ID: 1149397484

View in Genome Browser
Species Human (GRCh38)
Location 17:56259847-56259869
Sequence CCATTCTACCAGGTATATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 1, 2: 2, 3: 40, 4: 319}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149397484 Original CRISPR CCATTCTACCAGGTATATAT AGG Intronic
900039730 1:448795-448817 CCATTCTAACAGGTATGAAGTGG - Intergenic
900061162 1:683771-683793 CCATTCTAACAGGTATGAAGTGG - Intergenic
904854093 1:33482752-33482774 CCATTCTAATAGGTAGATAGTGG + Intronic
905696681 1:39979782-39979804 CTATTTTGCCAGGCATATATGGG - Intergenic
907143420 1:52210224-52210246 CCATTTTACTACTTATATATTGG - Intronic
907654466 1:56328170-56328192 CCACTCTACTTGGTATATGTCGG + Intergenic
907683681 1:56589001-56589023 CCATTCTGATGGGTATATATTGG - Intronic
909375111 1:74932049-74932071 CCATTCTAATAGGTTTATAGTGG - Intergenic
910315560 1:85878771-85878793 CCATTCTAACAGATGTATAGTGG + Intronic
911806656 1:102218487-102218509 CCATTCTAATAGATATATAGTGG - Intergenic
912218077 1:107639635-107639657 TTATTCTAGCAGGTATATAGTGG - Intronic
913235366 1:116776407-116776429 CCATTCTAATAGGTATGTAGCGG - Intergenic
914321179 1:146561916-146561938 CCATTCTACTCGGTATAAAGTGG + Intergenic
914785701 1:150827855-150827877 CCATTCTAGTGGGTATATAGTGG + Intronic
916501251 1:165389170-165389192 CCATTCTCACAGGTGTATCTGGG + Intergenic
916826763 1:168449401-168449423 CGCTTCTACCTGGTAGATATGGG + Intergenic
917382926 1:174434654-174434676 CCATTCTAGTGGGTATATATTGG + Intronic
918876488 1:190052033-190052055 CCATTCTAGTAGGTATTTAATGG + Intergenic
919071311 1:192758703-192758725 CCACTCTAACAGGTATGTAAAGG + Intergenic
919074981 1:192802520-192802542 CCATTTTAACAGGTGTGTATTGG - Intergenic
920289371 1:204907160-204907182 CCATTCTAACATGTGTATAATGG + Intronic
920358367 1:205393351-205393373 CCATTCTACTGGGTATAAAGTGG - Intronic
920993281 1:210960932-210960954 CCATTCTAATAGGTACATAGTGG + Intronic
921127686 1:212192090-212192112 CCATTCTAATAGGTACATAGTGG - Intergenic
921601570 1:217111728-217111750 CCACTCTCCCAGGGAGATATTGG - Intronic
922055154 1:222035477-222035499 CCATTCTAATAGGTATGTAATGG - Intergenic
923459796 1:234198574-234198596 CCATTCTAGCAGGTATGAAGTGG + Intronic
923758885 1:236820842-236820864 CCATTCTAATAGGTGTATAGTGG + Intronic
923967057 1:239153929-239153951 CCATTCCAAGAGGTATAAATAGG - Intergenic
924049789 1:240069267-240069289 CCATTCTAATAGGTATGTAATGG + Intronic
924300168 1:242629406-242629428 TCATTCTACCAAGTGTATAGTGG + Intergenic
1063429133 10:5974430-5974452 CCATTCTACTAGGTATGTAGGGG - Intronic
1064206078 10:13324851-13324873 CCATTCTAACAGGTATGTGGTGG + Intronic
1064482975 10:15758035-15758057 CCATTCTACTAGGTATATATTGG + Intergenic
1065405995 10:25365596-25365618 CCATTCTTCCTGATAGATATAGG - Intronic
1065526394 10:26625670-26625692 CCATTCTAATAGGTATGTAGTGG + Intergenic
1066535269 10:36384084-36384106 CCATTCTAAAAGGGATACATAGG - Intergenic
1066642930 10:37574271-37574293 CCATTCTAAAAGGGATACATAGG - Intergenic
1066678521 10:37913798-37913820 CCATTCCACGAGGTATCTGTTGG + Intergenic
1067203059 10:44191433-44191455 CCATTCTAACAGGTATGTAGTGG - Intergenic
1067857783 10:49811464-49811486 CCATTCTAATAGGTATGTAGTGG + Intergenic
1070708586 10:78659937-78659959 GCATTTTACCAGGTAACTATGGG - Intergenic
1070755641 10:78991401-78991423 CCATTTTACTAGATATGTATGGG - Intergenic
1071245936 10:83763449-83763471 CCATTCTAACTGGTGTATAGTGG - Intergenic
1071850183 10:89560803-89560825 CCATTCTAATAGGTATGTAGTGG - Intergenic
1072076323 10:91977753-91977775 CCATGCTAACAGGTATAGAGTGG + Intronic
1072603753 10:96959042-96959064 CCATTATACCATGTATTTCTCGG + Intronic
1073382239 10:103087805-103087827 ACATTCTAAATGGTATATATTGG - Exonic
1075012267 10:118884766-118884788 CCATTCTAGTGGGTATATGTTGG - Intergenic
1076965953 11:84708-84730 CCATTCTAACAGGTATGAAGTGG - Intergenic
1077683578 11:4269861-4269883 CCATTCTAATAGGTATGTAGTGG - Intergenic
1077686462 11:4296902-4296924 CCATTCTAATAGGTATGTAGTGG + Intergenic
1077691616 11:4348090-4348112 CCATTCTAATAGGTATGTAGTGG + Intergenic
1082907321 11:58323514-58323536 CCATCCTAGCAGGTATAAAGTGG + Intergenic
1083247621 11:61441734-61441756 CCATTCCAAGAAGTATATATTGG + Intronic
1083390250 11:62343814-62343836 CCATTCTAGTAGGCATATAATGG + Intronic
1083954069 11:65973275-65973297 CCATTCTTGGTGGTATATATGGG - Intronic
1084885306 11:72200872-72200894 CCATTCTAATAGGTATAAAATGG - Intergenic
1085244284 11:75086643-75086665 TCATTCTAACAGGTATGTAGTGG - Intergenic
1085452788 11:76646112-76646134 CCATTCTATCAGGTGTTTAGTGG - Intergenic
1085706253 11:78789006-78789028 CCACTCTACCATGTAAAAATGGG - Intronic
1086069384 11:82783135-82783157 CCATTCTAATAGGTGTGTATTGG + Intergenic
1086116083 11:83252208-83252230 CCATTCTGATGGGTATATATTGG - Intronic
1087942354 11:104113806-104113828 CCATTCTAATAGGTATGTAGCGG + Intronic
1088091146 11:106041380-106041402 CCATTATAACAGGAATCTATTGG - Intergenic
1088178201 11:107078496-107078518 CCATTCTAATAAGTATATAGTGG + Intergenic
1088445195 11:109918961-109918983 CCATTCTACTAGGTGTGTAGTGG + Intergenic
1088705116 11:112455167-112455189 CCATTCTAATAGGTATGTAGTGG + Intergenic
1089839403 11:121401520-121401542 CCATTCTAGCAGGTATGAAGTGG + Intergenic
1091575409 12:1729160-1729182 CCATTCTTCCTGGAATATACTGG + Intronic
1093591676 12:20909073-20909095 CCATTCTAATAGGTATGTAGTGG + Intronic
1093672300 12:21891506-21891528 CCATTTTATGAGGTATATACAGG + Intronic
1093738199 12:22648910-22648932 CCATTCTAATAGATATATAGTGG + Intronic
1094312650 12:29101837-29101859 CCATTCTAATAGTTATATAGTGG + Intergenic
1095166056 12:38973402-38973424 CCATTCTAATAGGTGTATAGTGG + Intergenic
1095552589 12:43460390-43460412 CCATTCTACTAGGTATAAAATGG - Intronic
1095901157 12:47329585-47329607 CCGTTCTAACAGGTACATAGTGG + Intergenic
1100786205 12:98081233-98081255 CCATTCTACCAAAAATAAATGGG - Intergenic
1101033375 12:100681350-100681372 CTATCCTACCAGGTACATAAGGG + Intergenic
1101344788 12:103876975-103876997 CCATTCTAATAGGTGTATAGTGG - Intergenic
1101461125 12:104895335-104895357 CCACTTTAACAGGTAAATATTGG - Exonic
1101649514 12:106662251-106662273 CCATTCTAATAGGTATGTAGTGG + Intronic
1102325550 12:111979883-111979905 CCATTCTAGTAGGTATGTATTGG - Intronic
1102941197 12:116943719-116943741 CCAGACTCCCAGGAATATATTGG + Intronic
1103310653 12:120004548-120004570 CCATTCCTCCAGGTATCTCTTGG - Intronic
1104514823 12:129415358-129415380 CCATTCTAACAGGTATGTGAGGG + Intronic
1106967775 13:35092660-35092682 TTATTCTACTAGGTATATAATGG - Intronic
1107179127 13:37437408-37437430 CCATTCTAATAGGTGTGTATTGG - Intergenic
1108211790 13:48146864-48146886 CCATTCTAATAGGTATGTAGTGG + Intergenic
1108315921 13:49237480-49237502 CCATTGTAATAGGTATATAGTGG - Intergenic
1108460393 13:50660713-50660735 ACATTCTTACAGGTATATAGTGG + Intronic
1109087436 13:57992854-57992876 CTATTCTAACAGGTATGTAGTGG + Intergenic
1109625646 13:64970381-64970403 TCATTCTACCATGTTTGTATGGG + Intergenic
1110425604 13:75363072-75363094 CCATTCTAAGAGGTATATAGTGG - Intronic
1111580249 13:90213385-90213407 CCAATTTACCATCTATATATTGG - Intergenic
1111751572 13:92338244-92338266 CCATTCTAATACGTATATATTGG - Intronic
1112631530 13:101166425-101166447 CCATTCTAATAGGTATAAAGTGG + Intronic
1112762345 13:102705692-102705714 CCATTCTAATAGGTATATAGTGG - Intergenic
1116733475 14:48657009-48657031 TCATAATACCAGGTATAGATGGG - Intergenic
1116906887 14:50412820-50412842 CCATTCTAACTGGTCTAAATGGG - Intronic
1118082646 14:62379289-62379311 CCATTCTAACAGGTATGTAGTGG - Intergenic
1119096390 14:71835874-71835896 CCATTCTAATAAGTATATAGTGG + Intergenic
1119273251 14:73328594-73328616 CCATTCTAATAGGTACATAGTGG + Intronic
1122702537 14:103599546-103599568 CCATTCTAACAGGTGTGTAGTGG - Intronic
1122769078 14:104089541-104089563 CCATTCTAACAGGTATGTAGTGG - Intronic
1202894510 14_KI270722v1_random:191598-191620 CCATTCTACTAGGTATGTAGCGG + Intergenic
1123975231 15:25547252-25547274 CCATTCTAGGGGGTATATAGTGG + Intergenic
1126537767 15:49784865-49784887 CCATTCTAATAGGTATATAGTGG + Intergenic
1129021426 15:72522945-72522967 CCATTCTAATAGGTATGTACTGG - Intronic
1129131596 15:73502971-73502993 CCATTCTAATAGATATATAGTGG - Intronic
1129148001 15:73666794-73666816 CCATTCTATCAAGTATGTAGTGG + Intergenic
1130582372 15:85149977-85149999 CCATTCTAACAGGTGTGTAGTGG - Intergenic
1131320095 15:91380415-91380437 CCATTCTAATATGTATGTATTGG + Intergenic
1131363115 15:91812778-91812800 CCATTCTAATAGGTATGTAGTGG - Intergenic
1131989018 15:98074871-98074893 CCATTCTAATATGTATATAGTGG - Intergenic
1132361096 15:101216196-101216218 CCATTCTAATAGTTATATAGCGG - Intronic
1132442178 15:101878817-101878839 CCATTCTAACAGGTATGAAGTGG + Intergenic
1133439956 16:5812783-5812805 ACATTCTTACAGGTATATACGGG + Intergenic
1137326523 16:47443201-47443223 CCATTCTACCTGGTATGAAATGG - Intronic
1137908270 16:52348973-52348995 CCATTCTTCTAGGTATATAGTGG - Intergenic
1138021611 16:53487881-53487903 CCATTCTAACAGGCATGTAATGG - Intronic
1139721292 16:68857707-68857729 CCATTCTAATAGGTATATAATGG + Intronic
1140012447 16:71149232-71149254 CCATTCTACTCGGTATAAAGTGG - Intronic
1140461671 16:75145226-75145248 CCATTCTAATAGGTATGTAGTGG - Intergenic
1143127068 17:4649116-4649138 CCATTCTAATAGGTATACACTGG + Intergenic
1146636009 17:34505275-34505297 CCATTCTAGAAGGTATATTGTGG - Intergenic
1147534808 17:41313060-41313082 CCATTCCAGCAGGTGTATAGTGG - Intergenic
1148691665 17:49531045-49531067 CCATTCTAATAGGTATGTAGTGG + Intergenic
1149397484 17:56259847-56259869 CCATTCTACCAGGTATATATAGG + Intronic
1149443531 17:56695514-56695536 CCATTCTAATAGGTATGTAGTGG + Intergenic
1149457481 17:56799763-56799785 CCATTCTAATAGGTGTATAGTGG + Intronic
1150673806 17:67226455-67226477 CCATTCTAATAGGTATGTAGTGG - Intronic
1152054379 17:78011841-78011863 CCATTCTAATAGGTATGTAGTGG + Intronic
1153111300 18:1591921-1591943 CCATTCTAATAGGTATGTAGTGG - Intergenic
1154337800 18:13479880-13479902 CCATTCTAAGAGGTATACAGTGG - Intronic
1155414686 18:25584461-25584483 CCATTCTAATAGGTGTATAGTGG + Intergenic
1155797897 18:30063689-30063711 CCATTCTAACAAGTATAAAATGG - Intergenic
1156379960 18:36549111-36549133 CCATTCTACTAGGTAAGTAGTGG + Intronic
1157069155 18:44385782-44385804 CCATTCTTCCAGCAATATAGGGG - Intergenic
1159701596 18:71636366-71636388 GCATTCTACCAGGTGTGTAGTGG - Intergenic
1159829147 18:73251853-73251875 CCATTCTAGTAGGTGCATATAGG - Intronic
1159874444 18:73794642-73794664 CCATTCTAATAGGAATATAATGG - Intergenic
1160642757 19:154338-154360 CCATTCTAACAGGTATGAAGTGG - Intergenic
1162234784 19:9300004-9300026 CCATTCTAACAGGTGTGTAGTGG - Intronic
1164815630 19:31200020-31200042 CCATTCGAATAGGTATATAGAGG - Intergenic
925316062 2:2924496-2924518 CCATTCTAATAGGTGTATAATGG + Intergenic
925889808 2:8424423-8424445 ACATTCTAACAAGTACATATGGG + Intergenic
926282095 2:11457985-11458007 CCATTTTACCAGCTATTTAGAGG + Intronic
927266196 2:21153998-21154020 TCATTCTAAAAGTTATATATAGG - Intergenic
927580007 2:24234796-24234818 CCATTCTAACAGGTGTGTAGTGG - Intronic
928069513 2:28200732-28200754 CTAGTTTACCAGGTATCTATGGG + Intronic
929399638 2:41565184-41565206 CCATTTTACCATGTAGAAATGGG - Intergenic
930167627 2:48219070-48219092 CTCTTCTTCCAGGTATATAGGGG + Intergenic
930340986 2:50114311-50114333 CCATTCTACTAGGTTTATAGTGG - Intronic
930941068 2:57014732-57014754 CCATTCTAGTAGGTATGTAGTGG - Intergenic
932510664 2:72285941-72285963 CCATTCTAATAGGTGTATAGTGG - Intronic
933639175 2:84741140-84741162 ACATTGTCCTAGGTATATATAGG + Intronic
935231855 2:101105674-101105696 CCATTCTATTAAGTATATAATGG - Intronic
935344503 2:102093529-102093551 CCATCCTAAGAGGTATATAGTGG + Intronic
937481937 2:122270646-122270668 CCATTCTAATAAGTATGTATTGG + Intergenic
937823801 2:126342469-126342491 CCATCCTAGCAGGTGTAAATTGG - Intergenic
938866866 2:135431758-135431780 ACATTCTAGTAGGTATATAATGG - Intronic
939546188 2:143556955-143556977 CCATTCTAACAGGTGTGTAGTGG - Intronic
939840228 2:147178666-147178688 CCATCCTAGTAGGTATACATTGG + Intergenic
939910118 2:147971558-147971580 CCATTCTAATAGGTATATATTGG - Intronic
940201088 2:151151764-151151786 CCATTCAAGCTGGTATAAATGGG - Intergenic
941348790 2:164405604-164405626 TCATTCTACAAGGTATACAGTGG - Intergenic
942526546 2:176859312-176859334 CCATTCTAATAGGTATATGTTGG - Intergenic
942928461 2:181460182-181460204 CCAATCTACAAGGTATTTACTGG + Intronic
943217136 2:185052296-185052318 CCAATCTAACAGGTATAAAGTGG + Intergenic
943625306 2:190191653-190191675 CCATTCTAACAGCTACATAGTGG + Intronic
945372715 2:209039539-209039561 CCATTCTAACAGTTATGTAGTGG + Intergenic
946671810 2:222113051-222113073 CCATTCTAGTAGGTATGTAGTGG + Intergenic
946802946 2:223440080-223440102 CCATTCTAGCAGGCATGTACTGG + Intergenic
946865316 2:224037257-224037279 CCATTCTACCAGGAGAATAGAGG - Intronic
947272629 2:228353820-228353842 CCATTCTATTAGGTGTGTATTGG + Intergenic
1170162361 20:13326548-13326570 CCATTCTAATAGGTATATAGTGG + Intergenic
1170689433 20:18599709-18599731 CCATTCTAATAGGTATGTAGAGG + Intronic
1172802628 20:37588239-37588261 CCATCCTACTAGGTATAAAGTGG - Intergenic
1173721977 20:45267483-45267505 CAATTTTACCATGTATGTATGGG - Intergenic
1175043596 20:56079989-56080011 CCATTCTACTAGGTATGCAGTGG + Intergenic
1177258533 21:18697494-18697516 CCATTCTACTAGGTGTGTAATGG - Intergenic
1177321548 21:19527709-19527731 CCATTCTAATAGGTACATAATGG + Intergenic
1177742250 21:25168325-25168347 CCATTCTACATGGGATAAATTGG - Intergenic
1182179090 22:28325793-28325815 CTATTCTAATAGGTATATAGTGG - Intronic
1182673822 22:32021204-32021226 CCATTCTAATAGGTGTATAGTGG - Intergenic
1182674743 22:32030124-32030146 CAATTCTTCCAGGAATATAAAGG + Intergenic
1183572534 22:38664601-38664623 CCATTCTGGCAGGTATGTAATGG - Intronic
1184796364 22:46735709-46735731 CCATTCCCCCAGGTGTATCTGGG - Intronic
949196028 3:1308822-1308844 CCATTCTTACAGGTGTATAGTGG + Intronic
950295110 3:11823063-11823085 CCATTGTAGCAGGTATAGAATGG + Intronic
951364731 3:21767599-21767621 TCTATATACCAGGTATATATTGG - Intronic
951818007 3:26776871-26776893 CCATTCTGACAGGTATAAAATGG - Intergenic
952434006 3:33254311-33254333 CCATTCTAATAGGTATATAGTGG - Intergenic
952443067 3:33353084-33353106 CCATTCTAATAGGTATACAGTGG - Intronic
952473313 3:33679684-33679706 CCATTTTAACAGGTATTTAGTGG - Intronic
952830746 3:37562666-37562688 CCATTTTGGCAGTTATATATTGG + Intronic
953296671 3:41724800-41724822 CCATTCTAGTGGGTATATGTTGG + Intronic
953422938 3:42769283-42769305 CCATTCTAATAGGTATGTAATGG - Intronic
953894209 3:46782955-46782977 CCATTCTAATAGGTGTATAGTGG - Intronic
954694692 3:52416072-52416094 CCATTCTACTGGGTGTGTATTGG + Intronic
955884694 3:63585160-63585182 AAATTCTAACAGTTATATATTGG + Intronic
956046233 3:65199070-65199092 CCATTCTTCCAGGAATAAAATGG + Intergenic
958146095 3:89627447-89627469 CCATCCTACCAGGAATGAATGGG - Intergenic
958702586 3:97613585-97613607 ACATTCTTCCAGATATATATCGG + Intronic
958821803 3:98983333-98983355 CAATGCTACCAGATGTATATTGG + Intergenic
959564410 3:107819687-107819709 CCATTCTAACAGGGACATAGTGG - Intergenic
959777695 3:110188299-110188321 CCATTCCAACAGGGATAAATTGG + Intergenic
960860855 3:122152063-122152085 CATTACTTCCAGGTATATATAGG - Intergenic
962872003 3:139505369-139505391 CCATTCTAACAAGTATTTAGTGG + Intergenic
963211288 3:142694382-142694404 CCATTCTAGCAGGTACAAACTGG - Intronic
963731476 3:148977804-148977826 CCATTCTAATAGGTATATAGTGG + Intergenic
963821855 3:149905712-149905734 CCATTCTTCAAGCTATATATAGG - Intronic
964021284 3:152014886-152014908 CCAATCTAACAGGTATCTAATGG + Intergenic
964583058 3:158261298-158261320 ACATTCTAATAGGTATATAGTGG + Intronic
964807315 3:160625205-160625227 CCATTCTAATAGGTATGTAGTGG + Intergenic
965181632 3:165411403-165411425 CCATTCTAGTAGGTAGATAATGG - Intergenic
965471585 3:169099443-169099465 GCATTCTATCATGTATAAATTGG + Intronic
965526420 3:169724000-169724022 CCATTCTAATAGGTATATAGTGG - Intergenic
965555066 3:170010429-170010451 CCATTCTAATAGGTATGTAGTGG - Intergenic
966545516 3:181142395-181142417 CCATCCCACCAGGAATATAGGGG - Intergenic
966969879 3:185033817-185033839 CCATTCTAATAGGTATGTAATGG + Intronic
967393851 3:188984284-188984306 CCATTCCACTGGATATATATTGG + Intronic
967476823 3:189931247-189931269 CCATTTTAACAGGTATGTAGTGG + Intergenic
967849984 3:194074802-194074824 CCATTCTAGCAGGTATGTAGGGG - Intergenic
968108464 3:196021671-196021693 CCATTCTAACAGGTGTGTAGTGG - Intergenic
969708393 4:8828359-8828381 TCATTCTACTAGGTGTATAATGG - Intergenic
970632564 4:17966741-17966763 CCATTCTAACAGGTATATAGTGG - Intronic
971663501 4:29451741-29451763 CCATTCTACTAGGTATGAAGTGG - Intergenic
973212232 4:47629149-47629171 CATTTCTACCAAGAATATATAGG + Intronic
974285809 4:59865572-59865594 CCATTCTCCCAGGTAACTACAGG - Intergenic
974475066 4:62368165-62368187 CCATTCTAACAGATGTATAGTGG - Intergenic
976249177 4:83033140-83033162 CCTTCCTACCAGAAATATATAGG - Intergenic
977933450 4:102774364-102774386 CCATTCTAATAGGTATGTAGTGG - Intergenic
978129447 4:105177581-105177603 CCATTCTAACAGGTATGTAGCGG - Intronic
980001348 4:127492652-127492674 CCATTCTAGTAGGTATATAGTGG - Intergenic
980609097 4:135133399-135133421 CCATTCTTATAGGTATGTATTGG + Intergenic
982965189 4:161898520-161898542 CCTTTCTACTAGGTATGTTTTGG + Intronic
983448803 4:167885675-167885697 TCATTCTAATATGTATATATTGG + Intergenic
983843741 4:172489731-172489753 CTATTCAACCAGGAATATGTTGG + Intronic
985086359 4:186317072-186317094 CCATTCTAATAGGTATGTAGTGG - Intergenic
987012240 5:13779423-13779445 TCATCCTAGCAGGTATCTATGGG + Intronic
989621575 5:43389662-43389684 CCAGTTTACTAAGTATATATAGG - Intronic
989821008 5:45795922-45795944 CCATTCTGACAGGTATATAGAGG + Intergenic
991539472 5:67710776-67710798 CCATTCTAATAGGTATGTACTGG - Intergenic
992697761 5:79307437-79307459 CCATTCTGACAGGTGTATAGTGG + Intronic
993467082 5:88262216-88262238 CCATTCTAATAGGTGTATAATGG - Intronic
994569455 5:101496727-101496749 CCATTCTAATAGGTATGTAGCGG - Intergenic
996360788 5:122643548-122643570 CCATTCTAATAGGTACATAGTGG - Intergenic
996790442 5:127288546-127288568 CCATTCTAGTAAGTATATAGTGG - Intergenic
997260020 5:132458753-132458775 CCATTCTGGCAGGTATGTAGTGG + Intronic
997857624 5:137387112-137387134 CCATTCTAATAGGTGTGTATGGG - Intronic
998962224 5:147500769-147500791 CCATTCTACTAGGTGTGTAGTGG - Intronic
999509362 5:152232202-152232224 CCATTCTAATAGGTATGTAGTGG + Intergenic
1000236223 5:159363371-159363393 CCATTCTAATAGGTATGTAGTGG + Intergenic
1000580438 5:163029219-163029241 CCATCCTAATAGGTATATACTGG + Intergenic
1001150571 5:169224148-169224170 CCATTCTACCAGTTAAAAAAAGG - Intronic
1001538569 5:172519894-172519916 CCATTCTATTAGGTATGTAGTGG - Intergenic
1001765672 5:174244689-174244711 CCATTCTAATAGGTATGTAGAGG + Intergenic
1002734117 5:181370148-181370170 CCATTCTAACAGGTATGAAGTGG + Intergenic
1002750424 6:103978-104000 CCATTCTAACAGGTATGAAGTGG - Intergenic
1003706831 6:8541800-8541822 CTATTCTACCAGGTATGTTTTGG - Intergenic
1003854393 6:10258323-10258345 CCATTCTAATAGATATATAGTGG - Intergenic
1005530433 6:26699170-26699192 CCATTCTACCACGTTTATGGAGG + Intergenic
1005540363 6:26802476-26802498 CCATTCTACCACGTTTATGGAGG - Intergenic
1005869093 6:29960109-29960131 CCATTCTAAAAGGAATAAATGGG - Intergenic
1007734841 6:43974600-43974622 CTATTCTAACAGGTATGTAGAGG + Intergenic
1007968005 6:46021230-46021252 CCATTCTAATAGGTATATTGTGG - Intronic
1008363109 6:50644710-50644732 CCATTCTAACAGGTGTAAAATGG + Intergenic
1009011178 6:57844574-57844596 CCATTCTACCACGTTTATGGAGG - Intergenic
1009443018 6:63704964-63704986 CCATTCTAATAGGTGTATAGTGG + Intronic
1010023091 6:71184091-71184113 CAATTCTACCAGATGTATAAAGG + Intergenic
1010112795 6:72260756-72260778 ACATACTACCAGGTAAATACAGG + Exonic
1010952321 6:82051339-82051361 TCAGTTTACCATGTATATATAGG + Intergenic
1011198274 6:84805173-84805195 CTATGCTACATGGTATATATGGG + Intergenic
1011254922 6:85410279-85410301 CCATTCTAATAGGTGTATAGTGG + Intergenic
1013568918 6:111400419-111400441 TCATTCTAATAGGTATATAGTGG + Intronic
1013804596 6:113983342-113983364 CCATTTTAACAGGTGTATAGTGG - Intronic
1016115596 6:140281334-140281356 CCATTCTACCAGGTGTGTAGTGG - Intergenic
1016203110 6:141437345-141437367 CCATTCTAATAGATATATAATGG + Intergenic
1016293342 6:142547966-142547988 CCATACTACCGGGGACATATAGG + Intergenic
1016405638 6:143726740-143726762 CCATTCTAGTAGGTATGTAGTGG + Intronic
1017231102 6:152074778-152074800 CCATTCTAACAGGTGTATTGTGG + Intronic
1017661314 6:156676859-156676881 CCATTTTAATAGGTATATAGTGG - Intergenic
1019238365 6:170642462-170642484 CCATTCTAACAGGTATGAAGTGG + Intergenic
1019377897 7:705351-705373 CCATTCTAATAGGTATATGGTGG - Intronic
1019874494 7:3797281-3797303 CCTTTTTAAAAGGTATATATGGG - Intronic
1020591179 7:10139341-10139363 TCATTCTGCCAGGTAGATATGGG + Intergenic
1021652886 7:22848670-22848692 CCATTCTAGAAGGTATGTAGTGG + Intergenic
1021705712 7:23365599-23365621 CCATTCTACCAGGCCTAACTTGG - Intronic
1022116556 7:27266075-27266097 CCATTCTAGTAGGTATATAGTGG + Intergenic
1023603392 7:41903631-41903653 CCATTCTAATAGGTTTATAGTGG - Intergenic
1024850532 7:53710276-53710298 CCATTCCAATAGGTATATAGTGG + Intergenic
1027993234 7:85391159-85391181 CCATTCTACCAAGTCTATAGTGG + Intergenic
1028317338 7:89419898-89419920 CCATTGTACAAGGATTATATAGG - Intergenic
1028438181 7:90829455-90829477 CCATTCTAACAGGGAGAAATTGG + Intronic
1028816385 7:95150964-95150986 CTATTGTAACAGGTATATAGTGG - Intronic
1029060593 7:97793778-97793800 CCATTCTAATAGGTATATAGTGG + Intergenic
1031488434 7:122358164-122358186 CCATTCTAACAAGTACATAGTGG + Intronic
1031900177 7:127400398-127400420 CCATTCTGCTGGGTATATAGTGG - Intronic
1033815868 7:145071913-145071935 CCATTCTCCCAGCAATTTATAGG - Intergenic
1035509404 8:164145-164167 CCATTCTAACAGGTATGAAGTGG - Intergenic
1037255952 8:16953893-16953915 CCATTCTGATAGGTATGTATTGG - Intergenic
1037854272 8:22359523-22359545 CTATTCTACCAGGTATGGAATGG - Intergenic
1041502077 8:58550090-58550112 CCATTCTAATAGGTGTATAGTGG + Intergenic
1041879291 8:62729323-62729345 CCATTCTAATAGGTATGTAGTGG - Intronic
1042157475 8:65860978-65861000 CCACTCTAACAGGTATGTAATGG + Intergenic
1042184240 8:66121180-66121202 CCAGTCTCCCAGGTATGTCTGGG - Intergenic
1042292995 8:67189072-67189094 CCATTCTAGCAGGTATGTGGTGG - Intronic
1043611613 8:82070143-82070165 CTATTCTAATAGGTATATAGTGG + Intergenic
1043698213 8:83249264-83249286 CCATTCTAACAGGTGTGTAGTGG - Intergenic
1043762590 8:84086837-84086859 CCATTCTACTAGGGGTATACAGG - Intergenic
1043913677 8:85895103-85895125 CCATTCTGCAATGTATACATAGG - Intergenic
1044096127 8:88068100-88068122 CCATTCTATCAGGTGTGTAGTGG + Intronic
1044126226 8:88460835-88460857 CCATTGTAACAGGTATATAATGG + Intergenic
1045220658 8:100196410-100196432 CCATTCTATTAGGTGTATAGTGG + Intronic
1046391198 8:113574967-113574989 CCATTCTAATAGGTATGTAGTGG + Intergenic
1046883941 8:119341693-119341715 CCATTCTAAAAAGTATATAGTGG - Intergenic
1047050668 8:121108402-121108424 CCATTCTAATAGGTGTGTATTGG - Intergenic
1048052722 8:130834110-130834132 CCATTCTACCACATATACATAGG + Intronic
1050110032 9:2205839-2205861 CCATTCTAGTAGGTATGTAGTGG - Intergenic
1050977440 9:11958642-11958664 CTATTCTAATATGTATATATAGG + Intergenic
1051191713 9:14519670-14519692 CCATTTTGCCAGGCATATATTGG - Intergenic
1052062341 9:23975697-23975719 CCATTCTAGCAGGTCTATGGCGG - Intergenic
1052456173 9:28700839-28700861 CCATTCTAATAGGTATGTAGTGG + Intergenic
1054203658 9:62110442-62110464 CCATTCTACCTAATATATAATGG - Intergenic
1054866073 9:70002861-70002883 CCACTCTACTAGGTATATAGTGG + Intergenic
1055092131 9:72373730-72373752 CCATTCTAATAGGTACATAGTGG - Intergenic
1055474492 9:76648124-76648146 CCATTCTAATAGGTATGTAGTGG - Intronic
1055896208 9:81178884-81178906 CCATCCTAATATGTATATATAGG + Intergenic
1057286489 9:93759441-93759463 TCATTCTACAAAGTATATAGTGG - Intergenic
1057286800 9:93763164-93763186 CCATTCTAATAGATATATAGTGG - Intergenic
1058068189 9:100572847-100572869 CCAGTCTTACAGGTATATCTGGG + Intronic
1058433938 9:104944701-104944723 CCATCCTAATAGATATATATTGG + Intergenic
1060166731 9:121423292-121423314 CCATTCTACTAGGTGTGTAGTGG - Intergenic
1060169459 9:121449485-121449507 CCATTCTAGTAGGTATTTAGTGG + Intergenic
1060633191 9:125178339-125178361 CCATTCTAATAGGTATATAGTGG + Intronic
1062758569 9:138322754-138322776 CCATTCTAACAGGTATGAAGTGG + Intergenic
1203491529 Un_GL000224v1:110254-110276 CCATTCTACTAGGTATGTAGCGG + Intergenic
1203504153 Un_KI270741v1:52125-52147 CCATTCTACTAGGTATGTAGCGG + Intergenic
1188149920 X:26660440-26660462 CCATTCTAATAGGTATGTACTGG - Intergenic
1188151637 X:26683414-26683436 ACATTCTATCAGGCATATAAAGG - Intergenic
1188471341 X:30543426-30543448 CCATTCTAATAGGTATGTAGTGG - Intergenic
1188796044 X:34466685-34466707 CATTTCTAGCAGGTATATTTTGG + Intergenic
1188897254 X:35684832-35684854 CCATTCTAATAGGTGTATAGTGG - Intergenic
1189058352 X:37724954-37724976 CCATTCCAATAGGTATATAGTGG - Intronic
1189638343 X:43037652-43037674 CCATAATCCCAGGAATATATTGG + Intergenic
1189717881 X:43883533-43883555 CCTTTCTAGCAGGTAGATACAGG - Intergenic
1189937525 X:46085326-46085348 CCATTCTAATTGGTATATAATGG + Intergenic
1189976697 X:46467640-46467662 CCTTTCTAGTAGGTATATAGGGG + Intronic
1190402357 X:50050402-50050424 CCATTCTAATAGGTATGTAGTGG + Intronic
1192328581 X:70155048-70155070 CCATTCTATCAGGTGTATAGTGG - Intronic
1193074763 X:77344117-77344139 CCACTCTACCTGGGATATCTGGG - Intergenic
1193505717 X:82341020-82341042 CAATACTACCATGGATATATGGG - Intergenic
1193891566 X:87051860-87051882 CCATTCTAATAGGTATAGAGCGG + Intergenic
1193968785 X:88024268-88024290 CCGTTCTAATAGGTATATAGTGG - Intergenic
1194124592 X:89999671-89999693 CCATTCTAATAGGTGTATAGTGG + Intergenic
1195371355 X:104177650-104177672 CCATCCTACTGGGTATAAATTGG + Intronic
1196094396 X:111783459-111783481 TCATTCTAACAGGTATGTAGTGG + Intronic
1197125188 X:122937721-122937743 CCATTCTAGTAGGTGTGTATTGG - Intergenic
1198174410 X:134141371-134141393 CCTTTCTCCCAGGTATAGAGAGG - Intergenic
1199178493 X:144822508-144822530 GTAGTCTACCAGGTCTATATAGG + Intergenic
1200477487 Y:3657281-3657303 CCATTCTAATAGGTGTATAGTGG + Intergenic