ID: 1149393519

View in Genome Browser
Species Human (GRCh38)
Location 17:56215880-56215902
Sequence GTGTTGCCGGAGAAGCCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 370}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149393514_1149393519 19 Left 1149393514 17:56215838-56215860 CCAGAGGCAGCGTGGGTGGGAGG 0: 1
1: 0
2: 3
3: 37
4: 411
Right 1149393519 17:56215880-56215902 GTGTTGCCGGAGAAGCCTAGAGG 0: 1
1: 0
2: 1
3: 28
4: 370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149393519 Original CRISPR GTGTTGCCGGAGAAGCCTAG AGG Intronic
901135702 1:6992805-6992827 GTGTTGCAGGAGGGGCCTGGTGG - Intronic
902035042 1:13451781-13451803 GAGTTGCTGGAGGAGCCTAGGGG - Intergenic
902927746 1:19708004-19708026 GTGTTGAAGGAGAGGCCTGGTGG - Intronic
903075631 1:20762941-20762963 GTGTTGCAGGTGGGGCCTAGTGG + Intronic
906170748 1:43722963-43722985 GTGTTGGAGGTGGAGCCTAGTGG + Intronic
906575657 1:46886933-46886955 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
906596319 1:47080963-47080985 GTGTTGGAGGAGAGGCCTGGTGG - Intronic
906762307 1:48387233-48387255 GTGTTGTGGGAGGAGCCTGGTGG - Intronic
908087176 1:60648000-60648022 GTGTTGGAGGTGAGGCCTAGTGG - Intergenic
908351353 1:63288433-63288455 GTGTTGGAGGAGAGGCCTGGTGG - Intergenic
908498384 1:64718285-64718307 GTGTTGTGGGAGGAGCCCAGTGG - Intergenic
908603249 1:65764014-65764036 GTGTTGAGGGAGAAACCTGGTGG - Intergenic
908851429 1:68380654-68380676 GTGTTGAGGGAGAGGCCTGGTGG - Intergenic
909136726 1:71810619-71810641 GTGTTGGAGGAGAAGCTTGGTGG + Intronic
909693645 1:78438992-78439014 GTGTTGGAGGAGAGGCCTAGTGG - Intronic
910270431 1:85388092-85388114 GTGTTGGAGGTGAAGCCTAGTGG - Intronic
910460760 1:87445814-87445836 GTGTTGAAGGAGGAGCCTGGTGG - Intergenic
910643690 1:89490717-89490739 GTGTTGTGGGAGAAACCCAGTGG - Intergenic
910898210 1:92091107-92091129 GTGTTGGAGGAGGGGCCTAGTGG + Intronic
911234986 1:95403000-95403022 GTGTTGGAGGAGAGGCCTTGTGG + Intergenic
911612051 1:99968607-99968629 GTGTTGAGGGAGAGACCTAGGGG - Intergenic
912039061 1:105362524-105362546 GTGTTGGAGGTGGAGCCTAGTGG + Intergenic
912043175 1:105417496-105417518 GTGTTGTGGGAGGAACCTAGTGG + Intergenic
913022235 1:114799756-114799778 GTGTTGGAGGAGGAGCCTGGTGG - Intergenic
913079872 1:115373572-115373594 GTGCTGTCACAGAAGCCTAGAGG - Intergenic
914954257 1:152146893-152146915 ATGTTGGAGGTGAAGCCTAGTGG - Intergenic
915409946 1:155693133-155693155 GTGTTGCTGGTGAGGGCTAGAGG - Intronic
916005939 1:160660277-160660299 GTGTTGGAGGTGGAGCCTAGTGG + Intergenic
916220875 1:162444044-162444066 GTGTTGAAGGAGAAACCTGGTGG + Intergenic
918993718 1:191730195-191730217 GTGTTGGAGGAAAAGCCTGGTGG - Intergenic
919431844 1:197503577-197503599 GTGTTGGAGGAGAGGCCTGGTGG - Intergenic
920635243 1:207695926-207695948 GTGTTGGAGGAGGAGCCTAGTGG - Intronic
920931144 1:210389472-210389494 GTCTTGCAGGAGGAGCCTGGTGG + Intronic
920937998 1:210454119-210454141 GTGTTGCAGGAGGAACCCAGCGG - Intronic
921765825 1:218971964-218971986 GTGTTGAAGGAAAAACCTAGTGG + Intergenic
923754557 1:236779208-236779230 GTGTTGCAGGAGGAACCTAGTGG - Intergenic
924419843 1:243897808-243897830 GTGTTGTGGGAGGGGCCTAGCGG - Intergenic
1063094743 10:2899463-2899485 GTGTTGGAGGAGAAGTCTGGTGG - Intergenic
1063116157 10:3073410-3073432 GTGTGCCCAGAGATGCCTAGGGG + Intronic
1063141301 10:3258669-3258691 GTGATGCCGGAAATGCCTGGAGG - Intergenic
1063240251 10:4161902-4161924 GTGTTGGAAGAGAAGCCTGGTGG - Intergenic
1063310078 10:4944046-4944068 GTGTTGGAGGAGGGGCCTAGTGG + Intronic
1063317215 10:5018076-5018098 GTGTTGAAGGAGGGGCCTAGTGG - Intronic
1063626107 10:7691587-7691609 GTGTTGTGGGAGGAACCTAGTGG - Intergenic
1064035831 10:11912734-11912756 TTGTTGCAGCAGAAGCCCAGAGG - Intergenic
1065216998 10:23458825-23458847 ATGTTGCAGGTGAGGCCTAGTGG + Intergenic
1066351499 10:34641339-34641361 GAGCTGCCGGGGAAGCCTGGAGG + Intronic
1066483929 10:35825657-35825679 GTGTTGTGGGAGAGGCCTGGTGG - Intergenic
1066666639 10:37789720-37789742 GTGTTGACTGAGAAGCCTAGAGG + Intronic
1067457985 10:46437107-46437129 GTGTTGGAGGAGAGGCCTGGGGG - Intergenic
1067629212 10:47947527-47947549 GTGTTGGAGGAGAGGCCTGGGGG + Intergenic
1068139742 10:52990926-52990948 GTGTTGGAGGAGGGGCCTAGTGG - Intergenic
1068494933 10:57775874-57775896 GTGTTGTAGGAGGAGCCTGGTGG - Intergenic
1069505860 10:68997335-68997357 GTCTTGGAGGAGAAGCCTGGTGG + Intronic
1069707369 10:70467300-70467322 GTTTAGCTGGAGAAGCCTGGGGG + Intergenic
1070136631 10:73699691-73699713 GTGTTGAGGGAGGGGCCTAGGGG - Intergenic
1070772056 10:79088310-79088332 GTTTTGCCCAAGAAGCCTTGTGG - Intronic
1076155693 10:128203380-128203402 GTGTTGGGGGAGAAACCTGGTGG + Intergenic
1076650070 10:131981660-131981682 AGGTTGCCGGGGAGGCCTAGGGG - Intronic
1077003887 11:341542-341564 GTGTTGGAGGAGGAGCCTGGTGG + Intergenic
1081008346 11:37775575-37775597 GTGTTGCAGAAGAAACCCAGTGG - Intergenic
1081051664 11:38349486-38349508 GTGTTGGAGGTGGAGCCTAGTGG - Intergenic
1081101276 11:39006172-39006194 GTGTTGTGGGAGGAACCTAGTGG - Intergenic
1081185441 11:40036789-40036811 GTGTTGAAGGAGGAGCCTGGTGG - Intergenic
1081243868 11:40739596-40739618 GTGTTGAGGGAGAGACCTAGTGG + Intronic
1086392231 11:86376612-86376634 GTGTTGAGGGAGAGGCCTGGTGG - Intronic
1087827455 11:102782087-102782109 GTGTTGGAGGTGAAGCCTGGTGG + Intergenic
1087864256 11:103204233-103204255 GTGTTGCGGGAGGAACCTGGTGG - Intronic
1088553276 11:111036438-111036460 GTGTTGTGGGAGAGGCCCAGTGG - Intergenic
1088561213 11:111118183-111118205 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
1089961230 11:122618781-122618803 GTGTTGCCTGAAAAGCCTTGGGG + Intergenic
1092030399 12:5278793-5278815 GTCTTGCTGTAGAAGCCAAGAGG - Intergenic
1092178304 12:6426377-6426399 GTGATGTCAGAGAAGCCTGGGGG - Intergenic
1094253840 12:28399369-28399391 GTGTTGCAGGAGAAACCCAGTGG - Intronic
1094276829 12:28686448-28686470 GTGTTGGAGGTGAGGCCTAGTGG - Intergenic
1094408236 12:30141933-30141955 GTGTTGGAGGTGAGGCCTAGTGG - Intergenic
1095401337 12:41817940-41817962 GTGTTGGAGGTGAGGCCTAGTGG + Intergenic
1095928971 12:47607039-47607061 GTGTTGTGGGAGAGGCCTGGTGG - Intergenic
1097215785 12:57411851-57411873 GTGTTGACGGAGAGACCTGGTGG + Intronic
1098316360 12:69197648-69197670 GTGTTGGCGGTGAGGCCTACTGG - Intergenic
1098789041 12:74797018-74797040 GTGTTGTGGGAGAAACCTGGTGG - Intergenic
1099443320 12:82724379-82724401 GTGTTGAGGGAGGAACCTAGTGG + Intronic
1099525167 12:83710303-83710325 GTGTTGCAGGAAAAGCCTGGTGG - Intergenic
1099620988 12:85002765-85002787 ATGTTGTAGGAGAGGCCTAGCGG + Intergenic
1100030642 12:90186164-90186186 ATGTTGAAGGAGAAGCCTGGGGG - Intergenic
1100072407 12:90736702-90736724 GTGTTGTGGGAGAAACCCAGTGG + Intergenic
1101036242 12:100709944-100709966 GTGTTGTGGGAGAAACCCAGTGG - Intergenic
1101051918 12:100872884-100872906 GTGTTGGAGGAGGGGCCTAGTGG + Intronic
1101638579 12:106568237-106568259 GTGTTCGAGGTGAAGCCTAGTGG + Intronic
1101932842 12:109028881-109028903 GTGTTGGAGGTGGAGCCTAGTGG - Intronic
1102191329 12:110990899-110990921 GTGTTGGAGGAGGAGCCTGGTGG + Intergenic
1106733499 13:32566547-32566569 ATGTTGAAGGAGAAGCTTAGTGG - Intergenic
1107541614 13:41394304-41394326 GTGTTGTAGGAGGAGCCCAGTGG - Intergenic
1108026843 13:46186875-46186897 GTGTTTCATGAGAAGCCTTGAGG - Intronic
1108838620 13:54583441-54583463 GTGTTGGAGGTGAAGCCTGGTGG + Intergenic
1108903792 13:55445925-55445947 GTGTTGCCAGAGAAGATCAGTGG + Intergenic
1108921648 13:55682064-55682086 GTATTGCCTTAGAAGCCAAGAGG - Intergenic
1109951766 13:69509837-69509859 GTGTTGTGGGAGAAACCCAGTGG + Intergenic
1110044800 13:70814107-70814129 GTGTTGTGGGAGAGGCCTGGTGG - Intergenic
1111020001 13:82437202-82437224 GTGTTGGAGGAAGAGCCTAGAGG + Intergenic
1111020263 13:82439215-82439237 ATGTTGGAGGAGGAGCCTAGTGG + Intergenic
1111137177 13:84063087-84063109 GTGTTGGGGGAGGAGCCTGGTGG - Intergenic
1111908383 13:94282457-94282479 GTGTTGTGGGAGAGACCTAGTGG - Intronic
1111926039 13:94464246-94464268 GTGTTGGCAGTGAAGCCTGGGGG + Intronic
1112662605 13:101529621-101529643 GTGTTGAGGGAGAAACCCAGTGG + Intronic
1113149767 13:107250761-107250783 GTGTTGGAGGAGGGGCCTAGTGG + Intronic
1113203229 13:107889355-107889377 GTGTTGATGGAGAGGCCTGGTGG - Intergenic
1113701320 13:112390788-112390810 GTGTTGGAGGAGGAGCCTGGTGG - Intronic
1114365258 14:22019737-22019759 GTGTTGGAGGAGAAGTCTGGTGG + Intergenic
1114786879 14:25610222-25610244 GTGTTGAGGGAGAGACCTAGTGG - Intergenic
1116133422 14:40890475-40890497 GTGTTGTGGGAGAAACCCAGTGG - Intergenic
1116199469 14:41772244-41772266 GTGTTGGAGGTGAAGCCTAGTGG - Intronic
1116410465 14:44615755-44615777 GTGTTGGAGGAGGGGCCTAGTGG + Intergenic
1116552164 14:46254742-46254764 GTGTTGTGGGAGGAGCCTGGTGG - Intergenic
1117181804 14:53199330-53199352 GTGTTGTGGGAGAGACCTAGAGG + Intergenic
1118851009 14:69583494-69583516 GTGTTGGAGGTGAGGCCTAGTGG + Intergenic
1120182080 14:81354076-81354098 GGGTTGCAGGAGAAGCCCAGAGG - Intronic
1120392428 14:83925217-83925239 GTGTTAGAGGAGGAGCCTAGTGG + Intergenic
1120969081 14:90192434-90192456 GTGTTGCAGGTGGAGCCTAATGG - Intergenic
1121384923 14:93511209-93511231 GTGTTGGAGGAGCAGCCCAGTGG - Intronic
1122104020 14:99437424-99437446 GGGTTGGCGGAGTAGCCCAGAGG - Intronic
1122139076 14:99651587-99651609 GTGTTGGAGGAGGAGCCTGGTGG - Intronic
1123490422 15:20775766-20775788 CTGTTGGCGGGGAAGCCTGGCGG - Intergenic
1123546923 15:21344853-21344875 CTGTTGGCGGGGAAGCCTGGCGG - Intergenic
1124645570 15:31435582-31435604 CTGTTTCCTGAGAAGCCCAGGGG + Intronic
1124705684 15:31962037-31962059 GTGTTGCAGGTGGGGCCTAGTGG + Intergenic
1126573732 15:50178070-50178092 GTATTGCAGGAGAAGTTTAGGGG - Intronic
1126866737 15:52945001-52945023 GTGTTGTGGGAGAGGCCCAGTGG - Intergenic
1127043324 15:55001055-55001077 GTGTTGGAGGTGAGGCCTAGTGG - Intergenic
1127576418 15:60296390-60296412 GTGTTGTGGGAGGGGCCTAGAGG - Intergenic
1127882739 15:63172487-63172509 GTGTTGGAGGAGAGGCCTGGTGG - Intergenic
1129831810 15:78675693-78675715 GTGTTGCCAGGCAAGCCTAAGGG + Intronic
1130359285 15:83166894-83166916 GTGTTGGAGGAGGAGCCTGGTGG - Intronic
1131606768 15:93913346-93913368 GTGTTGGAGGTGAGGCCTAGTGG + Intergenic
1131618185 15:94038543-94038565 GTGTTGTGGGAGGAACCTAGTGG - Intergenic
1131700797 15:94933946-94933968 GTGTTGCGGGAGGAACCTGGTGG - Intergenic
1132427475 15:101730661-101730683 GTGTTGCAGGTGGGGCCTAGTGG - Intergenic
1202955254 15_KI270727v1_random:72069-72091 CTGTTGGCGGGGAAGCCTGGCGG - Intergenic
1132695004 16:1198174-1198196 GTGTCGCCAGACAAGCCTCGAGG + Intronic
1132752714 16:1466189-1466211 GTGTTGGCGGAGGAGTCCAGCGG + Intronic
1134356257 16:13484884-13484906 GTGTTGGAGGAGAAACCTGGTGG - Intergenic
1134591524 16:15458047-15458069 GTGTTGAGGGAGAGACCTAGTGG - Intronic
1135681995 16:24465370-24465392 GTGTTGGAGGAGAGGCCTGGTGG - Intergenic
1138068120 16:53963464-53963486 GTGTTGGAGGAGGAGCCTGGTGG + Intronic
1139195842 16:64917749-64917771 GTGTTGCAGGAGGGGCCTGGTGG - Intergenic
1141176282 16:81721562-81721584 GTGTTGAGGGAGAAACCTTGTGG + Intergenic
1142840092 17:2622086-2622108 GTGTTGCAGGAGAGACCCAGGGG - Intronic
1143594235 17:7904865-7904887 GTTTTGCAGGAGAAGCAGAGGGG + Intronic
1144000814 17:11053183-11053205 GTGTTGGAGGTGGAGCCTAGCGG - Intergenic
1145752976 17:27368411-27368433 GTGTTGAAGGAGGAGCCTATGGG - Intergenic
1148800359 17:50221172-50221194 GTGTAGCCAGAAACGCCTAGGGG - Intergenic
1148897635 17:50849033-50849055 GTGTTGGAGGAGAGGCCTGGTGG - Intergenic
1149393519 17:56215880-56215902 GTGTTGCCGGAGAAGCCTAGAGG + Intronic
1151286433 17:73115083-73115105 GTGTTGATGGAGGAGCCTGGTGG + Intergenic
1151373510 17:73666174-73666196 GTGTTGGAGGAGAAGCCTGGTGG + Intergenic
1153583016 18:6594358-6594380 GTGTTGGAGGAGAGGCCTGGTGG - Intergenic
1154450073 18:14468236-14468258 GTGTTGGAGGAGAGGCTTAGTGG - Intergenic
1155795914 18:30035990-30036012 GTGTTGTGGGAGAGGCCCAGTGG + Intergenic
1155812722 18:30258784-30258806 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
1155917184 18:31568406-31568428 GTGTTGCAGGTGGGGCCTAGTGG + Intergenic
1158122058 18:54059271-54059293 GTGTTGACCAAGAAGCCTGGTGG - Intergenic
1159632936 18:70769684-70769706 GTGTTGGGGGAGAAGCATGGAGG + Intergenic
1160006750 18:75073923-75073945 GTGTTGAGGGAGAGGCCTGGTGG + Intergenic
1160088277 18:75800852-75800874 GCGATGCAGGAGAAGCCGAGTGG - Intergenic
1160217556 18:76946128-76946150 GTGTTGTGGGAGAAACCTGGTGG + Intronic
1160311349 18:77793810-77793832 GTGTTGCGGGAGGAACCCAGTGG + Intergenic
1160492756 18:79351805-79351827 GTGGTGATGGGGAAGCCTAGGGG + Intronic
1161678480 19:5666970-5666992 ATGTTGCCTGAAAAGCCTTGGGG + Intronic
1162154611 19:8668919-8668941 GTGTGGCCGGAGAAGTCCAGTGG + Intergenic
1162345231 19:10114772-10114794 GTGTTGCTGGAGAACCCTGAGGG + Exonic
1163774858 19:19212087-19212109 GTGTTGCGGGAGAAGACTTCGGG + Intronic
1163963191 19:20717274-20717296 GTGTTGGCGGTGAGGCCTGGTGG - Intronic
1164580256 19:29430339-29430361 GTGTTGCAGGTGAGGCCTGGTGG + Intergenic
1168259941 19:55187675-55187697 GTGATGCCGAAGAAGGCAAGGGG - Intronic
925290653 2:2746184-2746206 GTGTTGGAGGTGAAGCCTGGTGG - Intergenic
925860801 2:8173298-8173320 GTGGTGCAGGAAAGGCCTAGAGG + Intergenic
926133528 2:10320308-10320330 GTGTTGGAGGAGGAGCCTGGTGG + Intronic
926275368 2:11399493-11399515 ATGTTGGCGGAGGAGCCTGGTGG + Intergenic
926919835 2:17929521-17929543 GTGTTGCAGGTGGAGCCTGGTGG - Intronic
928327358 2:30330093-30330115 GTGTTGTGGGAGAGACCTAGGGG - Intergenic
928541116 2:32284397-32284419 GTGTTGGAGGAGAGGCCTGGTGG + Intronic
930729919 2:54719039-54719061 GTGTTGTGGGAGAAACCTGGTGG - Intergenic
930934315 2:56929137-56929159 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
931020385 2:58038148-58038170 GTGTTGAGGGAGAGGCCTGGTGG + Intronic
932912437 2:75819479-75819501 GTGTTGTGGGAGAAACCTGGTGG - Intergenic
933382465 2:81566888-81566910 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
933521428 2:83379821-83379843 ATGTTGGCGGAGAAGTCTGGTGG + Intergenic
933982995 2:87568806-87568828 GTGTTGGAGGAGGGGCCTAGTGG - Intergenic
934107057 2:88704540-88704562 GTGTTGTGGGAGAAACCTGGTGG - Intronic
935964522 2:108460773-108460795 GTGTTGGAGGTGAGGCCTAGTGG + Intronic
936310849 2:111381989-111382011 GTGTTGGAGGAGGGGCCTAGTGG + Intergenic
936730216 2:115374013-115374035 GTGTTGCAAGAGAGGCCTGGTGG - Intronic
937178934 2:119971345-119971367 GTGTTGGAGGAGAGGCCTTGTGG - Intronic
937450278 2:121996527-121996549 GTGTTGAAGGTGCAGCCTAGTGG - Intergenic
938800213 2:134755976-134755998 GTGTTGCAGGTGAGGCCTAGTGG - Intergenic
939446112 2:142311734-142311756 GTGTTGAGGGAGAAACCTGGTGG - Intergenic
940024827 2:149194807-149194829 GTGTTTCTGGAGAAGCAAAGAGG + Intronic
942769723 2:179502406-179502428 GTGTTGGAGGAGAGGCCTAATGG + Intronic
942961495 2:181834698-181834720 GTGTTGTAGGAGGAGCCTGGTGG - Intergenic
945866054 2:215177163-215177185 GTGTTGGAGGAGAGGCCTGGAGG + Intergenic
947093492 2:226540445-226540467 GTGTTGAGGGAGGAGCCTGGTGG - Intergenic
947287047 2:228528667-228528689 GCATTGCCTGAGAACCCTAGAGG + Intergenic
947964797 2:234270347-234270369 GTGTTAAAGGAGGAGCCTAGTGG + Intergenic
948185800 2:236020355-236020377 GTGTTGCCCATGAAGCATAGGGG + Intronic
948244418 2:236466759-236466781 GTGTTGGAGGTGGAGCCTAGTGG - Intronic
1171433517 20:25102484-25102506 GTGTTGGAGGTGGAGCCTAGTGG - Intergenic
1171505305 20:25628255-25628277 GTGTTGGAGGAGAGGCCTGGTGG - Intergenic
1172832369 20:37846727-37846749 GTGTGGCAGGAGGGGCCTAGTGG - Intronic
1174073086 20:47912438-47912460 GTGAGGCCAGAGAAGCCTTGGGG + Intergenic
1174916038 20:54654932-54654954 GTGTTGAGGGAGAGGCCTCGTGG + Intergenic
1176446112 21:6822126-6822148 GTGTTGGAGGAGAGGCTTAGTGG + Intergenic
1176824278 21:13687159-13687181 GTGTTGGAGGAGAGGCTTAGTGG + Intergenic
1177396983 21:20549216-20549238 GTGTTGGAGGAGAAGCCTGGTGG + Intergenic
1177472005 21:21571314-21571336 ATGTTGTGGGAGAAGCCTGGTGG + Intergenic
1177867622 21:26531420-26531442 GTGTTGAAGGAGAATCCTGGTGG + Intronic
1179096546 21:38321146-38321168 GTGTTGGAGGAGAGGCCTGGTGG - Intergenic
1179211011 21:39324288-39324310 GTGTTGCAGGTGGAGCCTGGTGG + Intergenic
1179964042 21:44790491-44790513 GTGTTGAGGGAGGAACCTAGTGG + Intronic
1183879160 22:40811820-40811842 GTGTTGGAGGTGAGGCCTAGTGG - Intronic
1184013644 22:41768795-41768817 GTGTTGGAGGAGGAGCCTGGTGG - Intronic
1184589399 22:45471503-45471525 GTGTTGAAGGAGGAGCCTGGTGG + Intergenic
1184931675 22:47685991-47686013 GTGTTGCAGGAGGAACCTAGTGG - Intergenic
949259905 3:2093543-2093565 GTGTTGCGGGAGCTGCCCAGTGG + Intergenic
949673459 3:6425764-6425786 GTGTTGTGGGAGAAACCTGGTGG - Intergenic
950286874 3:11751951-11751973 GTGATGCCACAGAAGCCTAGTGG - Intergenic
951201818 3:19883792-19883814 GTGATGCTGAAGAAGCCAAGTGG + Intronic
952082115 3:29771920-29771942 GTGTTGGAGGAGGGGCCTAGTGG - Intronic
952741608 3:36739420-36739442 GTATTGTGGGAGAAACCTAGTGG + Intronic
953556032 3:43947737-43947759 GTGTTGCGGGAGAGACCTAAAGG - Intergenic
954577288 3:51683606-51683628 GGGTTGCAGAAGAAGTCTAGAGG + Intronic
954709683 3:52499287-52499309 TTGTTGCCGTAGAAGGCTGGTGG + Intronic
955765895 3:62343573-62343595 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
956418566 3:69060707-69060729 GTGTTGGAGGTGAGGCCTAGTGG + Intronic
957576326 3:82013526-82013548 GTGTTGAAGGTGAGGCCTAGTGG + Intergenic
957691504 3:83576730-83576752 ATGTTGCAGGTGAAGCCTTGTGG - Intergenic
958049713 3:88330324-88330346 GTGTTGGAGGTGGAGCCTAGTGG - Intergenic
958550478 3:95606485-95606507 GTGTTGCCAGAGAGGCACAGTGG - Intergenic
958740113 3:98058827-98058849 GTGTTGCAGGAGAGGCCTGGTGG - Intergenic
958831629 3:99097629-99097651 GTGTTGCGGGAGAGACCCAGTGG + Intergenic
959105133 3:102057125-102057147 GCGTTGGAGGAGAGGCCTAGTGG - Intergenic
959303573 3:104631878-104631900 GTGTTGGAGGAGGGGCCTAGTGG - Intergenic
960220212 3:115098810-115098832 GTGTTGTCAGAGAAGCCTAATGG + Intronic
960738851 3:120810649-120810671 GTGTTGTGGGAGAAACCTGGTGG + Intergenic
960903293 3:122573245-122573267 GTGTTGGAGGTGAAGCCTAACGG - Exonic
963172487 3:142265089-142265111 CTGTTGTGGGAGAAGCCCAGTGG + Intergenic
963227144 3:142873973-142873995 ATGTTGCAGGAGGAGCCTGGTGG + Intronic
963572683 3:147016904-147016926 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
963777141 3:149451154-149451176 GTGTTGGAGGTGGAGCCTAGTGG - Intergenic
963816786 3:149839661-149839683 GTGTTGTGGGAGAAACCTCGTGG - Intronic
965198727 3:165630210-165630232 GTGTTGTGGGAGAAACCTGGAGG + Intergenic
965389195 3:168084045-168084067 ATGTTGCAGGAGAGGCCTGGTGG + Intronic
966052134 3:175632140-175632162 GTGTTGCAGGAGGGACCTAGTGG + Intronic
966513766 3:180794190-180794212 GTGTTGGAGGAGAGGCCTGGTGG + Intronic
966888909 3:184392068-184392090 GTTTTGCTGGAGAAGCTCAGTGG - Intronic
967005928 3:185382577-185382599 GTGTTGGAGGTGAGGCCTAGTGG + Intronic
967604255 3:191425400-191425422 ATGTTGCCGGAGGAACCTGGTGG + Intergenic
967645161 3:191913942-191913964 GTGTTGGAGGTGGAGCCTAGTGG + Intergenic
969103471 4:4787520-4787542 GTGTTGCATGAGGAGCCTGGTGG + Intergenic
970099600 4:12505207-12505229 GTGTTGAGGGAGAAACCTGGTGG + Intergenic
970224996 4:13848766-13848788 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
970292957 4:14596437-14596459 GAGTTTCCCTAGAAGCCTAGAGG + Intergenic
970309684 4:14768970-14768992 GTGTGGTCAGGGAAGCCTAGTGG - Intergenic
970816160 4:20158670-20158692 GTGTTGGAGGAGGGGCCTAGTGG + Intergenic
971896566 4:32604753-32604775 GTGTTGGAGGAGAGGCCTGGTGG - Intergenic
971972564 4:33638736-33638758 GTGTTGACGGAGGAACCTGGTGG + Intergenic
972367386 4:38389210-38389232 GTGTTGTTGGAGGAGCCCAGTGG - Intergenic
972730546 4:41790439-41790461 GTGTTGGAGGTGAGGCCTAGTGG - Intergenic
973015041 4:45127555-45127577 GTGTTGGAGGAGAGGCCCAGTGG + Intergenic
974482406 4:62462736-62462758 CTGTTGGAGGAGGAGCCTAGTGG + Intergenic
976089949 4:81446792-81446814 GTTTTGCAGTAGAAGGCTAGTGG - Intronic
977592608 4:98842946-98842968 GTGTTGTGGGAGAGACCTAGGGG + Intergenic
977612704 4:99052639-99052661 GTGTTGGAGGAGAGGCCTGGTGG - Intronic
978018044 4:103772832-103772854 GTGTTGGAGGAGGGGCCTAGTGG + Intergenic
978067887 4:104428518-104428540 GTGTTGAGGGAGAAACCCAGTGG + Intergenic
978083278 4:104620600-104620622 GTGTTGTCGGAGGGACCTAGTGG - Intergenic
979225051 4:118275353-118275375 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
979610079 4:122680743-122680765 GTGTTGGAGGAGGAGCCTGGTGG + Intergenic
980552991 4:134364683-134364705 GTGTTGGAGGAGGGGCCTAGTGG - Intergenic
981275277 4:142892384-142892406 GTGTTGGAGGAGGGGCCTAGTGG + Intergenic
984074592 4:175159672-175159694 GTGTTGGAGGTAAAGCCTAGTGG + Intergenic
984516876 4:180752317-180752339 GTGTTGTGGGAGGAGCCCAGTGG - Intergenic
984670734 4:182483948-182483970 GTGCTGGAGGAGAAGCCTAGTGG - Intronic
985191079 4:187373513-187373535 GTGTTGCAGGAGGGGCCCAGTGG - Intergenic
986242240 5:5971417-5971439 GTGTTGGAGGTGGAGCCTAGTGG - Intergenic
986242906 5:5977431-5977453 GTGTTGAGGGAGAGACCTAGTGG + Intergenic
986281742 5:6329009-6329031 GTGTTGGAGGAGGGGCCTAGCGG + Intergenic
986748633 5:10765269-10765291 GTGTGGCCAGAGGAGCCAAGAGG - Intergenic
986950064 5:13072114-13072136 GTGTTGAAGGAGAGGCCTGGTGG - Intergenic
986999931 5:13650307-13650329 GTGTTGTGGGAGAAACCTGGTGG + Intergenic
987542152 5:19269931-19269953 GTGTTGGAGGAGGGGCCTAGTGG - Intergenic
987699810 5:21382662-21382684 GTGTTGAAGGAGGAGTCTAGTGG - Intergenic
987861859 5:23499677-23499699 GTGTTGGAGGAGAAGCCTTCTGG - Intergenic
988091034 5:26541935-26541957 GTGTTGTGGGAGAAACCCAGTGG - Intergenic
989628587 5:43457636-43457658 GTGTTGGAGGAGGAGCCTGGTGG - Intronic
990213901 5:53509580-53509602 GTGTTGGAGGAGGAGCCTGGTGG - Intergenic
990355778 5:54964748-54964770 GTGTTGAGGGAGAAACCTGGTGG - Intergenic
996499875 5:124204470-124204492 GTGTTGAAGGAGAGACCTAGTGG + Intergenic
996621368 5:125507624-125507646 GTGTTGTGGGAGGAGCCCAGTGG - Intergenic
996674606 5:126159360-126159382 GTGTTGGAGGTGGAGCCTAGTGG - Intergenic
996829324 5:127721954-127721976 GTGTTGGAGGAGGAGCCTAGTGG - Intergenic
996840009 5:127837501-127837523 GTGTTGAGGGAGAGACCTAGTGG - Intergenic
999012404 5:148056966-148056988 GTGTTGTGGGAGAGACCTAGTGG + Intronic
1004054687 6:12123463-12123485 GTGCTGCCGGACAAGTCTTGAGG - Exonic
1005935852 6:30520482-30520504 GAGTTGCAGGAGAAACCCAGTGG + Intergenic
1005984585 6:30863188-30863210 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
1009204938 6:60789720-60789742 GTGTTGAGGGAGAAACCTGGTGG + Intergenic
1010498816 6:76568664-76568686 GTGTTGCAGGTGAGGCCTGGTGG - Intergenic
1010536433 6:77037102-77037124 GTGTTGAAGGAGGAGCCTGGTGG + Intergenic
1010731170 6:79393090-79393112 GTGTTGGAGGAGGAGCCTGGTGG + Intergenic
1011554536 6:88561015-88561037 GTGTTGGAGGTGAGGCCTAGTGG + Intergenic
1011743521 6:90387228-90387250 GTGGTGCCAGCGAAGCCTCGAGG - Intergenic
1011862220 6:91773538-91773560 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
1012516942 6:100072777-100072799 GGGTTGCAGGAGGAGCCTTGAGG + Intergenic
1012733626 6:102911297-102911319 GTGTTGAGGGAGAGACCTAGTGG + Intergenic
1012899043 6:104986021-104986043 GTGTTGGGGGAGGGGCCTAGTGG + Intronic
1013890406 6:115020383-115020405 GTGTTGTGGGAGAAACCTGGTGG - Intergenic
1013963409 6:115928140-115928162 GTGCTGCCGGAGCCTCCTAGAGG - Intergenic
1015349485 6:132200264-132200286 GTGTTGGTGGAGGAGCCTGGTGG - Intergenic
1015523305 6:134152462-134152484 GTGTTGTGGGAGAGACCTAGGGG + Intergenic
1016249794 6:142027193-142027215 GTGTTGTGGGAGAGACCTAGTGG + Intergenic
1016700348 6:147047560-147047582 GTGTTGGAGGTGAGGCCTAGTGG + Intergenic
1017618095 6:156266328-156266350 GTGTTGTGGGAGAAACCTAGTGG - Intergenic
1017883718 6:158581098-158581120 GTGTTGCCTGAGAAGCCGCAAGG - Intronic
1018030164 6:159835433-159835455 GTGCTGCCTGAGAAGCCAAGAGG + Intergenic
1018482303 6:164204285-164204307 GTGTTGTGGGAGGAGCCCAGTGG + Intergenic
1020696385 7:11419263-11419285 GTGTTGCAGGAGGGGCCTGGTGG + Intronic
1022152175 7:27618967-27618989 GTGTTGGAGGTGAAGCCTGGTGG - Intronic
1022521442 7:31010079-31010101 GTGTTGGAGGAGGAGCCTGGTGG - Intergenic
1023137951 7:37072258-37072280 GTGTTGTAGGAGGAGCCTGGTGG + Intronic
1023597683 7:41849324-41849346 GTGTTGGAGGAGAGGCTTAGTGG - Intergenic
1026608762 7:71838651-71838673 GTGTTGTGGGAGGAGCCCAGTGG + Intronic
1026686626 7:72515658-72515680 GTGTTGTAGGAGAAACCCAGTGG + Intergenic
1028066440 7:86391044-86391066 GTGTTGTGGGAGAAACCTGGTGG - Intergenic
1028334225 7:89631102-89631124 ATGTTGCAGGTGGAGCCTAGTGG + Intergenic
1029509902 7:100987554-100987576 GTGTTGCAGGAGGGGCCTTGTGG + Intronic
1031429095 7:121644080-121644102 GTGTTGGCGGTGGAGCCTGGTGG - Intergenic
1031773054 7:125870216-125870238 GTGTTGGAGGAGGAGCCTAGTGG - Intergenic
1032368451 7:131322966-131322988 GTGTCGGGGGAGAAGCCTGGTGG - Intronic
1032535347 7:132658341-132658363 GTGTTGGAGGAGGAGCCTGGTGG - Intronic
1032887614 7:136158521-136158543 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
1033652492 7:143353435-143353457 GTGATGCTGGAGAAGGCTACAGG - Exonic
1033790809 7:144790688-144790710 GTGTTGAAGGTGAAGCCTGGTGG - Intronic
1033798347 7:144873546-144873568 GTGTTGCGGGAGAGACCTGGTGG + Intergenic
1034255448 7:149722399-149722421 CTGTTGCAGGAGAAGACAAGAGG - Intronic
1035993734 8:4522098-4522120 GTGTTGTGGGAGGAGCCTGGGGG + Intronic
1037694487 8:21211370-21211392 CTGTTGACGGAGATGCCTGGTGG - Intergenic
1038489657 8:27961197-27961219 GTGTTGGAGGTGAGGCCTAGTGG + Intronic
1039597416 8:38802911-38802933 GTGTTGTAGGTGAGGCCTAGTGG - Intronic
1039734486 8:40316009-40316031 GTGTTGTGGGAGAAACCTGGTGG - Intergenic
1040534581 8:48297592-48297614 GTGGTGTCAGAGAGGCCTAGAGG - Intergenic
1041317860 8:56582748-56582770 GTGTTGGAGGAGGAGCCTGGTGG + Intergenic
1042454363 8:68983433-68983455 GTGTTGGAGGAGGAGCCTGGTGG - Intergenic
1043013792 8:74912604-74912626 GTGTTGCAGGAGGGGCCTGGTGG + Intergenic
1044298191 8:90553009-90553031 GTGTTGGGAGAGAAGCCTAATGG + Intergenic
1044525654 8:93247979-93248001 GTGTTGGAGGAGGAGCCTGGTGG + Intergenic
1045674680 8:104593898-104593920 GTGTTGGAGGAGAGGCCTGGAGG + Intronic
1046517355 8:115280610-115280632 GTGTTGGAGGAGAGGCCTGGTGG - Intergenic
1048023230 8:130559935-130559957 GTGTTGAAGGAGAGGCCTGGTGG + Intergenic
1048070998 8:131020855-131020877 TTATTGCTGGAGAAGACTAGTGG - Intronic
1048260742 8:132943183-132943205 GTGTTGGAGGTGAGGCCTAGTGG + Intronic
1048387562 8:133926832-133926854 GTGTTGCCGGAGGAACCCAGTGG + Intergenic
1048448257 8:134509224-134509246 GGGTAGCCGGAGAAGCCAGGAGG - Intronic
1048516021 8:135112398-135112420 GTGTTGGAGGTGAAGCCTGGTGG + Intergenic
1048598114 8:135888374-135888396 GTGTTGCCCGAGGAACCTAGAGG - Intergenic
1048652977 8:136501396-136501418 GTGTTGAAGGTGAAGCCTAATGG + Intergenic
1048990494 8:139757540-139757562 GTGTCGCCGGAGGAGCCAGGGGG + Intronic
1049653020 8:143784217-143784239 GTGTTGCAGGAGGGGCCTGGGGG + Intergenic
1051363809 9:16305690-16305712 GTGTCCTCGGGGAAGCCTAGGGG + Intergenic
1053878140 9:42564184-42564206 GTGTTGTCGGAGAAACCCAGTGG + Intergenic
1053894519 9:42730182-42730204 GTGTTGTGGGAGAAACCCAGTGG - Intergenic
1054233554 9:62537510-62537532 GTGTTGTCGGAGAAACCCAGTGG - Intergenic
1054843647 9:69769717-69769739 GTGTTGGCGGTGGAGCCTGGTGG - Intergenic
1055140115 9:72867590-72867612 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
1055525655 9:77130591-77130613 GTGTTGGAGGTGAAGCCTGGTGG - Intergenic
1056179780 9:84070897-84070919 GTGTTGGAGGAGGAGCCTGGTGG - Intergenic
1062235737 9:135506716-135506738 GTGTTGGGGCAGGAGCCTAGCGG + Intergenic
1203523081 Un_GL000213v1:62399-62421 GTGTTGGAGGAGAGGCTTAGTGG - Intergenic
1186053446 X:5624460-5624482 GTGTTGAAGGAGAGGCCTGGTGG + Intergenic
1186974614 X:14888337-14888359 GTGTTGTGGGAGAAACCTGGTGG + Intronic
1188558779 X:31443936-31443958 GTGTTGGTGGTGAGGCCTAGTGG + Intronic
1189228559 X:39433979-39434001 GTGTTGTGGGAGAAACCTGGTGG - Intergenic
1190444532 X:50510294-50510316 GTGTTGCTGGAGGTGCCTGGTGG + Intergenic
1191661173 X:63652789-63652811 GTGTTGGGGGAGGGGCCTAGTGG + Intronic
1191721805 X:64236915-64236937 GTGTTGGAGGAGGGGCCTAGTGG - Intergenic
1191738679 X:64414537-64414559 GTTTTGCAGGAGGGGCCTAGTGG + Intergenic
1191833106 X:65436252-65436274 GTGTTGGAGGAGGGGCCTAGTGG - Intronic
1192071991 X:67950588-67950610 GTGTTGGAGGATAGGCCTAGTGG - Intergenic
1192399574 X:70821354-70821376 GTGTTGGGGGAGAGGCCTGGTGG + Intronic
1192931542 X:75811598-75811620 GTGTTGGAGGAGAGGCCTTGAGG + Intergenic
1193134587 X:77956440-77956462 GTGTTGGAGGTGGAGCCTAGTGG + Intronic
1193241617 X:79176746-79176768 GTATTGGCGTAGAAGCATAGAGG + Intergenic
1193279004 X:79625818-79625840 GTGTTGTGGGAGGAGCCCAGGGG - Intergenic
1194454074 X:94080560-94080582 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
1196004893 X:110825397-110825419 GTGTTGCAGGTGAGGCCTGGTGG + Intergenic
1196754095 X:119142939-119142961 GTGTTGAAGGTGAAGCCTAGTGG - Intronic
1198035873 X:132800787-132800809 GTGTTGAGGGAGAAACCTGGTGG + Intronic
1198564612 X:137891481-137891503 GTGTTGGAGGTGAAGCCTGGTGG - Intergenic
1198817660 X:140609329-140609351 GTGTTGGAGGAGGGGCCTAGTGG + Intergenic
1199779451 X:151044803-151044825 GTGTTGGAGGAGGAGCCTGGTGG + Intergenic
1201184682 Y:11388888-11388910 GTGTTGTGGGAGGAGCCTGGTGG + Intergenic