAGGCGGG + Intergenic
1034385774 7:150739755-150739777 GAAGGGAAAGGGAGGGAGGCAGG + Intronic
1034605276 7:152307180-152307202 GAAGGAAAGAAGAGGGAGGAAGG + Intronic
1034752776 7:153586512-153586534 CAATGAAAACACATGGGGGCAGG - Intergenic
1034843562 7:154422228-154422250 CAAGGAAATCAGGTTGAGGCTGG + Intronic
1035074064 7:156166819-156166841 CAAGGAAAACCAGGGAAGGCGGG - Intergenic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035720500 8:1787905-1787927 CAAGGAAAAAGGAGGCAGGAAGG - Intergenic
1035754753 8:2022912-2022934 CGGGGCAGACAGAGGGAGGCAGG - Intergenic
1035823747 8:2622260-2622282 AAAGGAAGAAAGAGGGAGGGAGG - Intergenic
1036782546 8:11659469-11659491 GAAGGAAAACAGAGAGGTGCAGG - Intergenic
1037192430 8:16142824-16142846 CTGGGAATACAGAGGGAGGGAGG + Intronic
1037684807 8:21129705-21129727 TGAGGGAAACAGAGGCAGGCAGG + Intergenic
1038320244 8:26519126-26519148 CATGGAAATCAGGGTGAGGCTGG + Intronic
1038478384 8:27884897-27884919 CAGGGAGTACAGAGTGAGGCAGG + Intronic
1038596001 8:28887182-28887204 CAGGCAAAAAAGAGTGAGGCAGG + Intronic
1039033397 8:33333259-33333281 GAAGGAAAACAGAGGCAGAGTGG + Intergenic
1039164863 8:34666920-34666942 CAAAGAAAAAAGTGGGAGGGGGG - Intergenic
1039736281 8:40336313-40336335 CATGTAAAACAGAGAGAGGCAGG - Intergenic
1039836528 8:41260608-41260630 CAAGGGACACAGAGGTAGGCTGG - Intergenic
1040472372 8:47744988-47745010 AAAGAAAAAGAGAGGGAGGGAGG + Intergenic
1040769073 8:50951023-50951045 GACAGAAAACAGAAGGAGGCAGG + Intergenic
1041727185 8:61029369-61029391 GGAGAAGAACAGAGGGAGGCGGG + Intergenic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1041787277 8:61648985-61649007 CAAGGAAAAGAGAGGTCAGCTGG + Intronic
1041910797 8:63086373-63086395 GAAGGAAGAGAGAGGGAGGAAGG - Intergenic
1042078083 8:65018008-65018030 CAGGGAAAACAGAGGTAGCTAGG + Intergenic
1042537739 8:69875725-69875747 AAAGAAAAAGAGAGGGAGGAAGG + Intergenic
1042875206 8:73435202-73435224 TTAGGAACCCAGAGGGAGGCAGG - Intronic
1043119392 8:76303672-76303694 GAAGAACAACAGAGAGAGGCAGG + Intergenic
1044419418 8:91976159-91976181 CAAGGAAAACAGAGGGTCATTGG + Intronic
1044965251 8:97568187-97568209 CAGGGAGAAGAGAGAGAGGCTGG + Intergenic
1046345108 8:112913650-112913672 AAAGAAAAACAGAGGGAGAGGGG - Intronic
1046767299 8:118083729-118083751 CAATAAGAAAAGAGGGAGGCGGG + Intronic
1047009363 8:120654288-120654310 CTAGGAAAAAAGAGGGAGGGAGG + Intronic
1047597629 8:126394832-126394854 CAAGGATAAGAGTGGGAGGGAGG - Intergenic
1047812108 8:128422135-128422157 CCTGTAAAAAAGAGGGAGGCAGG + Intergenic
1047904019 8:129453644-129453666 CAAGGAAAAGAGAGGAAGAAGGG - Intergenic
1048390115 8:133954965-133954987 TTAGCAAAACAGAGGAAGGCAGG - Intergenic
1048874768 8:138828051-138828073 CGAGGAAAACATGGGGAGGATGG - Intronic
1049160373 8:141093948-141093970 CGAGGAAAAGACAGGGAGGGAGG + Intergenic
1049185450 8:141249518-141249540 CCATGACAACAGAGGCAGGCTGG + Intronic
1049210764 8:141385445-141385467 GAAGGGAAAAAGAGGGAGGGAGG - Intergenic
1049351564 8:142167410-142167432 CAAGGCAAACAGAGACAGACAGG + Intergenic
1049358579 8:142200952-142200974 AAAGAAAAAGAGAGGGAGGCAGG + Intergenic
1049565322 8:143335039-143335061 CAGGGAAACCAGGGGGAGGCCGG - Intronic
1050070117 9:1801608-1801630 CAAGGAACACAAAGGGTTGCTGG - Intergenic
1050170414 9:2810075-2810097 GAAGGAAAACAGAGAGAGTGAGG + Intronic
1050348915 9:4720910-4720932 CAAGGTAAACCAAGGTAGGCTGG - Intronic
1050429559 9:5548803-5548825 CAAAGAAAACAGAGGAAAGGAGG + Intronic
1050441545 9:5669279-5669301 CAGGGAAAAGGGTGGGAGGCGGG - Intronic
1051228416 9:14927555-14927577 TAAGGAAAACAGAAGGCGTCAGG - Intergenic
1051335387 9:16061272-16061294 GATGGAAAACTGAGGCAGGCAGG - Intronic
1051485821 9:17606697-17606719 GAAAGAAAACAGAAGGTGGCAGG - Intronic
1051487300 9:17622952-17622974 AAAGGAAAAGGGAGGGAGGAAGG - Intronic
1051685850 9:19657547-19657569 CAAAGAATACACAGGGAGGGTGG - Intronic
1051826772 9:21231106-21231128 CAATGAAAACAGAGGTAGAGGGG + Intronic
1051935103 9:22436110-22436132 CAAGGAGGACAGAGGAAGGTGGG - Intergenic
1052207113 9:25855598-25855620 CAATGAAAACAGATGGACACAGG - Intergenic
1052276696 9:26684735-26684757 TAAGAACAACAGAGGGAAGCTGG + Intergenic
1052660504 9:31422903-31422925 CAAGCAAAATAGAGAGAGGGCGG + Intergenic
1052726276 9:32231401-32231423 CAAGGAAGAGATAGGGAAGCAGG - Intergenic
1053283092 9:36834223-36834245 CCAGCACAACAGAGGGTGGCGGG - Exonic
1054793099 9:69274142-69274164 CGAGGAAGTCAGAGGGAGGAAGG - Intergenic
1055307705 9:74947378-74947400 CTGGGAAAACAGGGGGAAGCAGG + Exonic
1055589761 9:77799898-77799920 GAAGACAAATAGAGGGAGGCTGG + Intronic
1057412946 9:94834273-94834295 CAAGGAAAAGAGAGAGAGATTGG + Intronic
1057602592 9:96471720-96471742 TAATGAAAAGAGAGGGAGGGAGG - Intronic
1058927475 9:109681571-109681593 CAAGGTAAACAAGGGCAGGCTGG + Intronic
1059109716 9:111544153-111544175 CTAGGAAAATAGATGGGGGCTGG + Exonic
1059204240 9:112448850-112448872 AAAAGAACACAGAGAGAGGCTGG - Intronic
1059225866 9:112672396-112672418 CAAAAAAAAAAGAGGGAGTCCGG + Intergenic
1059603595 9:115808782-115808804 CAAGGAAAATGGATGGAGGTGGG + Intergenic
1059688925 9:116665030-116665052 CAAGAAAGAGAGAGGGAGGGAGG - Intronic
1059856317 9:118401624-118401646 CCAGGAAGAAAGAGGGAGGAAGG - Intergenic
1060054142 9:120399422-120399444 GAAGGAAAATAGAGGAAGACAGG + Intronic
1060683910 9:125590650-125590672 CAAGAAAAAAAAAGGGGGGCGGG + Intronic
1061057155 9:128229913-128229935 AAAGGAAAAAAAAGGGAGGGTGG + Intronic
1061219640 9:129242767-129242789 CAAGGACAGCTGAGGGAGGATGG + Intergenic
1061383103 9:130270872-130270894 AAAGAAAAACTGAGGAAGGCTGG - Intergenic
1061612804 9:131759546-131759568 CAAGGAAAAAGAAGGGAGGAAGG + Intergenic
1061848797 9:133402807-133402829 CAAGGACAACAGAGGCAGGAAGG + Intronic
1061882367 9:133574718-133574740 GAAGGAACACAGAGCGAAGCAGG - Intronic
1061948501 9:133922100-133922122 CAAACAAAGCAGAGGGAGCCGGG - Intronic
1061970233 9:134040985-134041007 CAAGGAAGACAGAGGGCGGGTGG + Intronic
1061977665 9:134078774-134078796 GGAGGAAGAAAGAGGGAGGCAGG - Intergenic
1185610977 X:1393365-1393387 AAAGGAAAAGAGAGGGAAGGAGG - Intergenic
1185644072 X:1604643-1604665 AAAGGAAAAGAAAGGGAGGGAGG - Intergenic
1185659982 X:1719924-1719946 GAAGGAAGAGAGAGGGAGGGAGG - Intergenic
1185787776 X:2905213-2905235 TAAGGACATCAGTGGGAGGCAGG - Exonic
1185989349 X:4875706-4875728 CAAGGGAGAAAGATGGAGGCTGG - Intergenic
1186101663 X:6163925-6163947 CAAGGAAACCAGAAGGAACCAGG + Intronic
1186140269 X:6564464-6564486 AAAGGAAAAGAGAGGGATCCAGG + Intergenic
1186193347 X:7087308-7087330 CAAGGAAAGCTAAGGGTGGCCGG + Intronic
1186361963 X:8851782-8851804 TCAGGAAACCAGAGGGAGGCCGG + Intergenic
1186483177 X:9911680-9911702 CAGGGAAGACAAAGGCAGGCTGG - Intronic
1186494580 X:10002071-10002093 CAAAAAAGACAGAGAGAGGCGGG + Intergenic
1186981116 X:14958584-14958606 CCAGGAAAAAAGGTGGAGGCAGG + Intergenic
1187135102 X:16540574-16540596 TAAGGAAAAGAGAAAGAGGCCGG + Intergenic
1187293823 X:17979919-17979941 CAATGAAAACACATGGATGCAGG - Intergenic
1187955196 X:24510867-24510889 CAAGGAAAAGAGAGGCCTGCAGG - Intronic
1188277316 X:28216061-28216083 CAAGGAAAAAAAAGGAAGGAAGG - Intergenic
1188350578 X:29125765-29125787 CAAGGAATAGAAGGGGAGGCAGG + Intronic
1189160070 X:38802345-38802367 AAAGAAAAATACAGGGAGGCAGG - Intronic
1189218696 X:39351097-39351119 CAAGGGAAAGTGTGGGAGGCGGG - Intergenic
1189760322 X:44315523-44315545 CAAGGCAGAGAGAGGGAGACTGG + Intronic
1189966674 X:46380437-46380459 GAAGGAAGAAAGAGGGAGGGAGG + Intergenic
1190484425 X:50910648-50910670 CAAGAAAAAGAAAGGCAGGCAGG - Intergenic
1190654069 X:52595912-52595934 CACTGTAAACTGAGGGAGGCTGG + Intergenic
1191661828 X:63659419-63659441 CAAGGAAAAAGGAGGAAGGCTGG - Intronic
1192831105 X:74751778-74751800 GAAGGAAAGAAGAGGGAGGGAGG - Intronic
1192877313 X:75245285-75245307 AAAGGAAAACAGATAGATGCTGG + Intergenic
1193085271 X:77443314-77443336 CAAAGAAAACAGAAGGAGAGAGG + Intergenic
1193203947 X:78725843-78725865 GAAAGAAAAGAGAGGGAGGGAGG - Intergenic
1194140506 X:90203448-90203470 AAAGGAAGAAAGAGGGAGGGAGG - Intergenic
1195033710 X:100951252-100951274 AAAGGAGGACAGAGGGAGGGAGG + Intergenic
1195394057 X:104392008-104392030 CAAACAAAACAGAGTAAGGCTGG + Intergenic
1195547345 X:106127109-106127131 CAAGGAAGAAAGATGTAGGCTGG + Intergenic
1195580989 X:106502421-106502443 CTAGGACAACAAAGGGAGACAGG - Intergenic
1195763495 X:108272118-108272140 CAATGGAAACAGAGAGGGGCAGG - Intronic
1196834478 X:119801831-119801853 CAAGGAAAAGAGTGAGAGGGAGG - Intergenic
1197622544 X:128766593-128766615 CAAGAAAAACAGAGGGAGAAAGG - Intergenic
1199144142 X:144346375-144346397 CATGGAAAAAAGATGTAGGCTGG + Intergenic
1199490007 X:148387594-148387616 AAGTGAAAACAGAGGTAGGCAGG - Intergenic
1199695735 X:150341705-150341727 AAAGGGAAAGAGAGGGAGGGGGG - Intergenic
1200194752 X:154240186-154240208 CAGGGAAAGAAGAGGAAGGCAGG + Intergenic
1200379739 X:155822297-155822319 AGAGGAAAAGAGAGGGAGGGAGG + Intergenic
1200486252 Y:3772411-3772433 AAAGGAAGAAAGAGGGAGGGAGG - Intergenic
1201538898 Y:15084727-15084749 GAAAGAAAAAAGAGGGAGGGAGG + Intergenic
1201565279 Y:15358816-15358838 CAAGGAAAGCTAAGGGTGGCCGG + Intergenic
1201621600 Y:15965105-15965127 AAAGGAAATCAGAGGGAGACAGG + Intergenic