ID: 1149397701

View in Genome Browser
Species Human (GRCh38)
Location 17:56261764-56261786
Sequence GTGCCCACCCGGACTGAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1981
Summary {0: 1, 1: 5, 2: 135, 3: 630, 4: 1210}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149397698_1149397701 0 Left 1149397698 17:56261741-56261763 CCATGCTGGCAGCTGATTAGATG 0: 252
1: 472
2: 594
3: 535
4: 521
Right 1149397701 17:56261764-56261786 GTGCCCACCCGGACTGAGAGTGG 0: 1
1: 5
2: 135
3: 630
4: 1210
1149397696_1149397701 16 Left 1149397696 17:56261725-56261747 CCTGCTTTTATTGTAGCCATGCT 0: 1
1: 18
2: 164
3: 276
4: 531
Right 1149397701 17:56261764-56261786 GTGCCCACCCGGACTGAGAGTGG 0: 1
1: 5
2: 135
3: 630
4: 1210
1149397695_1149397701 29 Left 1149397695 17:56261712-56261734 CCACGTTCTTCTGCCTGCTTTTA 0: 52
1: 211
2: 347
3: 494
4: 767
Right 1149397701 17:56261764-56261786 GTGCCCACCCGGACTGAGAGTGG 0: 1
1: 5
2: 135
3: 630
4: 1210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149397701 Original CRISPR GTGCCCACCCGGACTGAGAG TGG Intronic
900719828 1:4168346-4168368 GTGCCAACCCAGACTGAGGGTGG + Intergenic
900721598 1:4179634-4179656 GTGCCCACCCAGATTGAGGGTGG + Intergenic
900730107 1:4252631-4252653 GTGCCCACCCAGATTGAGGGTGG - Intergenic
900805007 1:4761875-4761897 GTGCCCACCCAGACTGAGGATGG + Intronic
900812459 1:4817349-4817371 GTGTCCACCCAGATTGAGGGTGG - Intergenic
900814795 1:4835290-4835312 GTGCCCACCCAGACTGAGGGTGG + Intergenic
900819887 1:4878526-4878548 GTGCCCACCCAGATTGAGAGTGG - Intergenic
901104218 1:6743015-6743037 GTGCCCACCCAGATTAAGGGTGG + Intergenic
901183567 1:7357881-7357903 GTCCCCACCTGGAATGAGATAGG + Intronic
901478746 1:9509312-9509334 GTGCTCACCCAGATTGAGGGTGG - Intergenic
901778351 1:11576066-11576088 GTGCCCACCCAGATTAAGGGTGG + Intergenic
901920480 1:12532753-12532775 GTGCCCACCCAGATTGAGGGTGG + Intergenic
902195456 1:14794835-14794857 GTGCCCACACAGATTGAGGGTGG - Intronic
902568359 1:17330739-17330761 GTGCCCACCCATACTGAGGGTGG + Intronic
902868588 1:19298067-19298089 GTGCCCACCCAGATTGAGGGTGG - Intergenic
903553678 1:24177583-24177605 GTGCCCACCCACACTGAGTGAGG + Intronic
905383037 1:37577786-37577808 GTGCCCACCCTGAATGAGGGAGG - Intronic
905536136 1:38723304-38723326 GTGCCCACCCAGATTGAGGGTGG + Intergenic
905873087 1:41416126-41416148 GGGCCCACCAGGGCTGAGTGGGG + Intergenic
905903169 1:41595691-41595713 GTGCCCACCCAGATTGAGGGTGG - Intronic
906050804 1:42869927-42869949 GTGCCCACCCAGATTAAGGGTGG - Intergenic
906397083 1:45475729-45475751 GTGCCCACCCAGATTGAGGGTGG - Intronic
906578524 1:46913832-46913854 CTGCCCACCCAGATTGAGAATGG + Intergenic
906773009 1:48501971-48501993 GTGCCCACCCAGATTAAGGGTGG + Intergenic
906773512 1:48507045-48507067 GTGCCCACCCACACTGAGAAGGG - Intergenic
906889410 1:49691728-49691750 GTGCCCACCCAGATTAAGGGTGG - Intronic
906908567 1:49921842-49921864 GTGCCCACCCACAGTGAGGGTGG + Intronic
907147473 1:52248425-52248447 GTGCCCACCCCCATTGAGAGTGG + Intronic
907402036 1:54230176-54230198 GTGCCCACCCAGACTGGGGGAGG + Intronic
907571934 1:55491765-55491787 CTGCCCACCCGGATTGAGGGTGG + Intergenic
907611018 1:55871230-55871252 GTACCCACCCAGACTGAGGGTGG - Intergenic
908038994 1:60086995-60087017 GTGCCCACCCAGATTGAGGGTGG - Intergenic
908052640 1:60249210-60249232 GTGCCCACCCAGAGTGAGGGTGG - Intergenic
908346370 1:63237684-63237706 GTGCCCACCCAGACTGAGGGTGG - Intergenic
908907603 1:69034680-69034702 GTGCCCACCCAGATTAAGGGTGG - Intergenic
909032574 1:70559786-70559808 GTGCCCACCCAGATTGAGGCTGG + Intergenic
909176703 1:72370827-72370849 GTGCCCATCCAGATTGAGGGTGG - Intergenic
909190139 1:72540481-72540503 GTGCCCACCCACATTGAGGGTGG + Intergenic
909427185 1:75539059-75539081 GTGTCCACCAGGACAGAGACAGG - Intronic
909576466 1:77182391-77182413 GTGCCCACCCAGATTAAGGGTGG + Intronic
910370973 1:86514644-86514666 GTGCCCACCCAGATTTAGGGTGG - Intergenic
910561401 1:88595959-88595981 GTGCCCACCCAGATTAAGGGTGG - Intergenic
910723104 1:90309416-90309438 TTGCCCACCCCCACTGAGCGTGG + Intergenic
910791492 1:91055638-91055660 GTGCCCACCCAGATTGAGGGTGG + Intergenic
910796451 1:91102388-91102410 GTGCCCACCCAGATTGAAGGTGG + Intergenic
911291848 1:96065963-96065985 GTGCCCACCCAGAGTAAGAGTGG - Intergenic
911339484 1:96619330-96619352 GTGCCCACCCAGACTGAGGGTGG + Intergenic
911343456 1:96668431-96668453 GTGCCTACCCAGATTGAGCGTGG - Intergenic
911403671 1:97408728-97408750 GTGCCTACCCAGATTGAGGGTGG - Intronic
911559965 1:99393136-99393158 GTGCCCACCCAGATTAAGGGTGG - Intergenic
911667272 1:100567706-100567728 GTGCCCACCCAGATTAAGGGTGG - Intergenic
911696118 1:100892224-100892246 GTGCCCACCCACATTGTGAGTGG - Intronic
911743807 1:101417103-101417125 GTGCCCACCCAGATTGAGGGTGG + Intergenic
911763482 1:101643970-101643992 GTGCCCACCCAGATTGAGAGTGG - Intergenic
911889669 1:103352079-103352101 GAGCCCACGCTGACTGAGGGTGG + Intergenic
912051097 1:105528521-105528543 GTGCCCACCCAGATTAAGGGTGG + Intergenic
912071133 1:105811074-105811096 GTGCCCACCCAGATTAAGGGTGG + Intergenic
912119804 1:106456131-106456153 GTGCCCACCCAGAGTGAGGGTGG + Intergenic
912130311 1:106591418-106591440 GTGCCCACCCAGATTTAGTGTGG + Intergenic
912248576 1:107987764-107987786 GTGTCCACCCAGATTGAGGGTGG + Intergenic
912251715 1:108018976-108018998 GTGCCTACCCAGATTAAGAGTGG + Intergenic
912438619 1:109680759-109680781 GTATCCACCCTGACTGAGAAGGG - Intronic
912441140 1:109699204-109699226 GTATCCACCCTGACTGAGAAGGG - Intronic
913039083 1:115005587-115005609 GTACCCAACCAGACTGAGGGTGG + Intergenic
913481392 1:119292814-119292836 GTGCCCACCCAGATTAAGGGTGG - Intergenic
915396582 1:155589810-155589832 GTGTCCACCCACACTGAGGGTGG + Intergenic
915412382 1:155712014-155712036 GTGTCCACCCACACTGAGGGTGG + Intronic
915793194 1:158697700-158697722 GTGCCCACCCAGATTGAGGGTGG + Intergenic
915880269 1:159663337-159663359 GTGACCACCCAGATTGAGGGTGG + Intergenic
916404900 1:164488698-164488720 GTGCCCATCCAGATTGAGGGTGG + Intergenic
916919571 1:169449794-169449816 GTGCCCACCCAGATTGAGTGTGG + Intronic
917038039 1:170771015-170771037 GTGCCCACCCAGATTAAGGGTGG + Intergenic
917288485 1:173446601-173446623 GTGCCCACCCAGATTGAGGGGGG - Intergenic
917542358 1:175926691-175926713 GTGCCCACTCAGATTGAGGGTGG + Intergenic
917682118 1:177377880-177377902 GTGCCCACCCAGATTGAGGGTGG - Intergenic
918236302 1:182583596-182583618 GTGCCCACCGTGACTGAATGTGG - Intronic
918253299 1:182724106-182724128 GTGCCCACCCAGATTGAGGGTGG - Intergenic
918407032 1:184221726-184221748 GTGCCCACCCACATTGAGGGTGG - Intergenic
918613486 1:186517909-186517931 GTGCCCACCCAGATTGAGGGTGG + Intergenic
918706543 1:187669536-187669558 GTGCCCATCCAGATTGAGGGTGG + Intergenic
918711987 1:187742546-187742568 GTGCTCACCCAGATTGAGGGTGG - Intergenic
918768779 1:188524402-188524424 GTGCCCACCCAGATTAAGGGTGG - Intergenic
918796559 1:188905585-188905607 GTGCCCACCCAGATTGAGGGTGG - Intergenic
918815401 1:189174062-189174084 CTGCCCACCTAGACTGAGGGTGG - Intergenic
918847514 1:189637419-189637441 GTGCCCACCCGGATTGAGGGTGG - Intergenic
918887226 1:190210814-190210836 GTGCCCACCCAGATTGAGGGTGG - Intronic
918895438 1:190337425-190337447 GTGCCCACCCAAATTGAGGGTGG - Intronic
918924031 1:190756726-190756748 GTGCCCACCCTGACTGAGAATGG - Intergenic
919125117 1:193383796-193383818 GTGCTCACCCAGATTGAGGGTGG + Intergenic
919134646 1:193492552-193492574 GTGCCCACCCAGACTAAGGGTGG - Intergenic
919193144 1:194249001-194249023 GTGCCCACCCAGATTAAGGGTGG - Intergenic
919230457 1:194766131-194766153 GTGCCCACCCAGATTAAGGGTGG + Intergenic
919318275 1:196001865-196001887 GGGCCCAACCAGATTGAGAGTGG - Intergenic
919398793 1:197082783-197082805 GTGCCCACCCACATTGAGGGTGG - Intergenic
919559517 1:199099314-199099336 GTGTCCACCCAGATTAAGAGTGG - Intergenic
920138265 1:203788321-203788343 GTGCCCACCCAGATTAAGGGTGG + Intergenic
921039763 1:211418534-211418556 GCGCCCACCCAGATTAAGAGTGG - Intergenic
921132597 1:212232583-212232605 GTGCCAACCCAGACTGAGGGTGG + Intergenic
921579143 1:216874758-216874780 GTGCCCACTCAGATTGAGGGTGG - Intronic
921940056 1:220829902-220829924 GTGCCCGCCCAGATTGAGGGTGG + Intergenic
921954900 1:220972096-220972118 GTGCCCACCCAGATTAAGGGTGG + Intergenic
922019074 1:221685575-221685597 GTGCCCTCCCAGATTGAGGGTGG + Intergenic
922057027 1:222051136-222051158 GTGCCCACCCAGATGGAGGGTGG - Intergenic
922156925 1:223047816-223047838 GTGCCCACCCTCACTGAGGGTGG + Intergenic
922225814 1:223645284-223645306 GTGCCCACCCAGATTGAGGGTGG + Intronic
922494590 1:226046692-226046714 GTGCCCACCCACATTGAGAGTGG + Intergenic
922581271 1:226700079-226700101 GTGCCCACCCAGATTAAGGGTGG + Intronic
922592063 1:226784825-226784847 GGGCCCACATGGTCTGAGAGGGG + Intergenic
922651418 1:227342263-227342285 GGGCCCACCCAGATTGAGGGTGG + Intergenic
922722148 1:227904640-227904662 CTGCCCACCCGGCCGGACAGGGG - Intergenic
922916788 1:229264361-229264383 GGGCCCACCCAGATTGAGGGTGG - Intergenic
923416979 1:233772380-233772402 ATGCCCACCCAGATTGAGGGTGG + Intergenic
923800004 1:237199556-237199578 GTGCCCACCCGGATTGAGGATGG + Intronic
923825421 1:237494472-237494494 GTGCCCACCCAGATTGAGGATGG + Intronic
923839583 1:237653956-237653978 GTGCCCACCCAGATTGAGAATGG + Intronic
923907381 1:238400301-238400323 GTGCTCACCCGCACTGAGGGTGG + Intergenic
924135054 1:240957115-240957137 GTGCCCACCCAGATTGAGGGTGG - Intronic
924306920 1:242698899-242698921 GTGCCCACCCAGATTGAGGGTGG + Intergenic
924365535 1:243289341-243289363 GTGCCCACCCAGATTAAGGGTGG + Intronic
924397715 1:243640982-243641004 GTGCCCACCCGGCTTAAGGGTGG - Intronic
924692893 1:246368694-246368716 GTGCCCACCCAGGTTGAGGGGGG - Intronic
924693761 1:246378380-246378402 GTGCCCACCCAGATTAAGGGTGG - Intronic
924934547 1:248756960-248756982 GTGCCCACCCAGACTGAGGGTGG + Intergenic
1063039755 10:2325169-2325191 GTGCCCACCCAGACTGAGGGTGG - Intergenic
1063149239 10:3321726-3321748 GTGCCCACCCAGACTGAGGGTGG - Intergenic
1063175307 10:3545247-3545269 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1063199675 10:3776021-3776043 CTGCCCTCCTTGACTGAGAGTGG + Exonic
1063242243 10:4182967-4182989 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1063262885 10:4410155-4410177 GTGCCCACCCAGACTGAGGGTGG - Intergenic
1063303989 10:4879574-4879596 GTGCCCACTCAGATTGAGGGGGG + Intergenic
1063457817 10:6196691-6196713 GTGTCCACCCAGACGGAGGGTGG + Intronic
1063525358 10:6779545-6779567 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1063827147 10:9910839-9910861 GTGCCCACCTAGATTGAGGGTGG + Intergenic
1064156821 10:12909461-12909483 GTGCCAACCCGGGCTGAGTGAGG + Intronic
1064177895 10:13091145-13091167 GTGCCCACCCAGATTGAGGGTGG + Intronic
1064220157 10:13433467-13433489 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1064329068 10:14376854-14376876 GTGCCCTCCCGGATTGAAGGTGG - Intronic
1064360849 10:14662925-14662947 GTACCCACCCAGATTGAGGGTGG - Intronic
1064402361 10:15032113-15032135 GTGCTCACCCAGATTGAGGGTGG - Intergenic
1064414715 10:15138991-15139013 GTGCCCACCCAGATTAAGGGTGG - Intronic
1064423165 10:15207588-15207610 GTGACCACCCAGATTAAGAGTGG + Intergenic
1064546095 10:16451254-16451276 GTGCCCACCCAGAATGAAGGTGG + Intronic
1064854849 10:19754569-19754591 GTGCCCACCCAGACTGAGGGTGG - Intronic
1065155845 10:22869430-22869452 GTACCCACCCAGACTGAGAGTGG - Intergenic
1065226838 10:23552234-23552256 GTGCCCACCCAGATGGAGGGTGG - Intergenic
1065281727 10:24145906-24145928 GTGCCCATCCAGATTGAGGGTGG + Intronic
1065387412 10:25147381-25147403 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1065501037 10:26382592-26382614 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1065739115 10:28781000-28781022 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1065762913 10:28999668-28999690 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1065811123 10:29444732-29444754 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1065868007 10:29930350-29930372 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1066167494 10:32802913-32802935 GTGCCCACCCAGATTGAGAGTGG + Intronic
1066169861 10:32829830-32829852 GTGCCCACCCAGATTAAGGGTGG - Intronic
1066227043 10:33393612-33393634 GTGCCTACCCCCGCTGAGAGAGG + Intergenic
1066752131 10:38668790-38668812 GTGCCCACCCACACTGAGGGTGG + Intergenic
1066964901 10:42254263-42254285 GTGCCCACCCACATTGAGGGTGG - Intergenic
1067072640 10:43146435-43146457 GTGCCCAACCAGATTGAGTGTGG + Intronic
1067169423 10:43894313-43894335 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1067277635 10:44849328-44849350 GTGCCCACCCACATTGAGGGTGG - Intergenic
1067406163 10:46025328-46025350 GTGCCCACACACACTGAGGGTGG + Intronic
1067494055 10:46746534-46746556 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1067600607 10:47593870-47593892 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1067823849 10:49555041-49555063 GGGCCCACCCACAGTGAGAGGGG + Intergenic
1068007796 10:51410524-51410546 GTGCCCACCCAGATTAAGGGTGG + Intronic
1068090478 10:52427038-52427060 GTGCCCACCCAGATTGAAGGTGG - Intergenic
1068225822 10:54105606-54105628 GTGCCCACCCAGATTAAGGGTGG + Intronic
1068238043 10:54263868-54263890 GTGCCCACCCAGATTGAGAGTGG - Intronic
1068406434 10:56595566-56595588 GTGCCCACCCAGATTGAAAGTGG + Intergenic
1068425710 10:56860869-56860891 GTGCCCACCTGGATTAAGGGTGG + Intergenic
1068446772 10:57134977-57134999 GTGCCCGCCCAGATTGAGGGTGG - Intergenic
1068594394 10:58887439-58887461 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1068700444 10:60014365-60014387 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1068834209 10:61534353-61534375 GTGCCCACTCAGATTGAGGGTGG + Intergenic
1068956818 10:62825836-62825858 GTGCCCACCCAGATTAAGGGTGG - Intronic
1069119922 10:64556868-64556890 GTGCCTACCCAGATTGAGGGTGG - Intergenic
1069371942 10:67757470-67757492 GTGCCCACCCAGAGTGAGGGTGG - Intergenic
1069740349 10:70683256-70683278 GTGCACACCCTCTCTGAGAGTGG + Intronic
1069788228 10:71003435-71003457 GTGCCCACCCAGACTGGGGGTGG + Intergenic
1069791319 10:71023942-71023964 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1069819645 10:71219531-71219553 GTGCCCACCCAGATTAAGGGTGG + Intronic
1070497279 10:77036009-77036031 GTGCCCATCCAGAGTGAGGGTGG - Intronic
1070737523 10:78874138-78874160 GTGCCCACTCAGATTGAGGGTGG - Intergenic
1071032699 10:81204128-81204150 GTGCCCCCCCAGATTGAGGGTGG - Intergenic
1071033065 10:81207328-81207350 GTGCCCACCAAGATTGAGGGTGG - Intergenic
1071218656 10:83436774-83436796 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1071251919 10:83827379-83827401 GTGCCCACCCACATTGAGGGTGG - Intergenic
1071262426 10:83932888-83932910 GTGCCCACCCAGACTGAGGGTGG - Intergenic
1071266749 10:83971483-83971505 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1071267548 10:83977634-83977656 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1071281302 10:84106493-84106515 GTGCCCACCCAGATTAAGAGTGG + Intergenic
1071308829 10:84324596-84324618 GTGCCCACCCGAATTGAGGGTGG - Intergenic
1071374319 10:84987056-84987078 GTGCCCACTCAGATTGAGGGTGG + Intergenic
1071378698 10:85035871-85035893 GTGCCCACCCAGATTAAGAGTGG - Intergenic
1071652140 10:87401742-87401764 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1071804733 10:89105640-89105662 CTGCCCACCCAGATTGAGCGTGG + Intergenic
1071907986 10:90196193-90196215 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1072360042 10:94650634-94650656 GTGCCCACCCGGATTAAGGGTGG - Intergenic
1073661667 10:105482679-105482701 TTGCCTACCCTGATTGAGAGTGG - Intergenic
1073675642 10:105644292-105644314 GTGCCCACCCACATTGAGGGTGG - Intergenic
1073806641 10:107105715-107105737 ATGCCCACCCAGATTGAGGGTGG + Intronic
1073854650 10:107660593-107660615 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1073951180 10:108811624-108811646 GTGCCCATCCACACTGAGGGTGG + Intergenic
1074133996 10:110611130-110611152 GTGCCCACCCAGATTGAAGGTGG + Intergenic
1074283560 10:112076716-112076738 GTGCCCACCTAGATTGAGGGTGG - Intergenic
1074510327 10:114105737-114105759 GTGCCCACCCAGATTGAAGGTGG - Intergenic
1074531147 10:114299724-114299746 GTGCCCACCCAGACTGAGAGCGG - Intronic
1074666398 10:115731048-115731070 GTGCCCACCCAGAATAAGGGTGG + Intronic
1074872892 10:117591027-117591049 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1074987392 10:118670253-118670275 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1074987596 10:118671436-118671458 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1075141842 10:119844699-119844721 CTGCCCACCCAGACTGAGGGTGG - Intronic
1075165746 10:120066820-120066842 GTGCCTACCCAGATTGAGGGTGG + Intergenic
1075210015 10:120482985-120483007 ATGCCCACCCAGATTGAGGGTGG - Intronic
1075217147 10:120545858-120545880 GTGCCCACCCAGATTGAGGGTGG - Intronic
1075573989 10:123565267-123565289 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1075585951 10:123658389-123658411 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1075607125 10:123819923-123819945 GTGCCCACCCAGATTAAGGGTGG - Intronic
1075722729 10:124596938-124596960 GTGCCCACCCACACGGAGGGTGG - Intronic
1075814475 10:125254283-125254305 GTGCCCACCCAAATTGAGGGTGG + Intergenic
1075872186 10:125779045-125779067 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1075913922 10:126149564-126149586 GTGCCCACCCAGATTGAGGACGG - Intronic
1076131605 10:128017638-128017660 GTGGCCACCGAGGCTGAGAGTGG - Intronic
1076447061 10:130523529-130523551 GTGTCCACCCAGATTGAGGGTGG - Intergenic
1076576802 10:131474906-131474928 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1076725104 10:132409506-132409528 GGGCCCACCGAGCCTGAGAGGGG + Intronic
1077782686 11:5348706-5348728 GTACCCACCCAGACGGAGGGTGG + Intronic
1077832236 11:5885917-5885939 GTGCCCACCCAGATTGAAGGTGG - Intronic
1078030922 11:7750158-7750180 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1078268335 11:9771784-9771806 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1078460040 11:11507789-11507811 GGGCCCACCCGGATTGAGGGTGG - Intronic
1078582015 11:12546111-12546133 GTGCCCACACACACTGAGGGTGG - Intergenic
1078696968 11:13644102-13644124 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1078734484 11:14007534-14007556 GTGCCCACCCAGATTAAGGGTGG + Intronic
1078782332 11:14451155-14451177 GTGCCCACCCAGATTAAGAGTGG - Intronic
1079172880 11:18112905-18112927 GTGCCCAGCCTGGCTGAGTGGGG - Intronic
1079182790 11:18208675-18208697 GTGCCCACCCAGATTGAGGGTGG - Intronic
1079210204 11:18454556-18454578 GTGCTCACCCGGATAGAGGGTGG + Intergenic
1079210818 11:18459191-18459213 GTGCTCACCCAGATTGAGGGTGG - Intronic
1079473484 11:20803809-20803831 GTGCCCACCCAGATTAAGGGTGG - Intronic
1079506459 11:21157996-21158018 GTGCCCACCCAGACTGAAGATGG - Intronic
1079537145 11:21527907-21527929 GTGCTCACCCAGATTGAGGGTGG + Intronic
1079581036 11:22065264-22065286 TTGCCCACCCTGATTGAGGGTGG - Intergenic
1079670383 11:23162688-23162710 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1079739353 11:24037488-24037510 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1079748210 11:24160153-24160175 GTGCCCACCCACATTGAGGGTGG - Intergenic
1079793903 11:24774073-24774095 GTGCCCACCCAGATTAAGGGTGG - Intronic
1079823750 11:25164440-25164462 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1079848022 11:25494825-25494847 GTGCCCACCCAGACTGAGGGTGG + Intergenic
1079861925 11:25683799-25683821 GTGCCCACCCACACTGGGTGAGG - Intergenic
1079948656 11:26774082-26774104 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1079990925 11:27246154-27246176 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1080098911 11:28436906-28436928 GTGCCCACCCAGATTGAGGATGG - Intergenic
1080408001 11:31997057-31997079 GTGCCCACCCGGACTGAGGGTGG + Intronic
1081057659 11:38430819-38430841 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1081106358 11:39074905-39074927 ATGCCCACCCACACTGAGAGTGG - Intergenic
1081107090 11:39083868-39083890 GTGCCTACCCAGACTAAGGGTGG + Intergenic
1081299524 11:41433542-41433564 GTGCCCACCCAGATTCAGGGTGG - Intronic
1081433094 11:42997995-42998017 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1081451922 11:43179401-43179423 GTGCCCACCCAGATTAAGTGTGG + Intergenic
1081776006 11:45676317-45676339 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1081812565 11:45922159-45922181 CGGGCCACCTGGACTGAGAGTGG + Intronic
1082213865 11:49542694-49542716 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1082918855 11:58469806-58469828 GTGCCTACCCAGATTGAGGGTGG + Intergenic
1082919691 11:58479691-58479713 ATGCCCACCCAGACTGAGGGTGG + Intergenic
1083529980 11:63411287-63411309 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1083570508 11:63759142-63759164 GTTCCCCCCCAGACTGAGATAGG - Exonic
1084503074 11:69546336-69546358 GTGCCGACCCTGGCTGAGGGAGG + Intergenic
1084598067 11:70128962-70128984 GTGACCACCTGGACTGAGGATGG - Intronic
1084727873 11:70953677-70953699 GTGCCCACCCATATTGAGGGTGG + Intronic
1084755838 11:71238028-71238050 ATGCACACACGGACTGAGGGTGG + Intronic
1085064828 11:73484984-73485006 GTGCCCACCCAGATTAAGGGTGG + Intronic
1085236343 11:75018398-75018420 GTGCCCACCCAGATTAAGAGTGG - Intronic
1085247592 11:75116196-75116218 GTGCCCACCCACATTGAGGGTGG - Intronic
1085619267 11:78025397-78025419 GTGCCCACCCAGATTAAGGGTGG + Intronic
1085620874 11:78037230-78037252 GTGCCCACGAGGTCTGAGAGTGG - Intronic
1085685490 11:78618611-78618633 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1085748646 11:79138050-79138072 GTGCCCACCCAGATTAAGTGTGG - Intronic
1085986787 11:81797370-81797392 GTGCCCACCCAGACTGAAGATGG + Intergenic
1086053774 11:82624630-82624652 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1086054886 11:82634984-82635006 GTGCCCACTCAGATTGAGGGTGG - Intergenic
1086246701 11:84761490-84761512 GTGCCCACCTAGAATGAGGGTGG - Intronic
1086635739 11:89081797-89081819 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1086834425 11:91602879-91602901 GTGCCCACCCAGATTGATGGTGG - Intergenic
1086834445 11:91603030-91603052 GTGCCCACCCAGATTGATGGTGG - Intergenic
1086851499 11:91814873-91814895 GTGCCCACCCACACTGAGGGTGG - Intergenic
1087041402 11:93804303-93804325 GTGCCCACCCAGATTAAGGGTGG + Intronic
1087366923 11:97231873-97231895 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1087415535 11:97850871-97850893 GTGCCCACCCAGCTTGAGGGTGG - Intergenic
1087417642 11:97878302-97878324 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1087675337 11:101154947-101154969 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1087731996 11:101789361-101789383 CTGCCCACCCACACTGAGGGTGG + Intronic
1088102610 11:106171799-106171821 GTACCCACCCAGAGTGAGGGTGG - Intergenic
1088142796 11:106637552-106637574 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1088191353 11:107232204-107232226 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1088205791 11:107390878-107390900 GTTCCCACCCACACTGAGGGTGG - Intronic
1088212645 11:107473595-107473617 GTGCCCACCCACATTGAAAGTGG + Intergenic
1088448897 11:109961665-109961687 GTGACCACCCAGATTGAGAGTGG - Intergenic
1088449654 11:109967802-109967824 GTGCCCACCTGGATTGAGAGTGG - Intergenic
1089370629 11:117953509-117953531 CTGCCCAGCATGACTGAGAGAGG - Intergenic
1089371047 11:117957876-117957898 GTACCCACCCAGACTGAGGGTGG + Intergenic
1089659927 11:119979060-119979082 GTGCCCACCCTTTCTGACAGAGG - Intergenic
1090155083 11:124428709-124428731 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1090221298 11:125029146-125029168 GTGCCAACCCAGAGTAAGAGTGG + Intronic
1090409159 11:126495717-126495739 GTGCCCACATGGGCTCAGAGAGG - Intronic
1090481256 11:127070689-127070711 GTGCCCACCCACATTGAGGGTGG + Intergenic
1090569983 11:128035354-128035376 GTGCCCACCAAGATTGACAGTGG - Intergenic
1090730053 11:129564641-129564663 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1090889831 11:130914222-130914244 GTGCTCACCCGGGCTAGGAGTGG - Intronic
1091052061 11:132381210-132381232 GTGCCCACCCAGATTAAGGGCGG - Intergenic
1091802312 12:3332134-3332156 GTGCCCACCCACATTGAGGGTGG + Intergenic
1091972013 12:4795474-4795496 GTGCCCGCCCAGATTGAGGGTGG + Intronic
1092370134 12:7909994-7910016 GTGCCCACACAGATTGAGGGTGG - Intergenic
1092575533 12:9778472-9778494 GTGCCCGCCCAGATTGAGAGTGG - Intergenic
1092819959 12:12344367-12344389 GTGCCCACCCAGATTCAGGGTGG - Intronic
1093037462 12:14346349-14346371 GTGCCCACCCACATTGAGGGTGG - Intergenic
1093097959 12:14993779-14993801 GTGCCCACCCACACCGAGGGTGG - Intergenic
1093222038 12:16433261-16433283 GTGCCCACCCAGACTGAGGGTGG + Intronic
1093292295 12:17342742-17342764 GTGCCCACCCAGACTGAGGGTGG + Intergenic
1093596607 12:20969749-20969771 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1093645585 12:21582300-21582322 GTGCCCACCCAGATTAAGGGTGG - Intronic
1093646024 12:21586135-21586157 GTGCCCACCCAGATTAAGGGTGG - Intronic
1093776719 12:23084096-23084118 GTGCCCACCCAGACTGACAGTGG + Intergenic
1093891212 12:24524126-24524148 GTGCCCACTCACACTGAAAGTGG - Intergenic
1093964095 12:25307273-25307295 GTGCCCATCCAGATTGAGGGTGG - Intergenic
1093964864 12:25313435-25313457 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1093968553 12:25352864-25352886 CTGCCCACCCTGACTGAGGGTGG + Intergenic
1094169864 12:27480259-27480281 GTGTCCACCCACACTGAGGGTGG + Intronic
1094604336 12:31937658-31937680 GTGCCTACCCAGATTGAGGGTGG - Intergenic
1094679121 12:32651990-32652012 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1094706909 12:32923099-32923121 GTGCCCACCCCGGTTGAGTGTGG + Intergenic
1094740214 12:33280314-33280336 GTTCCCACCCAGATTGAGGGTGG + Intergenic
1095500115 12:42828523-42828545 GTGCCCACCCGGATTGAGGGTGG + Intergenic
1095686372 12:45040120-45040142 GTGCCCACCCAGATTAAGGGTGG - Intronic
1095692922 12:45110925-45110947 GTGCCCACCCAGATTAAGAGTGG - Intergenic
1095785086 12:46101273-46101295 GTGCCCACCCACACTGAGGGTGG + Intergenic
1095844082 12:46727481-46727503 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1095903655 12:47355011-47355033 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1096050577 12:48604113-48604135 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1096269944 12:50157027-50157049 GTGCCCACCCAGATTAAGGGTGG - Intronic
1096457137 12:51796944-51796966 GTGCCCACCCACATTGAGGGTGG + Intronic
1096735445 12:53649699-53649721 GTGTCCACCCATACTGAGGGTGG + Intronic
1097366688 12:58722523-58722545 GTGCCCACCCAGACTGAAGGTGG + Intronic
1097403170 12:59154646-59154668 GTGCCCACCCAGACTAAGGGTGG + Intergenic
1097437512 12:59569772-59569794 GTGCCCAACCAGACTAAGGGTGG + Intergenic
1097471251 12:59995009-59995031 GTGCTCACCCAGATTGAGGGTGG + Intergenic
1097513360 12:60571211-60571233 GTTCCCACCCAGACTAAGGGTGG - Intergenic
1097554888 12:61124092-61124114 GTACCCACCCAGATTGAGAGTGG - Intergenic
1097581576 12:61463861-61463883 GTGCCCATCTGGATTGAGGGTGG + Intergenic
1097843017 12:64340262-64340284 GTGCCCACCCAGAATAAGCGTGG + Intronic
1098039685 12:66341368-66341390 GTGCCCACCCACACTGAGGGTGG + Exonic
1098153719 12:67575157-67575179 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1098239287 12:68450017-68450039 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1098307233 12:69114454-69114476 GTGCTCACCCAGATTGAGGGTGG - Intergenic
1098774982 12:74601030-74601052 GTGCTCACCCAGATTGAGGGTGG + Intergenic
1098806038 12:75020857-75020879 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1098824169 12:75271860-75271882 ATGCCCACCCACACTGAGGGTGG + Intergenic
1098995499 12:77114722-77114744 GTGCCCACCCAGATTAAGAGTGG + Intergenic
1099399963 12:82192207-82192229 GTGCCCATCCAGATTGAGGGTGG - Intergenic
1099423909 12:82499713-82499735 GTGCCCACCCACATTGAGCGTGG - Intergenic
1099490379 12:83281761-83281783 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1099493501 12:83315526-83315548 GTGCCCACACAGATTAAGAGTGG - Intergenic
1099509192 12:83512442-83512464 GTGCCCACCTAGATTGAGGGTGG - Intergenic
1099526731 12:83726122-83726144 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1099542363 12:83928161-83928183 GTGCCCAGCCAGATTGAGGGTGG - Intergenic
1099632431 12:85167637-85167659 GTGCCCACCCAGATTGAGGGTGG + Intronic
1099689677 12:85937140-85937162 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1099697780 12:86043550-86043572 GTGCCCACCCAGATTGAGAATGG + Intronic
1099736134 12:86568196-86568218 GTGCCCACTCAGATTGAGGGTGG - Intronic
1100074617 12:90765026-90765048 GTGCCCACCTAGATTGAGGGTGG - Intergenic
1100148173 12:91702617-91702639 GTGCCCACCTAGACTGAGGATGG + Intergenic
1100241621 12:92715298-92715320 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1100264937 12:92966787-92966809 GTGCCCACCCAGATTGATGGCGG - Intergenic
1100569153 12:95830244-95830266 GAGCCCACCCAGATTGAGGGTGG + Intergenic
1100715286 12:97299294-97299316 GTACCCACCCAGATTGAGGGTGG + Intergenic
1100890811 12:99123820-99123842 GTGCCCACCCAGATTGAGGGTGG + Intronic
1101063755 12:100998122-100998144 GTGCCCACCCAGATTAAGGGTGG - Intronic
1101192662 12:102351202-102351224 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1101213704 12:102560344-102560366 GTGCCTACCTGGACTGAGGGTGG - Intergenic
1101258744 12:103007185-103007207 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1101535235 12:105610435-105610457 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1101713829 12:107293157-107293179 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1101729872 12:107418136-107418158 GTGCTCACCCAGATTAAGAGTGG - Intronic
1101990079 12:109477286-109477308 CTCCAAACCCGGACTGAGAGAGG + Exonic
1102322800 12:111952599-111952621 GTGCCCACCCAGATTAAGGGTGG - Intronic
1102395855 12:112585209-112585231 GTGCTCACCCAGACTGAGGGTGG + Intronic
1102669895 12:114609245-114609267 GTGCCCACCTAGACTGAGGTTGG - Intergenic
1102763470 12:115410147-115410169 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1102766919 12:115441393-115441415 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1102790182 12:115638225-115638247 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1102988282 12:117296390-117296412 GTGCCCACCCACATTGAGGGTGG - Intronic
1103148604 12:118617369-118617391 GTGCCCACCCAGACTGAGGGTGG - Intergenic
1103396856 12:120613938-120613960 GCACCCACCCGGATTGAGGGTGG - Intergenic
1104133441 12:125916330-125916352 GTGCCCACCCACATTGAGGGAGG - Intergenic
1104185096 12:126422909-126422931 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1104241349 12:126993202-126993224 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1104241578 12:126994799-126994821 GTGCCCACCCAGACTGAGGGTGG + Intergenic
1104261059 12:127182423-127182445 GTGCCCATCCAGATTGAGGGTGG + Intergenic
1104311182 12:127655466-127655488 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1104325794 12:127796582-127796604 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1104327177 12:127810699-127810721 GTGCCCACCCACATTGAGGGTGG + Intergenic
1104370215 12:128217730-128217752 GTGCCCACCCAGAATGAGGGTGG + Intergenic
1104548072 12:129730685-129730707 GTGCCCACCGAGAATGAGGGTGG - Intronic
1104563476 12:129859593-129859615 GTGCCCGCCCACACTGAGGGTGG - Intronic
1104604845 12:130180331-130180353 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1104795292 12:131512824-131512846 GTGCCCACCCAGATTAAGGGCGG - Intergenic
1105289799 13:19045523-19045545 GTGCCCGCCCAGACTGAGGGTGG + Intergenic
1105515333 13:21084593-21084615 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1105632269 13:22182102-22182124 GTGCCCGCCCAGATTGAGGGTGG + Intergenic
1105670240 13:22605557-22605579 GTGCCCACCCAGACTGAGGGTGG + Intergenic
1105752821 13:23437181-23437203 GTGCCCACCCAGATTGACGGTGG - Intergenic
1106051553 13:26194893-26194915 GTGCCCACCCAGATTAAGGGTGG + Intronic
1106169585 13:27277598-27277620 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1106331062 13:28740096-28740118 GTGCCCACCCAGACTGAGGGTGG + Intergenic
1106820814 13:33462793-33462815 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1106862918 13:33930523-33930545 GTGCCCACCCAGATTGAGGATGG + Intronic
1106945303 13:34820866-34820888 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1107308738 13:39052991-39053013 GTGCCCACTCAGATTGAGGGTGG - Intergenic
1107400748 13:40066598-40066620 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1107424866 13:40282834-40282856 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1107682511 13:42866279-42866301 GTGCCCACCCAGACTGCAGGTGG - Intergenic
1107783290 13:43927814-43927836 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1107984024 13:45759525-45759547 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1108098022 13:46924942-46924964 GTGCCCACCCAGATTGAGGGAGG - Intergenic
1108111831 13:47082036-47082058 GTGCCCACCCACACTCAGGGTGG - Intergenic
1108117616 13:47146715-47146737 ATGCCCACCCAGACTGAGGGTGG + Intergenic
1108199136 13:48025492-48025514 GTGCCCACCTGCACTGAGGGTGG - Intergenic
1108287930 13:48927278-48927300 GTGCCCACCCACACTGAGGGTGG - Intergenic
1108446173 13:50511034-50511056 GTGCCCACCAAGACTGATGGTGG - Intronic
1108472061 13:50777311-50777333 GTGCCCACCCAGATTAAGGGTGG - Intronic
1108933371 13:55859808-55859830 GTGCCCACCCCGACTGAGGGTGG + Intergenic
1108941626 13:55963158-55963180 GTGCCCAACCACACTGTGAGTGG + Intergenic
1108954897 13:56140819-56140841 GTGCCCACCCAGACTGAGGGTGG + Intergenic
1108979903 13:56497684-56497706 GTGCCCACCCAGACTGAGGGCGG - Intergenic
1109045628 13:57407451-57407473 GTGCCCACCCAGACTGCGGGTGG - Intergenic
1109048199 13:57440253-57440275 GTGCTCACCCAGATTGAGGGTGG - Intergenic
1109171055 13:59097462-59097484 GTGCCCACCTAGACTGAGGGTGG - Intergenic
1109241815 13:59898907-59898929 GTGCCCACCCAGATTGAAGGTGG - Intronic
1109333232 13:60958304-60958326 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1109379641 13:61542942-61542964 GTGCCCACCCAGACTGAGGGTGG - Intergenic
1109415752 13:62037249-62037271 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1109462879 13:62686911-62686933 GTGCCCGCCCAGACTGAGGGTGG - Intergenic
1109799931 13:67363242-67363264 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1109914544 13:68963671-68963693 GTGCCCACCCAGATTAAGTGTGG + Intergenic
1109927098 13:69158012-69158034 GTGCCCACGCAGATTGAGGGTGG + Intergenic
1109981505 13:69913931-69913953 GTGCTCACCCAGATTGAGGGTGG - Intronic
1110065574 13:71101395-71101417 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1110083138 13:71343659-71343681 GTGCCCACCCAGATTAAGAGTGG + Intergenic
1110161083 13:72379515-72379537 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1110409726 13:75191105-75191127 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1110455836 13:75689566-75689588 GTGCCCACCCAGATTGAGGGTGG - Intronic
1110502531 13:76245176-76245198 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1110613397 13:77514161-77514183 GTGCCCACCCACATTGAGGGTGG + Intergenic
1110738237 13:78963558-78963580 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1110825539 13:79967475-79967497 GTGCCCATCCGGATTAAGGGTGG - Intergenic
1110882399 13:80588157-80588179 GTGCCCACCCACATTGAGGGTGG - Intergenic
1110948109 13:81450054-81450076 GTGCCCACCCAGATTGAGAGTGG - Intergenic
1111086506 13:83381529-83381551 GTGCCCACCTAGGCTGAGGGTGG + Intergenic
1111087779 13:83399190-83399212 GCGCCCACCCAGATTGAGGGTGG - Intergenic
1111182402 13:84686488-84686510 GTGCTCACCCACATTGAGAGTGG - Intergenic
1111317804 13:86584286-86584308 GTGCCCACCCAGATTGAGGCTGG - Intergenic
1111372993 13:87341435-87341457 GTCCCCACCCAGATTAAGAGTGG - Intergenic
1111524978 13:89456665-89456687 GGGCCCACCCAGATTGAGGGTGG - Intergenic
1111543969 13:89705771-89705793 GTGCCCACCCAGATTGAGTGTGG + Intergenic
1111679572 13:91426764-91426786 GTGCCCACCAAGATTGAGGGTGG + Intronic
1111741418 13:92210054-92210076 GTGCCCACCCAGATTGAGGGTGG + Intronic
1111786236 13:92790125-92790147 GTGCCCACCCAGACTGAGGGTGG + Intronic
1111802353 13:92996407-92996429 GTGCCCACCCAGATTGAGGATGG + Intergenic
1111906876 13:94265474-94265496 GTGCCCACCCAGATTAAGGGTGG + Intronic
1111957957 13:94778979-94779001 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1111977530 13:94982617-94982639 GTGCCCACCCAGACTGAGGGTGG - Intergenic
1112105609 13:96236207-96236229 GTGCCCACCCAGATTAAGGGTGG + Intronic
1112109899 13:96284554-96284576 GTGCCCACTCAGATTGAGGGTGG + Intronic
1112206122 13:97324943-97324965 GTGCCCACCCAGATTGAGGGTGG + Intronic
1112225566 13:97536309-97536331 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1112228213 13:97561953-97561975 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1112322895 13:98423164-98423186 GTGCCCACCCAGATTGAGGGTGG + Intronic
1112524693 13:100133771-100133793 GTGCCCACCCAGATTGGGGGTGG - Intronic
1112686746 13:101837881-101837903 GTGCCCACCCAGATTGAGGGTGG - Intronic
1112742088 13:102486482-102486504 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1112761397 13:102697210-102697232 GTGCCCATCCTGACAGAGAGAGG - Intergenic
1112984096 13:105424732-105424754 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1113024920 13:105929771-105929793 GTGCCCACCCGGATTGAGGGTGG - Intergenic
1113094592 13:106650339-106650361 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1113096236 13:106666922-106666944 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1113128956 13:107013313-107013335 GTGCCCATCCAGATTGAGGGTGG - Intergenic
1113140739 13:107146484-107146506 GTGCCCACCCAGATTGAGAGTGG - Intergenic
1113204396 13:107898430-107898452 GTGCCCACCCACACTGGGAAGGG + Intergenic
1113332474 13:109342986-109343008 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1113519152 13:110926394-110926416 GTGCCCACCCAGACTGAGGGTGG - Intergenic
1114038505 14:18653152-18653174 GTGACCACCCAGACTGAGAGTGG + Intergenic
1114120115 14:19661891-19661913 GTGACCACCCAGACTGAGGGTGG - Intergenic
1114379895 14:22191372-22191394 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1114764101 14:25350760-25350782 GTGCCCACCCACAATGAGGGTGG - Intergenic
1114977064 14:28115073-28115095 GTGCCCACCCAGAATAAGGGTGG - Intergenic
1115014243 14:28590667-28590689 GTGCCCACCCAGTTTGAGGGTGG - Intergenic
1115040238 14:28915536-28915558 GTGCCCACCAAGATTGAGGGTGG + Intergenic
1115068434 14:29294088-29294110 GTGCCAACCCAGATTGAGGGTGG + Intergenic
1115129809 14:30041900-30041922 GTGCCCATCCAGATTGAGGGTGG - Intronic
1115161407 14:30399692-30399714 GTGCCCACCCAGACTGAGGGCGG + Intergenic
1115347995 14:32363701-32363723 GTGCCCACCCAAACTGAGGGTGG + Intronic
1115656379 14:35447522-35447544 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1115951000 14:38721264-38721286 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1116067810 14:40006983-40007005 GTGCCCACCCAGTTTGAGAATGG - Intergenic
1116217605 14:42039287-42039309 ATGCCCACCCAGATTAAGAGTGG + Intergenic
1116245547 14:42406936-42406958 GTGCCCTCCCACATTGAGAGTGG + Intergenic
1116248693 14:42454528-42454550 GTACCCACCCAGATTGAGGGTGG - Intergenic
1116269518 14:42743048-42743070 GTGCCCACCCAGACTGAGGTTGG + Intergenic
1116297634 14:43133693-43133715 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1116327382 14:43547808-43547830 GTACCCACCCAGATTGAGGGTGG + Intergenic
1116388196 14:44358724-44358746 GTGCCCACCCACACTGAGGCTGG + Intergenic
1116414638 14:44665716-44665738 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1116661947 14:47721529-47721551 GTGCCCACTCAGACTGAGAGTGG + Intergenic
1116665247 14:47766268-47766290 GTCCCCACCCGGATTGATTGTGG + Intergenic
1116747860 14:48844899-48844921 GTGCCCAGCCACACTGAGGGTGG - Intergenic
1116754508 14:48929259-48929281 GTGCCAACACAGATTGAGAGTGG - Intergenic
1117001677 14:51376848-51376870 GTGCCCACTCAGATTGAGGGTGG - Intergenic
1117024600 14:51607045-51607067 ATGCCCACCCACACTGAGGGTGG + Intronic
1117347450 14:54847409-54847431 GTGCCCACCCAGATTAAGTGTGG - Intronic
1117491318 14:56250718-56250740 GGGCCCATCCAGATTGAGAGTGG + Intronic
1117808601 14:59521154-59521176 GTTCCCACCCAGATTGAGAGTGG - Intronic
1118052151 14:62041172-62041194 GTGCCCACCCAGATTAACAGTGG + Intronic
1118214428 14:63795232-63795254 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1118440264 14:65805723-65805745 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1118449697 14:65888850-65888872 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1118459872 14:65977867-65977889 GTGCCCACCCAGATTAAGGGTGG - Intronic
1118466356 14:66034657-66034679 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1118675798 14:68183435-68183457 GTGCCCACCAAGATTGAGGGTGG + Intronic
1118769447 14:68932183-68932205 GTGCCCACCCAGATTGAGGGTGG - Intronic
1119052775 14:71386388-71386410 GTGCCCACCCAGATTGAGGGTGG + Intronic
1119132302 14:72185217-72185239 GTGCCCACCCAGATTGAGAGTGG + Intronic
1119147341 14:72329378-72329400 TTGCCCACCTGGAGTGTGAGGGG - Intronic
1119532801 14:75374683-75374705 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1119676737 14:76561396-76561418 GTGCCCACCTAGACTGAGTGTGG - Intergenic
1120067557 14:80061123-80061145 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1120275781 14:82370761-82370783 GTGCCCATCCAGATTGAGGGTGG - Intergenic
1120298371 14:82674511-82674533 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1120461688 14:84805392-84805414 GTGTCCACCCAGATTGAGGGTGG - Intergenic
1120626040 14:86827649-86827671 GTGTCCACCCAGATTGAGGGTGG - Intergenic
1120676844 14:87430632-87430654 GTGCCCACCCAGACTGAGGGTGG - Intergenic
1120760952 14:88284710-88284732 GTGCCCACCCAGATTAAGGGTGG + Intronic
1120774027 14:88412538-88412560 GTGCCCACCCAGATTAAGGGTGG + Intronic
1120865648 14:89293377-89293399 CTGCCCTCCAGGACTGTGAGAGG - Intronic
1120974057 14:90233609-90233631 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1121082511 14:91119752-91119774 GTGCCCACCCAGACTGAGGGCGG - Intronic
1121245945 14:92460884-92460906 GTGCCCACCTGGCCTGATGGTGG + Intronic
1121422921 14:93828239-93828261 GTGCCCACCCAGACTAAGGGTGG + Intergenic
1121897951 14:97665966-97665988 GTGCCCACCCAGATGGTGAGTGG - Intergenic
1122378391 14:101284765-101284787 GGGCCCACCCAGACTGAGGGTGG - Intergenic
1122439857 14:101723260-101723282 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1122765801 14:104068996-104069018 GTGCCCACCCAGATGGAGGGTGG - Intergenic
1124136172 15:27038107-27038129 GTGGCCAACCGGACTGAGATGGG - Intronic
1124194184 15:27606237-27606259 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1124392660 15:29273645-29273667 GTGCCCACCCAGATTGAACGTGG - Intronic
1124855090 15:33380061-33380083 ATGCCCACCCACATTGAGAGTGG + Intronic
1124960523 15:34389962-34389984 GTCCCCACCCACTCTGAGAGAGG + Intronic
1124977152 15:34536183-34536205 GTCCCCACCCACTCTGAGAGAGG + Intronic
1125423189 15:39525176-39525198 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1126283214 15:46980616-46980638 ATGCCCACCCAGATTAAGAGTGG - Intergenic
1126283912 15:46988711-46988733 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1126318511 15:47396665-47396687 GTGCTCACCCAGATTGAGGGTGG + Intronic
1126452211 15:48820657-48820679 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1126874469 15:53025105-53025127 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1127326164 15:57897091-57897113 GTGCCCACCCAGACTGAGGGTGG + Intergenic
1127380056 15:58423199-58423221 GTGCCCACCCAGATTGAGGGTGG - Intronic
1127574187 15:60273874-60273896 GTACCCACCCAGATTGAGAGTGG + Intergenic
1127787876 15:62372038-62372060 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1127923595 15:63515850-63515872 GTGGACAGCAGGACTGAGAGTGG - Intronic
1128207609 15:65867198-65867220 GTGCCCACCCGGATTAAGGGTGG + Intronic
1128454529 15:67825245-67825267 GTGCGCACCCGGACCTAGCGCGG - Intronic
1130066372 15:80608316-80608338 GTGCCCACCGGGATTGAGGGTGG - Intergenic
1130332432 15:82932846-82932868 GTGCACACCCCAACTGTGAGAGG + Intronic
1130391451 15:83459230-83459252 GTGTCCACCCAGATTGAGGGTGG + Intronic
1130768562 15:86899910-86899932 GTGCCCACCCAGATTGAGGGTGG - Intronic
1130772542 15:86939220-86939242 GTGCCCATCCAGATTGAGAGTGG - Intronic
1131035393 15:89218686-89218708 GTGCCCACCTGGGCAGAGAAAGG + Exonic
1131404168 15:92150276-92150298 GTGCCCACCCAGATTGAGGCTGG + Intronic
1131600147 15:93838887-93838909 GTACCCACCCAGATTGAGAGTGG + Intergenic
1131651865 15:94409131-94409153 GTGCCCACCCAGATTAAGGGTGG - Intronic
1131896499 15:97037046-97037068 GTGCTCACCCAGATTGAGGGTGG - Intergenic
1131897890 15:97053678-97053700 GCGCCCACCCAGATTGAGGGTGG + Intergenic
1132421261 15:101672143-101672165 TTACCCACCCAGACTCAGAGTGG - Intronic
1132616003 16:841465-841487 GTGTCCCCCTGGCCTGAGAGGGG + Intergenic
1133367195 16:5219526-5219548 GTACCCACTCACACTGAGAGTGG + Intergenic
1133392170 16:5419457-5419479 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1133407254 16:5534657-5534679 GTGCCCACTCACACTGAGGGTGG + Intergenic
1133626447 16:7574660-7574682 GGGCCCACCCAGATTGAGGGTGG + Intronic
1133648577 16:7787889-7787911 GTGCCCACCCAGAGTAAGGGTGG - Intergenic
1133925180 16:10186590-10186612 GTGCCTACCCAGATTGAGGGTGG - Intergenic
1134504913 16:14797213-14797235 GTACCCACCCAGATTGAGGGTGG + Intronic
1134570250 16:15284555-15284577 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1134575661 16:15331696-15331718 GTACCCACCCAGATTGAGGGTGG - Intergenic
1134726786 16:16424806-16424828 GTACCCACCCAGATTGAGGGTGG + Intergenic
1134732125 16:16471498-16471520 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1134778303 16:16872154-16872176 GTGCCCATCCAGATTGAGGGTGG + Intergenic
1134814876 16:17197577-17197599 ATGCCCACCCAGACTGAGAGTGG - Intronic
1134861420 16:17563864-17563886 GTGCCCTCCCAGATTGAGGGTGG + Intergenic
1134935312 16:18240465-18240487 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1134940648 16:18287057-18287079 GTACCCACCCAGATTGAGGGTGG - Intergenic
1135518968 16:23158856-23158878 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1135538051 16:23309695-23309717 GTGCCCACTCAGATTAAGAGTGG + Intronic
1135909103 16:26543031-26543053 GTGCCCACCCAGATTAAGGGCGG + Intergenic
1135977844 16:27122596-27122618 GTGCCCACCCACATTGAGGGTGG + Intergenic
1136134914 16:28249876-28249898 GTGCCCACCCAGATGGAGGGTGG - Intergenic
1136251307 16:29007342-29007364 GTGCCTACCCAGATTGAGGGTGG - Intergenic
1136730590 16:32408250-32408272 GTGCCCACCCACATTGAGGGTGG - Intergenic
1137418073 16:48303941-48303963 GTGCCCACTCAGATTGAGGGTGG + Intronic
1137816428 16:51402069-51402091 GTGCCCACCCACATTGAGGGTGG + Intergenic
1138033882 16:53583020-53583042 GTGCCCACCCAGACTGAGGGTGG - Intergenic
1138268879 16:55680580-55680602 GTGCCCACCCAGACTGAGGGTGG + Intronic
1138493500 16:57392493-57392515 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1138626400 16:58255365-58255387 GTGCCCACCCACACTGAGGGTGG + Intronic
1138647044 16:58433245-58433267 GTGACCACCCAGATTAAGAGTGG + Intergenic
1138831682 16:60382171-60382193 GTTCCCACCCAGATTGAGGGTGG + Intergenic
1138868696 16:60853308-60853330 GTGCCCACCCAGATAGAGGGTGG - Intergenic
1138907071 16:61349736-61349758 GTGCCCACCCAGTTTGAGGGTGG + Intergenic
1139048671 16:63096226-63096248 GTGCCCACCCACATTGAGGGTGG - Intergenic
1139116728 16:63963333-63963355 GTGCCCAACCAGACTGAGAGTGG - Intergenic
1139216968 16:65135515-65135537 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1139217829 16:65146429-65146451 GTGCCCACCCAGACTTAGGCTGG + Intergenic
1139292815 16:65873670-65873692 GTGCCCACCCAAATTGAGGGTGG + Intergenic
1139312327 16:66038070-66038092 CTGCCCACCCAGATTGAGGGTGG + Intergenic
1139702352 16:68715813-68715835 GTGCCCACCAGCAAGGAGAGGGG - Intronic
1139822392 16:69730819-69730841 GTGCCCACCCAGATTGAGGATGG - Intergenic
1140316396 16:73902022-73902044 GTGCCCACCCACACTGTGGGTGG - Intergenic
1140336769 16:74114441-74114463 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1140337494 16:74122012-74122034 GTGCCCACCCAGATTAAGAGTGG + Intergenic
1140597866 16:76437228-76437250 GTGCCCACCCAGATTAAGGGTGG + Intronic
1141024400 16:80531166-80531188 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1141249594 16:82343105-82343127 GTACCCACCCAGAATGAGGGTGG + Intergenic
1141267641 16:82511377-82511399 GGGCCCACCCAGATTAAGAGTGG - Intergenic
1141275743 16:82586533-82586555 GTGCCCACCCAGACTGAGAGTGG - Intergenic
1141324267 16:83040622-83040644 ATGCCCACCCAGACTGAGGGTGG + Intronic
1141547608 16:84781741-84781763 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1141878239 16:86841094-86841116 GTCCCCACCCACACTGAGGGTGG + Intergenic
1142310194 16:89307722-89307744 GTCCCCACCTGGAATGAGATAGG + Intronic
1202995811 16_KI270728v1_random:109065-109087 GTGCCCACCCACATTGAGGGTGG + Intergenic
1203022498 16_KI270728v1_random:421407-421429 GTGCCCACCCACATTGAGGGTGG + Intergenic
1143353474 17:6306976-6306998 GTGCCCACCCACATTGAGGGTGG - Intergenic
1143364890 17:6400593-6400615 GTGCCCACCCACATTGAGGGTGG - Intronic
1144000135 17:11046261-11046283 GTGCCCACCCAAATTGAGGGTGG + Intergenic
1144089598 17:11842788-11842810 GTGCCCACCCAAACTGAGAGTGG + Intronic
1144136549 17:12300836-12300858 GTGCCCACCCAGACCCAGGGTGG - Intergenic
1144154616 17:12487095-12487117 GTGCCCACCCTGATTGAGGGTGG + Intergenic
1144155201 17:12493724-12493746 GTGCCCACCCAGGTTGAGGGTGG - Intergenic
1144412351 17:15013410-15013432 GTGCTCACCCAGACTGAGGGTGG - Intergenic
1145224310 17:21115199-21115221 GTGCCCATCCAGATTGAGGGTGG + Intergenic
1145263976 17:21370682-21370704 GTGCCCACCAGGGTAGAGAGGGG + Intergenic
1146127051 17:30238149-30238171 GGGACCACCCGGCCAGAGAGAGG - Intergenic
1146694465 17:34898112-34898134 CTCCCCACCAGGACTGGGAGAGG + Intergenic
1146952022 17:36913418-36913440 CCACCCACCCGGAATGAGAGCGG + Intergenic
1147431409 17:40373116-40373138 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1148179702 17:45595449-45595471 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1148269203 17:46250452-46250474 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1148812801 17:50305063-50305085 GTGCCCAACTAGGCTGAGAGAGG + Intergenic
1148950947 17:51311889-51311911 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1148960452 17:51388191-51388213 GTGGCCACCCAGATTGAGGGTGG + Intergenic
1149051066 17:52306154-52306176 GTGCCCACTCAGATTGAGTGTGG - Intergenic
1149095765 17:52838545-52838567 GTGCCCACCCAGATTGATGGTGG + Intergenic
1149123921 17:53204741-53204763 GTGGCCACCCAGATTGAGGGTGG - Intergenic
1149207852 17:54268945-54268967 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1149219798 17:54403619-54403641 GTGTCCACCCAGACTGAGGGTGG + Intergenic
1149397701 17:56261764-56261786 GTGCCCACCCGGACTGAGAGTGG + Intronic
1149637048 17:58179328-58179350 GTGCCCACTCAGATTGAGTGTGG - Intergenic
1149770708 17:59318684-59318706 GTACCCACCCAGACTGAGGGTGG - Intergenic
1150627632 17:66852021-66852043 GTGCCCATCCACACTGAGAGTGG - Intronic
1150935531 17:69631303-69631325 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1150956235 17:69863246-69863268 GTGCCCCCCCAGATTGGGAGTGG + Intergenic
1150964784 17:69955820-69955842 GTGCCCACCCAGATTGAGGATGG + Intergenic
1151029380 17:70718570-70718592 GTGTCCACCCAGATTGAGGGTGG - Intergenic
1151034558 17:70783282-70783304 GTGCCCACCCAGATTAAGAGTGG + Intergenic
1151069065 17:71187373-71187395 GTGCCCACCCTGACTGATGAGGG + Intergenic
1151184935 17:72356903-72356925 GTGCCCACCCAGATTGAGTGTGG - Intergenic
1151368537 17:73632273-73632295 GTGCCCACCCAGACTGAGGGTGG - Intronic
1151444955 17:74157422-74157444 GTGCCCACCCACACTGAGGATGG - Intergenic
1151504268 17:74516233-74516255 GTGCCCACCCGGATTGAGGGTGG + Intergenic
1152398950 17:80052432-80052454 GTGCCCACCCAGATTGGGGGTGG + Intronic
1152716037 17:81901308-81901330 GTGCCCACCTGGATTGAGGGTGG + Intronic
1153101155 18:1471214-1471236 GTACCCACCCAGATTGAGGGTGG - Intergenic
1153131717 18:1861318-1861340 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1153442129 18:5132354-5132376 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1153613975 18:6917312-6917334 GTGCCCACCCATATTGAGGGTGG - Intergenic
1153713576 18:7823546-7823568 GTGCCCACCCAGACTGAGGGTGG - Intronic
1153950439 18:10053846-10053868 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1154071499 18:11156299-11156321 GTGCCCACCCAGATTGAGGGCGG + Intergenic
1154506474 18:15045359-15045381 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1155551225 18:26967795-26967817 GTGTCCACCCAGATTGAGGGTGG - Intronic
1155618240 18:27746049-27746071 GTGCACACCCAGATTGAGGGTGG - Intergenic
1155663907 18:28283922-28283944 ATGCCCACCCAGATTGAGGGTGG - Intergenic
1155741641 18:29296876-29296898 GTGCCCACCCACACTGAGGGTGG + Intergenic
1156304162 18:35861177-35861199 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1156510055 18:37628704-37628726 GTGTACACCCAGACTGAGGGTGG + Intergenic
1156573299 18:38282846-38282868 GTGCCCACCCAGCTTGAGGGTGG - Intergenic
1156576868 18:38327342-38327364 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1156606077 18:38668764-38668786 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1156973904 18:43193166-43193188 GTGCCCACCTAGACTGAGGATGG + Intergenic
1156990740 18:43404436-43404458 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1157011610 18:43655755-43655777 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1157180799 18:45496406-45496428 GTGCCCACCCACACTGACAGTGG - Intronic
1157377220 18:47177668-47177690 GTGCCCACTTGGATTAAGAGTGG - Intergenic
1157394356 18:47329426-47329448 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1157654919 18:49375784-49375806 GTGCCCACCCAGATTGAGGGTGG - Intronic
1157707475 18:49819467-49819489 GTGCCCACCCACACTGAGGGTGG + Intronic
1157753854 18:50200787-50200809 GTGCTCACCCGGATTGAGGGTGG - Intergenic
1157798102 18:50594221-50594243 GTGCCCACCCACACTGAGGGTGG + Intronic
1157821312 18:50772365-50772387 GTGCCCACCCACATTGAGAGTGG + Intergenic
1157845457 18:51000087-51000109 GTGCCCACCCACACTGAGGGTGG - Intronic
1157870626 18:51227116-51227138 GTGCCCACCCACATTGAGGGTGG + Intergenic
1157918875 18:51696063-51696085 GTGTCCACCCAGACTGAGGGTGG - Intergenic
1158011681 18:52735741-52735763 GTGCCCAGCCAGATTGAGGGTGG + Intronic
1158125979 18:54100116-54100138 GTGCACACCCACACTGAGGGTGG - Intergenic
1158446479 18:57526562-57526584 GTGCCCACCCAGACTGAGGGTGG - Intergenic
1158456060 18:57608845-57608867 GTGCCCACCCACATTGAGGGTGG - Intronic
1158762793 18:60410618-60410640 GTGCTCACCCAGATTGAGGGTGG - Intergenic
1158946082 18:62448052-62448074 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1159136595 18:64343929-64343951 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1159151607 18:64530201-64530223 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1159162485 18:64661017-64661039 GTGCTCACCCAGACTGAGGGTGG - Intergenic
1159208553 18:65285714-65285736 GTGCCCACCTAGATTGAGGGCGG - Intergenic
1159378118 18:67620658-67620680 GTGCCCACCCAGATTGGGAGTGG - Intergenic
1159478007 18:68949137-68949159 GTGCTCACCCAGATTGAGGGTGG + Intronic
1159481803 18:68998810-68998832 GTGCCTACCCAGACTGAGGGTGG + Intronic
1159642667 18:70881843-70881865 GTGCCCACCCAGACTGTGAGTGG - Intergenic
1159674631 18:71266235-71266257 ATGCCCACCCTGATTGAGGGTGG + Intergenic
1159693513 18:71522793-71522815 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1159708803 18:71727567-71727589 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1159804546 18:72940360-72940382 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1159836768 18:73346103-73346125 GTGCCCACCCACATTGAGGGAGG + Intergenic
1159840419 18:73392839-73392861 GTGTCCACCCAGATTGAGGGTGG - Intergenic
1160058522 18:75509013-75509035 GTCCCCACCCAAACTGTGAGAGG + Intergenic
1160126666 18:76180089-76180111 GGGCCCACCCAGATTGAGAGTGG + Intergenic
1160262684 18:77309833-77309855 GTGCCTACCCAGATTGAGGGTGG - Intergenic
1160767350 19:814347-814369 GTGCCCACAGGGCCTGAGTGGGG - Intronic
1161362544 19:3859085-3859107 GTGCCCACCCAGAGTGAGGGTGG - Intronic
1161620267 19:5293666-5293688 GGTCCCACCCAGACTGGGAGGGG - Intronic
1162707966 19:12569973-12569995 GTGCCCACCCAAACTGAGGGTGG - Intronic
1163060056 19:14754016-14754038 GTGCCCACCCAGATTAAGAGTGG - Intronic
1163060097 19:14754371-14754393 GTGCCCACCCAGATTAAGAGTGG - Intronic
1163068346 19:14816368-14816390 GTGCCCACACGGATTGAGGGTGG - Intronic
1163195003 19:15711992-15712014 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1163195548 19:15717219-15717241 GTGCCCACCTGGATTGAGGGTGG + Intergenic
1163219411 19:15904121-15904143 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1164032431 19:21419618-21419640 GTGCCCACCCAGATTAAGGGTGG + Intronic
1164547960 19:29184739-29184761 GTGCCCACCTGGATTGAGGGTGG - Intergenic
1164689259 19:30197216-30197238 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1164945387 19:32288915-32288937 GTGCCCACTCAGATTGAGGGTGG - Intergenic
1165179040 19:33952195-33952217 GTGCCCTCCCAGATTGAGGGTGG + Intergenic
1165238872 19:34447263-34447285 GTGCCCACCCAGATTAAGAGAGG + Intronic
1166407689 19:42532989-42533011 GTGCCCACCCACAGTGAGTGAGG - Intronic
1166913901 19:46180935-46180957 GTGCCCCCCCAGATTGAGGGTGG + Intergenic
1166974030 19:46592994-46593016 GTACCCACCCAGATTGAGGGTGG + Intronic
1167677347 19:50895484-50895506 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1167882111 19:52468691-52468713 GTGCCCACTCACACTGAGGGTGG - Intronic
1167882352 19:52470589-52470611 GTGCCCACCCACACTGAGGGTGG - Intronic
1168150471 19:54444790-54444812 GTGCCCACCCACACTGAGAGTGG - Intergenic
1168538992 19:57194697-57194719 GTGCCCACCCAGATTAAGGGGGG + Intronic
925017000 2:536514-536536 GTGCCCACCCGCATTAAGGGTGG - Intergenic
925105228 2:1285214-1285236 GTGCCCACCCAGATTAAGGGTGG + Intronic
925245899 2:2382682-2382704 GTGCCCACCCAGACTGGGTGTGG - Intergenic
925263682 2:2549400-2549422 GTGCCCACCAAGACTGAGGGTGG + Intergenic
925329505 2:3047559-3047581 GTGCCTACCCAGACTGAGGGTGG - Intergenic
925460276 2:4056895-4056917 GTGCCCACCCAGATTAAGGGTGG - Intergenic
925471604 2:4168368-4168390 GTGCCCACCTGGATTGAGGGTGG - Intergenic
925480069 2:4260982-4261004 GTGCCCACCCAGATTGAGGGTGG + Intergenic
925497965 2:4473265-4473287 GTGCCTACCCAGACTGAGGGTGG + Intergenic
925516800 2:4692014-4692036 GTGCCCACCCAGACTGAGCACGG - Intergenic
925572502 2:5326566-5326588 GTGCCCACCCACAATGAGGGTGG + Intergenic
925574144 2:5343377-5343399 GTGCCCACCCAGATTAAGGGTGG - Intergenic
925673432 2:6335645-6335667 GTGCCCACCCAGATTAAGGGTGG + Intergenic
925704793 2:6674170-6674192 GTGCCCACCCAGACTGAGGGTGG + Intergenic
925720273 2:6820645-6820667 GTGCCCACCCAGATTGAGGGTGG + Intergenic
926204398 2:10824983-10825005 GTGCCCACCCAGATTAAGGGTGG - Intronic
926283688 2:11470643-11470665 GTGCCCACCCAGATTGAGAGTGG + Intergenic
926388531 2:12363002-12363024 GTGCCCACCCTCACTGAGGGTGG - Intergenic
926390456 2:12385981-12386003 GTGCCCACCCAGATTGAGGGTGG - Intergenic
926401055 2:12497219-12497241 GTGTCCACCCAGATTAAGAGTGG + Intergenic
926518018 2:13873983-13874005 GTGCCCACCCAGATTAAGGGTGG + Intergenic
926577748 2:14601038-14601060 GTGCCCACCCACACTGAGGGTGG - Intergenic
926733195 2:16052886-16052908 GTGCCCACCCAGATCGAGGGTGG + Intergenic
926810845 2:16754265-16754287 GTGCCCACCCAGATTAAGGGTGG + Intergenic
926826076 2:16906148-16906170 GTGCCCACTCAGATTAAGAGTGG + Intergenic
926829639 2:16947588-16947610 GTGCCCACCAAGATTGAGGGTGG - Intergenic
926840041 2:17070213-17070235 GTGTCCACCCAGACTGAGGGTGG + Intergenic
926841864 2:17089782-17089804 GTGCCCACCCAGATTGAGGGTGG + Intergenic
926942676 2:18154774-18154796 GTGCCCGCCCTGACTGAGGATGG + Intronic
926987221 2:18638347-18638369 GTGCCCACCCATATTGAGGGTGG - Intergenic
926994943 2:18724594-18724616 GTACCCACCCAGAATGAGGGTGG - Intergenic
927028571 2:19096348-19096370 GTGCCCACCCACACTGAAGGTGG - Intergenic
927077588 2:19595512-19595534 GTGCCCACCCAGATTCAGGGTGG - Intergenic
927438395 2:23090152-23090174 GTGCCCAACCAGACTGAGGGTGG - Intergenic
927643927 2:24863236-24863258 GTGCCCACCCAGATTTAGGGTGG - Intronic
928082445 2:28323064-28323086 GTGCTCACCCTGGATGAGAGTGG - Intronic
928172726 2:29013738-29013760 GTGCCCACCCACACTGAGGATGG + Intronic
928184903 2:29101559-29101581 GTGCCCACCTGGATTGAGGGTGG + Intronic
928415953 2:31091897-31091919 GTGCCCACCCACATTGAGGGTGG - Intronic
928719028 2:34097873-34097895 GTGCCCACTCAGATTCAGAGTGG + Intergenic
928845733 2:35669557-35669579 GTGCCCACCCAGCTTGAGGGTGG + Intergenic
929032713 2:37663824-37663846 GTGCCCACCCAGATTGAGGATGG - Intronic
929269501 2:39958330-39958352 GTGCCCACCCAGATTGAGGTGGG + Intergenic
929404651 2:41627972-41627994 GTGCCCACTCAGATTGAGGGTGG - Intergenic
929881574 2:45841549-45841571 GTGCCCACCCAGATTGAGAATGG + Intronic
930294891 2:49542912-49542934 GTGCCCACCCAGATTAAGGGTGG + Intergenic
930295585 2:49549097-49549119 GTGCCCACCCAGATTAAGAGTGG + Intergenic
930997382 2:57736859-57736881 GTGCCCACCCAGATTGAGGATGG + Intergenic
931110127 2:59101307-59101329 GTGCCCACCCAGGTTGAGTGTGG + Intergenic
931518540 2:63070399-63070421 GTGCCCACCCAGATTAAGGGTGG + Intergenic
931992740 2:67807554-67807576 GTGCCCACCCAGACTGAGGGTGG - Intergenic
932176896 2:69611167-69611189 GTGCCCACCCACATTGAGGGTGG - Intronic
932561498 2:72875216-72875238 GTGCCCACCCAGATTGAGGGTGG + Intergenic
932814500 2:74851105-74851127 GTGCCCATCCACACTAAGAGGGG + Intronic
932859086 2:75269891-75269913 GTGCCCACCCAGATTGAGGGTGG + Intergenic
932936189 2:76104938-76104960 GGGCCCACCCAGATTGAGGGTGG - Intergenic
933067780 2:77819595-77819617 GTGCCCACCCAGAGTGAAGGTGG - Intergenic
933105819 2:78323830-78323852 GTGCCCACCCAGATTAAGGGTGG + Intergenic
933265399 2:80175996-80176018 GTGTCCACCCAGATTGAGGGTGG + Intronic
933311645 2:80668351-80668373 GTGCCCACCCAGAATGAAGGTGG - Intergenic
933344648 2:81067270-81067292 GTGCCCACCCAGATTGACAGTGG + Intergenic
933549848 2:83762674-83762696 GTGCCCACCCAGATTAAGGGTGG - Intergenic
933588793 2:84208787-84208809 GTGCCCACCCAGATTGAGGGTGG - Intergenic
934151191 2:89149201-89149223 GTGCCCACCCAGATTGAGGGTGG - Intergenic
934216069 2:90032706-90032728 GTGCCCACCCAGATTGAGGGTGG + Intergenic
934315125 2:91910932-91910954 GTGCCCACCCACATTGAGGGTGG + Intergenic
935444077 2:103137882-103137904 GTGCCCACCCAGACTGAGGGTGG - Intergenic
935526265 2:104171693-104171715 GTGCCCACCCACATTGAGGGTGG - Intergenic
935824950 2:106936650-106936672 GTGCCTACCCAGATTGAGGGTGG + Intergenic
935882927 2:107584437-107584459 CTGCCCACCCAGACTGAGGGTGG + Intergenic
936429968 2:112454173-112454195 GTGCCCACCCACACTGAGGGTGG + Intergenic
936873732 2:117163575-117163597 GTGCCCACCCAGACTGAGGGTGG + Intergenic
936940548 2:117879599-117879621 GTGCCCACCCAGATTGACGGTGG - Intergenic
937068275 2:119037345-119037367 GTGCCCACCCAGATTAAGGGTGG - Intergenic
937313373 2:120915753-120915775 GTGCACACCAGGGCTGGGAGAGG - Intronic
937732641 2:125252929-125252951 GTGCCCACCCAGGTTGAGGGTGG + Intergenic
937759674 2:125585927-125585949 GTGCCCACCCAGACTGAGGGTGG + Intergenic
937765940 2:125660586-125660608 GTGCCCACCCAGATTGAGGGTGG - Intergenic
938151417 2:128888438-128888460 GTGCCCACCCAGATTAAGGGTGG - Intergenic
938272459 2:129985949-129985971 GTGACCACCCAGACTGAGGGTGG - Intergenic
938443775 2:131360160-131360182 GTGACCACCCAGACTGAGGGTGG + Intergenic
938509102 2:131921386-131921408 GTGCCCACCCAGATTGAGGGTGG + Intergenic
938574423 2:132590902-132590924 GTGCCCACCCAGGTTGAGGGTGG - Intronic
938683338 2:133713928-133713950 GTGCCCACTCAGATTGAGGGTGG - Intergenic
939068636 2:137514269-137514291 GTGCCCACCCGGATTGAGGGTGG - Intronic
939227074 2:139377728-139377750 GTGCCCACCCATATTGAGGGTGG + Intergenic
939336772 2:140839427-140839449 GTGCCCACCCAGATTGAGGGTGG - Intronic
939410333 2:141816303-141816325 GTGCCCACCTAGACTGAGGGTGG - Intronic
939774053 2:146362306-146362328 GTGCCCACCCAGACTGCCAGTGG - Intergenic
939805780 2:146774784-146774806 GTGCCCACCCAGAATGAGGGTGG - Intergenic
939806544 2:146780940-146780962 GTGCCCACCCAGAATAAGTGTGG - Intergenic
940319214 2:152357994-152358016 GTGCCCACCCAGATTGAGGGTGG - Intronic
940452205 2:153853235-153853257 GTGCCCACCCAGATTGGGGGTGG + Intergenic
940460024 2:153953011-153953033 GTGCCCACTCAGATTGAGGGTGG + Intronic
940471776 2:154110646-154110668 GTGCCCACCCTGATTAAGGGTGG + Intronic
940473647 2:154132069-154132091 GTGCCCACCCAGATTGAGGGTGG + Intronic
940646454 2:156397611-156397633 GTGCCCACCCACATTGAGAGTGG + Intergenic
940855477 2:158725676-158725698 GTCTCCATCAGGACTGAGAGTGG + Intergenic
941039133 2:160600627-160600649 GTGCCCACCCAGACTGAGGGTGG - Intergenic
941068579 2:160930633-160930655 GTGCCCACCCAGATTAAGGGTGG - Intergenic
941241303 2:163041685-163041707 GTGCCCACCCAGATTAAGGGTGG - Intergenic
941283120 2:163577678-163577700 GTGCCCACCCAGATTGAGAGTGG - Intergenic
941520611 2:166537398-166537420 GTGCCCACCCACATTGAGGGTGG + Intergenic
941822984 2:169861122-169861144 GTGTCCACCCAGAATGAGGGTGG + Intronic
942493337 2:176511774-176511796 GTGCCCACCCAGATTAAGGGTGG + Intergenic
942802556 2:179892413-179892435 GTGCCCATCCTTACTGAGATTGG - Intergenic
942830245 2:180231646-180231668 GTTCCCACCCAGATTAAGAGTGG - Intergenic
942923710 2:181407980-181408002 GTGCCCACCCAGATTAAGGGTGG + Intergenic
943076806 2:183205786-183205808 GTGCCCACTCAGATTGAGGGTGG - Intergenic
943080251 2:183251297-183251319 GTGTCCACCCAGACTGAGGGTGG + Intergenic
943100902 2:183484972-183484994 GTGCCCACACAGACTGAGGGTGG - Intergenic
943170062 2:184386504-184386526 GTGCCCACCCAGATTGAGAGTGG - Intergenic
943182630 2:184562435-184562457 GTGCTCACCCAGATTGAGGGTGG - Intergenic
943198162 2:184782369-184782391 GTGCCCACCCAGATTAAGGGTGG - Intronic
943238967 2:185360511-185360533 GTGCCCACCCAAATTAAGAGTGG + Intergenic
943301728 2:186211221-186211243 GTGCCCACCCAGATTGAGGGTGG + Intergenic
943317619 2:186409858-186409880 GTGCCCACCCAGATTAAGGGTGG + Intergenic
943384468 2:187184464-187184486 GTGCCCACCCAGATTAAGGGTGG + Intergenic
943385584 2:187200751-187200773 GTGCCCACCCAGATTGAGGGTGG + Intergenic
943386152 2:187205710-187205732 GTGCCCACCCTGATTGAGGGTGG + Intergenic
943451195 2:188044373-188044395 GTGCCCACCCAGACAGAGGGTGG - Intergenic
943518032 2:188910734-188910756 GTGCCCACCCAGATTAAGGGTGG + Intergenic
943636250 2:190309977-190309999 GTGCCCACTCAGACTGAGGGTGG - Intronic
943788873 2:191909511-191909533 GTGCCCACCCAGATTAAGGGTGG + Intergenic
943830905 2:192460540-192460562 GTGCCCACTCAGATTGAGGGTGG + Intergenic
943833684 2:192491825-192491847 GTGCCCACCCAGATTAAGGGTGG - Intergenic
943884978 2:193205024-193205046 GTGCCTACCCAGATTGAGGGTGG - Intergenic
943922675 2:193729492-193729514 GTGCCCACCCAGATTGAGGGTGG - Intergenic
944021528 2:195111089-195111111 GTGCCCACCTAGATTGAGGGTGG - Intergenic
944076889 2:195742980-195743002 GTGTCCACCCACACTGAGGGTGG - Intronic
944422309 2:199544459-199544481 GTGCCCACCCAGATTGAGGGTGG + Intergenic
944424292 2:199563328-199563350 GTGCCCACCCATATTGAGGGTGG + Intergenic
944579376 2:201118488-201118510 GACCCCACCAGGACTGAGTGGGG - Intronic
944584862 2:201164607-201164629 GTGCCCACCCAGATTGAGGATGG + Exonic
944619394 2:201498498-201498520 GTGCCCACCCACATTGAGGGTGG + Intronic
944713263 2:202354883-202354905 GTGCCTACCCAGATTGAGGGTGG + Intergenic
944745423 2:202650869-202650891 GTGCCCACCCTGATTGAGGGTGG + Intronic
945333054 2:208561549-208561571 GTGCCCACCCAGATTGAGGGTGG + Intronic
945344901 2:208701765-208701787 GTGCCCACCCAGATTGAGGGTGG + Intronic
945377811 2:209099612-209099634 GTACCCACCCAGATTGAGGGTGG + Intergenic
945725167 2:213465966-213465988 GTGCCCACCCAGATTGAGGGTGG - Intronic
945732171 2:213552751-213552773 GTGCCCACCCAGATTGAGGGTGG - Intronic
945739440 2:213642533-213642555 GTGCCCACTCAGATTAAGAGTGG - Intronic
946523919 2:220497324-220497346 GTGCCCACCCAGAATGAGGGTGG + Intergenic
946533042 2:220594144-220594166 GTGCCCACACAGACTGAGGGTGG - Intergenic
946533809 2:220605437-220605459 GTGCTCACCCAGATTGAGGGTGG + Intergenic
946556189 2:220860351-220860373 GTGCCCACTCTGATTGAGGGTGG - Intergenic
946569711 2:221010284-221010306 GTGCCCACCCAGATTGAAGGTGG - Intergenic
946790461 2:223296051-223296073 GTGCCCACCCACACTGAAGGTGG - Intergenic
946847254 2:223870234-223870256 GTGCCCACCCAGACTGAGGGTGG - Intronic
946901502 2:224377322-224377344 GTGCCCACCCAGACTGGGGGTGG - Intergenic
946977421 2:225168783-225168805 GTGCCCACGCAGATTGAGGGTGG - Intergenic
947015375 2:225613396-225613418 GTGCCCACCCACATTGAGGGTGG + Intronic
947028090 2:225761796-225761818 GTGCCCACCCAGACTGAGGGTGG - Intergenic
947030630 2:225788988-225789010 GTGCCCACCCAGCTTGAGGGTGG + Intergenic
947057454 2:226122710-226122732 GTGCCCACCCAGATTGAGGGTGG + Intergenic
947067202 2:226241078-226241100 GTGCCAACCCAGATTGAGGGTGG - Intergenic
947255961 2:228164021-228164043 GTGCCCACCCACACTGGGAGTGG - Intronic
947294862 2:228619126-228619148 GTGCCCACCCAGATTGAGGGTGG - Intergenic
947356333 2:229299851-229299873 GTGCCCACACAGACTGAGTGTGG - Intergenic
947439398 2:230105184-230105206 GTGACCACCCAGATTGAGGGTGG + Intergenic
947843155 2:233221817-233221839 GTGCCCACCCACAGTGAGTGTGG + Intronic
947921041 2:233874531-233874553 GTGCCCACCCAGACTGAGGGTGG - Intergenic
948131034 2:235600752-235600774 ATGCCCACCCAGATTGAGGGTGG + Intronic
948344701 2:237285943-237285965 GTGCCCACCCACATTGAGGGTGG - Intergenic
948460732 2:238128797-238128819 GTGCCCACGCGGGATGAGCGCGG + Exonic
948558854 2:238837022-238837044 GTCCCCTCCCAGACTGAGGGTGG + Intergenic
1170084142 20:12510346-12510368 GTGTCCACCCAGATTGAGGGTGG - Intergenic
1170479804 20:16754562-16754584 GTGCCCACCCAGATTGAAGGTGG - Intronic
1170503853 20:17003716-17003738 GTGCCCACCCAAATTGAGGGTGG + Intergenic
1171236244 20:23527518-23527540 GTGCCCACCCACACTGAGGGTGG - Intergenic
1171252507 20:23659779-23659801 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1173458746 20:43224883-43224905 GTGCCCACGCACGCTGAGAGTGG + Intergenic
1173462980 20:43258831-43258853 GTGTCCACCCAGATTGAGGGTGG - Intergenic
1173642941 20:44616224-44616246 GTGCCTCCCCGGTCTGGGAGGGG - Intronic
1173709583 20:45142815-45142837 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1174094535 20:48077795-48077817 GTGCCCACCCAGACTGAGGGTGG + Intergenic
1174103521 20:48145607-48145629 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1174288386 20:49488808-49488830 GTGCCCACCCACACTGAGGGTGG - Intergenic
1174666184 20:52260159-52260181 GTGCCCACCCAAATTGAGAGTGG - Intergenic
1174698040 20:52580029-52580051 GTGCCCACCCAGATTGAGGATGG + Intergenic
1174699109 20:52589986-52590008 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1174748712 20:53090241-53090263 GTGCCCACCCAGACTGAGGGTGG + Intronic
1174853458 20:54019630-54019652 GTGCCCACCCACATTGAGGGTGG - Intronic
1175029338 20:55936881-55936903 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1175735490 20:61384127-61384149 GTGCCCACCCAGACTGAGGGTGG + Intronic
1176124916 20:63471102-63471124 GCGCCCACCTGGGCCGAGAGGGG - Intronic
1176253862 20:64140435-64140457 GCGCCCACCCGGCCTGAGAACGG - Intergenic
1176276783 20:64276956-64276978 GTGCCCACCCAGACTGAGGGTGG + Intronic
1176419980 21:6506313-6506335 GTGCCCACCCACACTGAGGGTGG - Intergenic
1176525290 21:7861740-7861762 GTGCCCACCCAGATTAAGAGTGG - Intergenic
1176587399 21:8601425-8601447 GTGCCCACCCACATTGAGGGTGG + Intergenic
1176784383 21:13237153-13237175 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1176791383 21:13323667-13323689 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1176895841 21:14377652-14377674 GTGCCCACCCAGATTGAGGGTGG - Intronic
1176921856 21:14697436-14697458 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1177027565 21:15938441-15938463 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1177028845 21:15956247-15956269 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1177139108 21:17339783-17339805 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1177232448 21:18340172-18340194 GTGCCTACCCAGACTGAGAGTGG - Intronic
1177325845 21:19587689-19587711 GTGCCCACTCAGACTGAGGGTGG - Intergenic
1177342835 21:19826995-19827017 GTGCCCACCCAGATTGAAGGTGG + Intergenic
1177389022 21:20442971-20442993 GTGCCCACCTGGGTTGAGGGCGG - Intergenic
1177389681 21:20451521-20451543 GTGCCCACCCAGATTGAGGCTGG - Intergenic
1177458685 21:21380064-21380086 GTGCCCACCCAGATTAAGGGTGG + Intronic
1177478783 21:21659236-21659258 ATGCCCACCCAGATTGAGAGTGG + Intergenic
1177514785 21:22135197-22135219 GTGGCCACCCAGATTGAGGGTGG - Intergenic
1177538288 21:22458392-22458414 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1177680960 21:24370233-24370255 GTGCCCACCCAGACTGAGCGTGG - Intergenic
1177737868 21:25115663-25115685 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1177760899 21:25401275-25401297 GTGCCCACCCAGATTAAGGGGGG - Intergenic
1177894722 21:26845339-26845361 GTGCGCTACCGGACGGAGAGGGG - Exonic
1177899085 21:26891547-26891569 GTGCCCACCCAAATTGAGGGTGG - Intergenic
1177943785 21:27442975-27442997 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1177971048 21:27790054-27790076 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1177982433 21:27931015-27931037 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1177997141 21:28115053-28115075 GTGTCCACCCAGATTGAGGGTGG + Intergenic
1178057713 21:28818111-28818133 GTGCTCACCCAGATTGAGGGTGG - Intergenic
1178061713 21:28860185-28860207 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1178106362 21:29323575-29323597 GTGCCCACCCATATTGAGGGTGG + Intronic
1178167494 21:29996581-29996603 GTGCCCACCCAGATTGAGGACGG - Intergenic
1178192412 21:30299790-30299812 GTGCCCATCCAGATTGAGGGTGG + Intergenic
1178260666 21:31097280-31097302 GTGCCCACCTAGATTGAGGGTGG + Intergenic
1178284249 21:31311854-31311876 ATGCCCACCCAGATTGAGGGTGG - Intronic
1178339848 21:31777039-31777061 GTGCCCACCCAGATTAAGAGTGG - Intergenic
1178370700 21:32024915-32024937 GTGCCTACCCAGATTGAGGGGGG + Intronic
1178496388 21:33089895-33089917 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1178513324 21:33225723-33225745 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1178659310 21:34491753-34491775 GTGCCCACCCAGATTAAGAGTGG - Intergenic
1179282825 21:39949692-39949714 GTACCCACCCAGATTGAGGGTGG - Intergenic
1179327709 21:40365217-40365239 GTGCCCACCCAGATTGAGGGTGG - Intronic
1179436383 21:41364900-41364922 GTGCCCACCTAGACTGAAGGTGG + Intronic
1179467959 21:41590355-41590377 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1179695471 21:43114633-43114655 GTGCCCACCCACACTGAGGGTGG - Intergenic
1179796118 21:43784805-43784827 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1180241528 21:46510310-46510332 GTGCCCACCCAGATTTAGGGTGG + Intronic
1180270230 22:10578422-10578444 GTGCCCACCCACATTGAGGGTGG + Intergenic
1180462631 22:15580194-15580216 GTGACCACCCAGACTGAGGGTGG + Intergenic
1180541885 22:16456816-16456838 GTGCCCACCCACATTGAGGGTGG + Intergenic
1180592293 22:16950912-16950934 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1182193554 22:28490110-28490132 GTGCCCACCCAGATTAAGATGGG + Intronic
1182535049 22:30994794-30994816 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1182853427 22:33496225-33496247 GTCCCCACCCAGATTGAGGGTGG + Intronic
1182907612 22:33951552-33951574 ATGCCCACCCAGATTGAAAGTGG + Intergenic
1182962683 22:34490321-34490343 GTGCCCACCCAGACTGAGGGTGG + Intergenic
1182966002 22:34521562-34521584 GTGCCCACCCAGATTAACAGTGG - Intergenic
1183860274 22:40664881-40664903 GTGCCCACCCACACTGAGGGCGG - Intergenic
1184380364 22:44141522-44141544 GTGCCCACCTGGATTAAGGGTGG + Intronic
1184604025 22:45561975-45561997 GTGCCCACCCAGATTAAGGGTGG + Intronic
1184914493 22:47559705-47559727 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1184963768 22:47951505-47951527 GTGCCCACCCAGATTAAGTGTGG + Intergenic
949140018 3:620632-620654 GTGCCCACCCACATTGAGGGTGG - Intergenic
949306036 3:2642330-2642352 GTGCCCACCCAGATTGAGGGTGG + Intronic
949412669 3:3782869-3782891 GCGCCCACCCAGATTGAGGGTGG + Intronic
949445928 3:4133542-4133564 GTGCCCACCCAGATTAAGGGTGG - Intronic
949633601 3:5957340-5957362 GTGCCCACTCAGATTGAGGGTGG - Intergenic
949637271 3:5996530-5996552 GTGCCTACCCAGATTGAGGGTGG + Intergenic
949659130 3:6256870-6256892 GTTCCCACCCAAATTGAGAGTGG - Intergenic
949844507 3:8356275-8356297 GTGCCCACCTAGATTGAGGGTGG - Intergenic
949846690 3:8378239-8378261 GTGCCCACCCAGATTAAGGGTGG - Intergenic
950348969 3:12328307-12328329 GCCCCCACCAGGAATGAGAGGGG - Intronic
950588960 3:13921621-13921643 GTGCTCACCCAGATTGAGGGTGG - Intergenic
950709729 3:14805664-14805686 ATGCTCACCCAGGCTGAGAGAGG - Intergenic
950908362 3:16559886-16559908 GTGCCCACCCAAATTGAGGGTGG - Intergenic
951003888 3:17594974-17594996 GTGCCCACCCAGATTAAGGGTGG - Intronic
951086855 3:18521769-18521791 GTGCCCACCCAGGTTAAGAGTGG - Intergenic
951112639 3:18822970-18822992 GTGCCCACCCAGATTGAGGGTGG + Intergenic
951112647 3:18823005-18823027 GTGCCCACCCAGATTGAGGGTGG + Intergenic
951302093 3:21010289-21010311 GTGCCCAACCGGATTGAAGGTGG - Intergenic
951353585 3:21636656-21636678 GTGCCCACCCAGATTAAGGGTGG + Intronic
951400678 3:22228727-22228749 GTGCTTACCCAGATTGAGAGTGG - Intronic
951730455 3:25805093-25805115 GTGCCCACCCAGATTAAGGGTGG + Intergenic
951971333 3:28447867-28447889 GTGCCCAGGCAGACTTAGAGGGG + Intronic
951987999 3:28642382-28642404 GTACCCACCCAGATTAAGAGTGG + Intergenic
951993524 3:28702050-28702072 GTGCCCACTCTGATTGAGGGTGG + Intergenic
952313095 3:32208150-32208172 GTGCCCACCCAGACTGAGGGTGG + Intergenic
952642860 3:35619252-35619274 GTGCCCACCCAGATTGAGGGTGG - Intergenic
953180691 3:40591677-40591699 GTGCCCACCCAGATTAAGGGTGG + Intergenic
953225006 3:41010497-41010519 GTGCCCACCCAGATTAAGGGTGG + Intergenic
953245053 3:41183269-41183291 GTGCCCACCCACATGGAGAGTGG - Intergenic
955032205 3:55232411-55232433 GTGCCCACCCACACTGAGGGTGG - Intergenic
955489952 3:59471971-59471993 GTGCCCACCCAGAATGAGGGTGG + Intergenic
955499056 3:59565989-59566011 GTGCCCACCCAGATTGAGCATGG - Intergenic
955535212 3:59916112-59916134 GTGCCCACCAAGATTGAGGGTGG - Intronic
955978380 3:64499519-64499541 GTGCCCACTCAGACTGAGGGAGG + Intergenic
956216273 3:66852626-66852648 GTGCCCACACAGATTGAGAGTGG + Intergenic
956314142 3:67915238-67915260 GTGCCCACCCAGATTGAGGGTGG + Intergenic
956320510 3:67991469-67991491 GTGCCCACCCACATTGAGGGTGG - Intergenic
956363298 3:68471674-68471696 GTGCCCACCCAAATTGAGGGTGG + Intronic
956364751 3:68488369-68488391 GTGCCCACTCAGATTGAGGGTGG + Intronic
956388424 3:68745979-68746001 GTGCCCACCCAGATTAAGGGTGG - Intronic
956898047 3:73683938-73683960 GTGCCCACCACCACTGAGGGTGG + Intergenic
957117900 3:76050144-76050166 GTGCCCACCCAGATTGAGGGTGG - Intronic
957123964 3:76133820-76133842 GTGCCCACCCAGATCGAGGGTGG + Intronic
957242345 3:77675170-77675192 GCGCCCACCCAGACTGAGGGTGG - Intergenic
957452149 3:80393036-80393058 GTGCCCACCCAGATTGAGGGTGG + Intergenic
957453864 3:80415763-80415785 GTGCCCACCCAGACTGAGGGTGG + Intergenic
957483460 3:80828312-80828334 GTGCCCACACACATTGAGAGTGG - Intergenic
957633981 3:82758449-82758471 GTGCCCACCCAGATTAAGGGTGG - Intergenic
957656617 3:83086592-83086614 GTGCCCACCCAGACTGACGGTGG - Intergenic
957712275 3:83877041-83877063 GTGCCCACCCACATTGAGGGTGG - Intergenic
957750424 3:84408081-84408103 GTGCCCACCCACAATGAGGGTGG + Intergenic
957851933 3:85819264-85819286 GTGCCCACCCACATTGAGAGTGG + Intronic
958494788 3:94830643-94830665 GTGCCCACCCAGATTAAGGGTGG + Intergenic
958601960 3:96306089-96306111 GTGCCCACCCAGATTGAGGGTGG + Intergenic
958778138 3:98509979-98510001 GTGCCCACCCAGACTGAGGGTGG + Intronic
958806599 3:98818623-98818645 GTGCCGACCCAGATTGAGGGTGG - Intronic
958829365 3:99068625-99068647 GTGCCCACTCAGATTGAGGGTGG - Intergenic
958845923 3:99263918-99263940 GTGCCCACCCAGATTAAGAGTGG + Intergenic
958877541 3:99633227-99633249 GTGCCCACCTGCACTGAGGGTGG - Intergenic
958879567 3:99654234-99654256 GTGCCCACCCAGATTGAGGGTGG + Intronic
959153271 3:102633122-102633144 GTGCCCACCCAGATTAAGGGTGG + Intergenic
959154480 3:102649871-102649893 GTACCCACCCAGATTGAGGGTGG + Intergenic
959208604 3:103345794-103345816 GTGCTCACCCAGATTAAGAGTGG + Intergenic
959291457 3:104479745-104479767 GTGCCCACCCAGATAGAGAGTGG + Intergenic
959456847 3:106573289-106573311 GTGCCCACCCAGATTAAGTGTGG + Intergenic
959472775 3:106773259-106773281 GTGCCCACCCAGATTAAGGGTGG - Intergenic
959649996 3:108742260-108742282 GTGCCCACCCAGATTGAGGGTGG + Intergenic
959696795 3:109256770-109256792 CTGCCCACCCAGAATGAGGGTGG + Intergenic
959748870 3:109809789-109809811 GTGCCCACCAGGATTGAGGATGG + Intergenic
959775107 3:110150195-110150217 GTGCCCACCCAGACTGAGAGCGG - Intergenic
959868780 3:111302816-111302838 GTGCCCACACAGACTGAGAGTGG + Intronic
960060987 3:113320849-113320871 GTGCCCACCCAGATTAAGGGTGG + Intronic
960115002 3:113885057-113885079 GGGCCCACATGGACTGGGAGTGG - Intronic
960296518 3:115951581-115951603 GTGGCCACCCAGATTGAGGGTGG - Intronic
960318932 3:116210313-116210335 GTGCCCACTCAGACTGAGGATGG - Intronic
960478012 3:118154344-118154366 GTGCCCACCCAGATTGAGGGTGG + Intergenic
960531551 3:118771306-118771328 GTGCCCACCCAGATTGAGGGTGG + Intergenic
960721938 3:120633086-120633108 CTCCCCACCCTTACTGAGAGGGG - Intronic
961149338 3:124623664-124623686 GTGCCCACCCAGAGTAAGGGTGG + Intronic
961733394 3:128984327-128984349 GTGCCCACCCAGCTTGAGGGTGG - Intronic
961961311 3:130858150-130858172 GCGCCCACCCAGATTGAGGGTGG + Intronic
962031399 3:131604512-131604534 GTGCCCACCCAGACTAAGGGTGG - Intronic
962075782 3:132080501-132080523 GTGCCCACCCAGATTGAGGGTGG - Intronic
962447089 3:135475904-135475926 ATGCCCACCCAGATTGAGGGTGG + Intergenic
962474615 3:135744229-135744251 GTGCCCACCCAGATTAAGGGTGG - Intergenic
963067131 3:141272830-141272852 GTGCCCACCCAGATTGAGGGTGG + Intronic
963217533 3:142766288-142766310 GTGCCCACCCAGATTAAGGGTGG - Intronic
963332448 3:143930339-143930361 GTACCCACCCAGATTGAGAGTGG + Intergenic
963346030 3:144097456-144097478 GGGCCCACCCCTACTGAGTGTGG + Intergenic
963369446 3:144379605-144379627 GTGCCCACCCAGATTGAGGGTGG + Intergenic
963432786 3:145230846-145230868 GTGCCCACCCAGATTAAGGGGGG + Intergenic
963460824 3:145612874-145612896 GTGCCCACCCAGATTGAGAATGG - Intergenic
963488794 3:145972544-145972566 GTGCCCACCCAAATTGAGGGTGG - Intergenic
963512793 3:146269710-146269732 GTGCCCACCCAGATTAAGGGTGG + Intergenic
963538638 3:146559994-146560016 GTGCTCACCCAGATTGAGGGTGG + Intergenic
963549264 3:146700101-146700123 GTGCCCACCCAGATTGAGGGTGG + Intergenic
963566422 3:146937110-146937132 GTGCCCACCCAGATTAAGGGTGG - Intergenic
963574866 3:147047564-147047586 GTGCCCACCCAGATTAAGGGTGG - Intergenic
963615997 3:147538979-147539001 GTGCCCACCCAGATTGAGGGTGG - Intergenic
963929217 3:150984774-150984796 GTGCCCATCCACATTGAGAGTGG - Intergenic
964175533 3:153823158-153823180 GTGCCCATCCAGATTGAGGGTGG + Intergenic
964646613 3:158964967-158964989 GTGCCCACTCAGATTGAGGGTGG + Intronic
964828449 3:160856160-160856182 GTGCCCACCGAGATTGAGAGTGG + Intronic
964977653 3:162639642-162639664 GTGCCCACCCCGACTAAGGGTGG + Intergenic
965034960 3:163426132-163426154 GTGCCCACCCGGATTAAGGGTGG + Intergenic
965071093 3:163916346-163916368 GTGTCCACCCAGATTGAGGGTGG - Intergenic
965138470 3:164804900-164804922 GTGCCCACCCAGATTAAGGGTGG + Intergenic
965219781 3:165914092-165914114 GTGCCCACCCAGATTAAGGGTGG + Intergenic
965251932 3:166353335-166353357 GTGCCCACCCAGATTCAGGGTGG + Intergenic
965266476 3:166550194-166550216 TTGCTCACCCAGACTGAGAGTGG - Intergenic
965291447 3:166887089-166887111 GTGCCCACCCAGATTAAGGGTGG + Intergenic
965299360 3:166990476-166990498 GTGCCCACCCAGATTAAGGGTGG + Intergenic
965374550 3:167907102-167907124 GTGCCCACCCACACTGGGTGAGG - Intergenic
965446699 3:168781959-168781981 GTGCCCACCCAGATTAAGGGTGG + Intergenic
965707373 3:171522593-171522615 GTGCCCACCCAAATTGAGGGTGG - Intergenic
965736340 3:171824792-171824814 GTGCCCACCCACATTGAGGGTGG + Intergenic
965951037 3:174308534-174308556 GTGCCCACACAGATTGAGGGTGG + Intergenic
965996292 3:174886371-174886393 GTGCCCACCCAGATTAAGGGTGG + Intronic
966107234 3:176350839-176350861 GTGCCCACCTGGATTGTGGGTGG + Intergenic
966169279 3:177059818-177059840 GTTCCCACCCAGATTGAGGGTGG - Intronic
966221573 3:177556828-177556850 GTGCCCACCCAGATTGGGGGTGG - Intergenic
966262559 3:177997223-177997245 GTGCCCACCCAGATTGAGGTCGG - Intergenic
966272263 3:178121505-178121527 GTGCCCACCCAGATTGAGGGTGG + Intergenic
966446013 3:180001053-180001075 GTGCCCACCCAGATTAAGGGTGG - Intronic
967195030 3:187018644-187018666 GTGCCCACCCAGATTAAGGGTGG + Intronic
967204406 3:187106532-187106554 GTGCCCACCCAGATTGAGGATGG - Intergenic
967403181 3:189086302-189086324 GTGCCCACCCAGATTGTGGGTGG + Intronic
967612925 3:191529135-191529157 GTACCCACCCAGATTGAGAGTGG + Intergenic
967742496 3:193018710-193018732 GTGCCCACCCAGATTGAGGGTGG - Intergenic
967745209 3:193047441-193047463 GTGCCCACCCAGATTGAGGGTGG - Intergenic
967758398 3:193196432-193196454 GTGCCCACCCAGATTGAGGGTGG + Intergenic
967760355 3:193217323-193217345 GTGCCCACCCACATTGAGGGTGG + Intergenic
967764007 3:193257743-193257765 GTGCCCACCCAGATTGAGGGTGG - Intronic
967776647 3:193392545-193392567 GTGGCCACACAGACTGTGAGAGG - Intergenic
968430811 4:557313-557335 GTGCCCACCCAGATTGAGGGTGG - Intergenic
968800620 4:2741219-2741241 GTGCCCACCCCGATTGAGGGTGG - Intergenic
969035908 4:4253593-4253615 GTGCCCACCCAGATTGAGGGTGG - Intergenic
969071813 4:4545732-4545754 GTACCCACCTAGATTGAGAGTGG + Intergenic
969076554 4:4583462-4583484 GTGCCCACCCAGAGTGAGGGTGG - Intergenic
969082772 4:4632692-4632714 GTGCCCACCCAGATTGAGGGTGG - Intergenic
969162169 4:5270422-5270444 GCGCCCACCCAGATTGAGGGTGG + Intronic
969284283 4:6193016-6193038 GTGCCCACCCACACTGAGGGTGG - Intronic
969605602 4:8200830-8200852 GTGACCACCAGGGCGGAGAGTGG - Intronic
969608806 4:8215913-8215935 CTGACCACCCGGGCTGTGAGAGG - Intronic
969615288 4:8248580-8248602 GTGCCCACCCAGATTAAGGGTGG - Intergenic
969672731 4:8598597-8598619 GAGCCCACCTGGCCAGAGAGGGG - Intronic
969983817 4:11186631-11186653 GTGCCCACCCAGATTGAGGGTGG - Intergenic
970082080 4:12298977-12298999 GTGCCCACCCACAGTGAGGGTGG + Intergenic
970329235 4:14962224-14962246 GTGCCCACACAGATTGAGAGTGG + Intergenic
970477407 4:16437594-16437616 GTGCCCACCCAGATTGAGGATGG + Intergenic
970629066 4:17921772-17921794 GTGCCCACCCAGACTGAGGGTGG - Intronic
970629657 4:17926298-17926320 GTGCCCACCAAGATTGAGGGTGG - Intronic
970704543 4:18784110-18784132 GTGCCCACCCAGATTAAGTGTGG - Intergenic
970733893 4:19142756-19142778 GTGCCCACCCAGACTTAGGGTGG - Intergenic
970785741 4:19794021-19794043 GTGCCCATTCAGACTGAGGGTGG - Intergenic
970821457 4:20220098-20220120 GTGCCCACCCAGATTAAGGGTGG + Intergenic
970831664 4:20346927-20346949 GTACCCACCCGGATTGAGGATGG + Intronic
970931755 4:21520139-21520161 GTGCCCACCCAGATTAAGACTGG + Intronic
970935803 4:21568507-21568529 GTGCCCACCCAGATTGAGGGTGG - Intronic
971043082 4:22776829-22776851 GTGCCCACCCAGATTAAGGGTGG + Intergenic
971051453 4:22867162-22867184 GTGCCCACCCACACTGAGGGTGG - Intergenic
971078884 4:23183927-23183949 GTGCCCACCCACACTGAGGATGG + Intergenic
971126753 4:23762845-23762867 GTGCCCACCCAGATTAAGGGTGG - Intronic
971189132 4:24410631-24410653 GTGCCCACCCAGATTGAGGGTGG - Intergenic
971209311 4:24600578-24600600 GTGCCCACCCAGATTAAGGGTGG - Intergenic
971563903 4:28115393-28115415 GTGCCCACCCACAGTGAGGGTGG - Intergenic
971610986 4:28726246-28726268 GTGCTCACCCGGATTAAGGGTGG + Intergenic
971790764 4:31167470-31167492 GTGCCCACCCAGACTGAGGGTGG + Intergenic
971816802 4:31501454-31501476 GTGCCCACCCAGATTAAGGGTGG - Intergenic
971836373 4:31768258-31768280 ATGCCCACCCAGATTGAGGGTGG + Intergenic
971857685 4:32063085-32063107 GTGCCCACCCAGATTGAGGGTGG - Intergenic
971935612 4:33143520-33143542 GTGCCCACCCCGATTGAGGGTGG + Intergenic
972034218 4:34500397-34500419 GTGCCCATCCAGATTGAGGGTGG + Intergenic
972039779 4:34578631-34578653 GTGCCCACCCAGACTGAGGGTGG - Intergenic
972073757 4:35057089-35057111 GTGCCCACCCAGACTGAGGATGG - Intergenic
972095798 4:35345293-35345315 GTGCCCACCCAGATTAAGGGTGG - Intergenic
972116846 4:35646705-35646727 GTGCCCACTCAGATTGAGGGTGG + Intergenic
972121433 4:35709428-35709450 GTGCCCACCCAGATTGAAGGTGG + Intergenic
972123929 4:35740372-35740394 GTGCCCACCCAGATTGAGGGTGG - Intergenic
972178163 4:36433123-36433145 GTGCCCACCCAGACTGAGAATGG + Intergenic
972676943 4:41269112-41269134 GTGCCCACGCAGATTGAGGGTGG + Intergenic
972786829 4:42334074-42334096 GTGCCCACCCAGATTGAGGGTGG + Intergenic
972805512 4:42526466-42526488 GTGCCCACCCAGATTAAGGGTGG - Intronic
972882669 4:43445682-43445704 GTGCCCACCCAGACTGAGGGTGG + Intergenic
972921479 4:43947715-43947737 GTGCCCACCCAGATTAAGGGTGG - Intergenic
972942775 4:44217612-44217634 GTGCCCACTCACACTGAGGGTGG - Intronic
972964742 4:44495547-44495569 GTGCCTACCCAGATTGAGGGTGG + Intergenic
973035742 4:45403886-45403908 GTGTCCACCCAGATTGAGAGTGG + Intergenic
973121485 4:46524929-46524951 GTACCCACCCAGATTGGGAGTGG + Intergenic
973260857 4:48161769-48161791 GTGCCCATCCAGATTGAGGGTGG - Intronic
973275427 4:48301938-48301960 GTGCCCACCCAGATTAAGGGTGG + Intergenic
973616402 4:52682696-52682718 GTGACCACCCAGATTGAGGGTGG + Intergenic
973638642 4:52882536-52882558 ATGCCCACCCAGATTGAGGGTGG - Intronic
974262851 4:59546246-59546268 GTGCCCACCCAGATTAAGGGTGG + Intergenic
974287049 4:59882239-59882261 GTGCCCAACCAGATTGAGGGTGG + Intergenic
974328898 4:60450928-60450950 GTGCCCACCCACATTGAGAGTGG - Intergenic
974345794 4:60679508-60679530 GTGCCTGCCCAGATTGAGAGTGG + Intergenic
974474939 4:62366391-62366413 GTGCCCCCCCAGATTGAGGGTGG - Intergenic
974478751 4:62418348-62418370 GTGCCCACTCAGACTGAGGGTGG + Intergenic
974479478 4:62424548-62424570 TTGCCCACCCAGATTGAGAGTGG + Intergenic
974508678 4:62808734-62808756 GTGCCCACCCAGATTAAGGGTGG + Intergenic
974508877 4:62810997-62811019 GTGCCCACCCAGATTAAGGGTGG - Intergenic
974565270 4:63572898-63572920 GTTCCTACCCAGATTGAGAGTGG - Intergenic
974680121 4:65149780-65149802 GTGCCCACCCAGATTGAAGGTGG + Intergenic
974738744 4:65977015-65977037 GTGCCCACCCAGATTAAGGGTGG - Intergenic
974765896 4:66345449-66345471 GTGCCCACACAGACTGAGGGTGG + Intergenic
974777882 4:66510824-66510846 GTGCCCACCCAGATTAAGGGTGG + Intergenic
974778647 4:66522206-66522228 GTGCCCACCCAGACTAAGGGTGG + Intergenic
974853422 4:67430563-67430585 GTGCCCACTCAGATTGAGGGTGG - Intergenic
975090049 4:70390724-70390746 GTGCCCACCCGGATTAAGGGTGG - Intergenic
975099913 4:70501081-70501103 GTGCCCACCCAGATTGAGGGTGG + Intergenic
975235452 4:71990177-71990199 GTGCCCACCCACATTGAGGGTGG - Intergenic
975249548 4:72162571-72162593 GTGCCCACTCAGATTGAGGGTGG + Intergenic
975257375 4:72254172-72254194 GTGCCCACCCAGATTAAGGGTGG - Intergenic
975386424 4:73765032-73765054 GTGCCCACCCAGACTGAAGGTGG + Intergenic
975394310 4:73857115-73857137 GTGCCCACCAAGATTAAGAGTGG - Intergenic
975477680 4:74842288-74842310 GTGCCCACCCAGATTAAGGGTGG + Intergenic
975681252 4:76878783-76878805 GTGCCCACCCAGATTGAGGATGG - Intergenic
975734159 4:77365653-77365675 GTGCCCACCCAGATTGAGGGTGG + Intronic
975876201 4:78839872-78839894 GTGCCCACCCAGATTAAGGGTGG + Intronic
975934485 4:79561967-79561989 GTGACCACCCACACTGAGGGTGG - Intergenic
975947917 4:79730343-79730365 GTGCCCACCCAGATTAAGGGTGG - Intergenic
976549428 4:86377957-86377979 GTGCCCACCCAGATTAAGGGTGG + Intronic
976805415 4:89040849-89040871 GTGCCCACCCAGACTGAGGGTGG - Intronic
976889149 4:90023768-90023790 GTGCCCACCCAGATTGAGTGTGG + Intergenic
976971554 4:91108922-91108944 GTGCCCACCCACACTGGGTGAGG - Intronic
977203954 4:94148956-94148978 GTGCCCACCCACATTGAGGGTGG - Intergenic
977265279 4:94846432-94846454 GTGCCCACCCAGATTAAGGGTGG - Intronic
977448647 4:97164951-97164973 GTGACCACCCAGATTGAGGGTGG + Intergenic
977449061 4:97171256-97171278 GTGCCCACCCTGATTGAGGGTGG + Intergenic
977465553 4:97379811-97379833 GTGCCCACCAAGATTGAGGGTGG - Intronic
977528775 4:98175250-98175272 GTGCCCACCCAGATTAAGGGTGG - Intergenic
977627051 4:99198954-99198976 GTGCCCACCCAGATTAAGCGTGG + Intergenic
977701423 4:100027355-100027377 GTGCCCACCCAGATTAAGGGTGG + Intergenic
977702181 4:100033475-100033497 GTGCCCACCCAGATTAAGGGTGG + Intergenic
977721945 4:100249382-100249404 GTGCCCACCCAGATAAAGAGTGG + Intergenic
977762539 4:100756695-100756717 GTGCCCACCCAGAATGAGAGTGG + Intronic
977846823 4:101776839-101776861 GTGCCCACTCAGATTGAGGGTGG - Intronic
977871676 4:102097861-102097883 GTGCCCACCCACATTGAGGGTGG - Intergenic
977899018 4:102397077-102397099 GTGCCCACCCAGATTGAGGGTGG - Intronic
977947367 4:102929022-102929044 GTGCCGACCCACACTGAGGGTGG + Intronic
978044813 4:104113449-104113471 GTGCCCACCCAGATTGAAGGTGG + Intergenic
978079393 4:104573628-104573650 GTGCCCACCCAGATTGAGGGTGG + Intergenic
978160800 4:105545717-105545739 GTGCCCACCCAGACTAAGTGTGG + Intergenic
978602086 4:110439392-110439414 GTGCCCATCCAGATTGAGGGTGG + Intronic
979039322 4:115766805-115766827 GTGCCCACCCAGATTGAGGGTGG - Intergenic
979075285 4:116262780-116262802 GTGCCCATCCAGACTAAGAATGG - Intergenic
979083857 4:116380190-116380212 GTGCCCACCCAGACTAATGGTGG - Intergenic
979187672 4:117818786-117818808 GTGCCCACCCAGATTGAGGGTGG - Intergenic
979507261 4:121512829-121512851 GTGCCCACCCAGATTAAGGGTGG + Intergenic
979644527 4:123053073-123053095 GTACCCACCCAAACTGAGGGTGG + Intronic
979887067 4:126041111-126041133 GTGCCCACCCAGATTAAGTGTGG - Intergenic
979898987 4:126193717-126193739 ATGCCCACCAAGACTGAGGGTGG + Intergenic
979918143 4:126465245-126465267 GTGTCCACCCAGATTGAGGGTGG + Intergenic
980188601 4:129494624-129494646 GTGCCCACCCAGATTGAGGGTGG - Intergenic
980217209 4:129867908-129867930 GTGCCCACCCAGATTGAGGGTGG - Intergenic
980475142 4:133304614-133304636 GTGCCCACCCAGATTGAAAGTGG - Intergenic
980497984 4:133608969-133608991 GTGCCCACCCAGATTAAGGGTGG + Intergenic
980513779 4:133826388-133826410 GTGTCCACCCAGATTGAGACTGG - Intergenic
980737357 4:136907761-136907783 CTGCCCACCAGGACAGAGATGGG - Intergenic
980792139 4:137633385-137633407 GTGCCCACCCACACTGAGGATGG - Intergenic
980868475 4:138582252-138582274 GTGCCCACCCAGATTAAGGGTGG - Intergenic
980879178 4:138692119-138692141 GTGCCCACCCAGATTAAGGGTGG + Intergenic
980933929 4:139208221-139208243 GTGCCCACCCACATTGAGGGTGG + Intergenic
980935795 4:139224566-139224588 GTGCCCACCCAGATTGAGGGAGG + Intergenic
980957274 4:139442519-139442541 GTGCCCACCCAGATTAAGGGTGG - Intergenic
981494601 4:145377203-145377225 GTTCCCCCCCAGACTGAGATAGG - Intergenic
981619131 4:146673847-146673869 GTGCCCACCCAGATTGAGGGTGG - Intergenic
981676420 4:147348194-147348216 GTGCCCACCCAGATTGAGGGTGG + Intergenic
981882066 4:149626128-149626150 GTGCCCACCCAGGCTAAGGGTGG - Intergenic
981885169 4:149665769-149665791 GTGCCTACCCAGATTGAGGGTGG - Intergenic
982162551 4:152584705-152584727 GTGCCCACCCACATTGAGGGTGG + Intergenic
982265757 4:153537012-153537034 GTGCCCACCCAGATTAAGGGTGG + Intronic
982481873 4:155921905-155921927 GGGCCCACCCAGGCTGAGGGTGG + Intergenic
982526760 4:156488781-156488803 GTGCCCACCCAGATTAAGGGTGG - Intergenic
982530948 4:156542884-156542906 GTGCCTACCCAGACTGAGAGTGG + Intergenic
982597471 4:157404574-157404596 GTGCCCACTCGCACTGAGGGTGG + Intergenic
982656130 4:158151928-158151950 GTGCCCACCCAGATTGAGGGTGG - Intronic
982783352 4:159513947-159513969 GTATCCACCCAGACTGAGGGTGG + Intergenic
982789680 4:159576478-159576500 GTGCCCACCCAGATTAAGGGTGG + Intergenic
982835026 4:160112729-160112751 GTGCCCACCCAGATTAAGGGTGG - Intergenic
982835857 4:160119142-160119164 GTGCCCACCCAGATTAAGGGTGG - Intergenic
982839298 4:160161865-160161887 GTGGCCACCCAGATTGAGGGCGG + Intergenic
982891511 4:160858132-160858154 GTGTCCACCCAGATTGAGTGTGG - Intergenic
982894565 4:160902514-160902536 GTGCCCACCCAGACTGGGGGTGG - Intergenic
983020065 4:162665306-162665328 GTGCTCACCCAGACTGAGGGTGG - Intergenic
983025767 4:162736051-162736073 GTGCCCACCCAGATTATGAGTGG - Intergenic
983267363 4:165521905-165521927 GTGCCCACCCAGATTAAGGGTGG + Intergenic
983284940 4:165727396-165727418 GTGCCCACCCAGACTGAGGGTGG + Intergenic
983459061 4:168004306-168004328 GTGCCCACCTGGATTGAGGGTGG + Intergenic
983459523 4:168010919-168010941 GTGCCCACCCAGATTGAGGGTGG - Intergenic
983701167 4:170595996-170596018 GTGCCCACCCAGATTAAGGGTGG - Intergenic
983844083 4:172494844-172494866 GTGCCCACCCGTATTGAGGGTGG + Intronic
983969154 4:173849743-173849765 GTGCCCACCCAGATTGAGGATGG + Intergenic
984061493 4:174993383-174993405 GTGCCCACCCAGATTAAGGGTGG + Intergenic
984079947 4:175235587-175235609 GTGCCCACCCAGAGTAAGGGTGG - Intergenic
984326081 4:178252767-178252789 GTGCCCACCCAGATTAAGGGTGG + Intergenic
984390897 4:179131014-179131036 GTGCCCACCCAGATTGAGGGTGG - Intergenic
984400701 4:179260511-179260533 GTGCCCAACCAGATTGAGAGTGG - Intergenic
984403673 4:179299774-179299796 GTGCCCACCCAGATTAAGGGTGG + Intergenic
984451994 4:179914194-179914216 GTGCCCACCTGGACTGAGGATGG - Intergenic
984726666 4:183028437-183028459 GTGCCCACCCACATTGAGGGTGG + Intergenic
984876591 4:184373636-184373658 GTGCCCACCCAGATTAAGGGTGG + Intergenic
984924648 4:184796076-184796098 GTGCCCACCCAGATTAAGGGTGG - Intronic
985037118 4:185851663-185851685 GTGCCCACCCAGATTAAGGGTGG - Intronic
985076339 4:186219140-186219162 GTGCCCACCCAGATTGAGGGTGG + Intronic
985678852 5:1245735-1245757 CTGCCCACCCGGACTTGGATGGG - Intronic
985832643 5:2245822-2245844 GTGCCCACCCAGATTAAGAGTGG - Intergenic
986133785 5:4955487-4955509 GTGCCCACCCAGATTGAGGGTGG + Intergenic
986147326 5:5090777-5090799 GTGCCCACACAGACTGAGGGTGG + Intergenic
986181108 5:5393690-5393712 ATGCCCACCCAGATTGAGGGTGG + Intergenic
986356364 5:6931241-6931263 GTGCCCACCCAGATTAAGTGTGG - Intergenic
986427759 5:7651603-7651625 GTGCCCACCCAGATGGAGGGTGG + Intronic
986524752 5:8662172-8662194 GTGCCCACCCACACTGAGGGTGG - Intergenic
986524838 5:8662910-8662932 GTGCCCACCCACACTGAGGGTGG - Intergenic
986763034 5:10897328-10897350 GTGCCCACCCAGATTGAGGGTGG + Intergenic
986906314 5:12497834-12497856 ATGCCCACCCAGATTGAGGGTGG + Intergenic
986960151 5:13201654-13201676 GTGCCCACCCAGATTAAGGGTGG - Intergenic
987152737 5:15058234-15058256 GTGCCCACCCAGATTAAGGGTGG - Intergenic
987153504 5:15064143-15064165 GTGCCCACCCAGATTAAGGGTGG - Intergenic
987158389 5:15114585-15114607 GTGCCCACCTAGACTGAGGGTGG + Intergenic
987189335 5:15458234-15458256 GTGCCCACCCAGATTGAGGGTGG - Intergenic
987539431 5:19235022-19235044 GTGCCCATCCAGATTGAGGGTGG - Intergenic
987560865 5:19518490-19518512 GTGCCCACCCAGATTGAGGGTGG - Intronic
987608848 5:20175809-20175831 GTGCCCACCCAGAATAAGGGTGG + Intronic
987648194 5:20703889-20703911 GTGCCCACCTGCATTGAGGGTGG + Intergenic
987680162 5:21125228-21125250 GTGCCCACCCAGATTAAGGGTGG - Intergenic
987682895 5:21160751-21160773 ATGCCAACCAGGACAGAGAGGGG + Intergenic
987683749 5:21170009-21170031 GTGCCCACCCAGATTAAGGGTGG + Intergenic
987703838 5:21437694-21437716 GTGCCCACCCAGATTAAGGGTGG - Intergenic
987707021 5:21470820-21470842 ATGCCCACCCAGATTGAGGGTGG - Intergenic
987796785 5:22638521-22638543 GTGCCCACCCAGATTGAGGGTGG + Intronic
987907401 5:24094488-24094510 GTGCCCACCTGGATTGAGGGCGG + Intronic
987920317 5:24271882-24271904 GTGCCCACCCAGACTGAGGGTGG + Intergenic
987994031 5:25251687-25251709 GTGCCCACACAGATTGAGGGTGG - Intergenic
988188347 5:27897586-27897608 GTGCCCACCCAGATTAAGGGTGG - Intergenic
988189085 5:27903723-27903745 GTGCCCACCCCGATTAAGGGAGG - Intergenic
988229065 5:28450604-28450626 GTGCCCACCCAGATTAAGGGTGG - Intergenic
988233691 5:28510656-28510678 GTGCCCACCCAGATTAAGAGTGG + Intergenic
988748135 5:34164997-34165019 GTGCCCACCCGCATTGAGGGTGG - Intergenic
988761548 5:34315502-34315524 GTGCCCACCCACATTAAGAGTGG - Intergenic
989071233 5:37513806-37513828 GTGCCCACCCAGAGTAAGGGTGG + Intronic
989200968 5:38763391-38763413 GTGCCCACCCAGATTGAGGATGG - Intergenic
989331628 5:40266712-40266734 GTGCCCACCCAGATTGAGGGTGG - Intergenic
989356691 5:40551486-40551508 GTACCCACCCAGATTGAGGGTGG - Intergenic
989757304 5:44970938-44970960 ATGCCCACCCAGACTGAGGTGGG - Intergenic
989768523 5:45115132-45115154 GTGCCCACCCAGATTAAGGGTGG - Intergenic
990031171 5:51261411-51261433 GTGCCCACCCAGACTGAGGGTGG - Intergenic
990078813 5:51886403-51886425 GTGCCCACCCAGACTAAGGGTGG + Intergenic
990099664 5:52166139-52166161 GTGCCCACCCAGATTGAGGGTGG + Intergenic
990181224 5:53162870-53162892 GTGCCCACCCAGGCTGAGGGTGG + Intergenic
990594625 5:57300463-57300485 GTGGCCACCCAGACTGAGAGTGG - Intergenic
990783357 5:59392222-59392244 GTGCCCACCCAGATTAAGAGTGG - Intronic
990921592 5:60974121-60974143 GTGCCCACCTGGACTGAGAGTGG - Intronic
991034017 5:62109607-62109629 GTGCCCACCCAGATTGAGGGTGG - Intergenic
991120240 5:63004570-63004592 GTGCCCACCCAGATTGAAGGTGG + Intergenic
991166996 5:63575070-63575092 GTGCCCACCCAAATTGAGGGTGG - Intergenic
991192838 5:63896169-63896191 GTGCCCACCCAGCTTGAGGGTGG - Intergenic
991259381 5:64650559-64650581 GTGCCCACCCAGATTGAGGGTGG + Intergenic
991330435 5:65487206-65487228 GTGCCCACCCAGCTTGAGGGTGG + Intergenic
992243274 5:74792330-74792352 GTGCCCACCTGGATTGAGGGTGG - Intronic
992641883 5:78774805-78774827 GTGCCCACCCAGATTGAGTGTGG - Intergenic
992769325 5:80032780-80032802 GTGCCTACCCAGATTGAGGGTGG + Intronic
992780439 5:80122413-80122435 GTGCCCACCCAGATTAAGAGTGG + Intronic
993229358 5:85211940-85211962 GTGCCCACCCAGACTGAGGGTGG - Intergenic
993618454 5:90140049-90140071 GTGCCCACTCAGATTGAGGGTGG + Intergenic
993780966 5:92064871-92064893 GTGCCCACCCCGATTGAGAGTGG - Intergenic
994018338 5:94994749-94994771 GTGCCCACCCAGATGGAGGGCGG - Intronic
994051867 5:95371087-95371109 GTGCCCACCCAGATTGGGGGTGG - Intergenic
994269477 5:97760109-97760131 GTGCCCACCCAGATTGAGGTTGG + Intergenic
994291057 5:98029480-98029502 GTGCCCACTCAGACTAAGAGTGG + Intergenic
994291828 5:98035579-98035601 TTGCCCACTCAGACTAAGAGTGG + Intergenic
994369636 5:98953636-98953658 GTGCCCACCCAGATTAAGAATGG + Intergenic
994700481 5:103126805-103126827 GTGCCCACCCAGATTAAGGGTGG + Intronic
994855305 5:105112555-105112577 GTGCCCACCCAGATTAAGGGTGG + Intergenic
994855849 5:105118152-105118174 GTGCCCACCCAGATTGAGGATGG - Intergenic
994917243 5:105995922-105995944 GTGCCCACCCAGATTAAGGGTGG - Intergenic
995187161 5:109283555-109283577 GTGCCCACCCAGATTGAGGGTGG + Intergenic
995291576 5:110462402-110462424 GTGCCCACCCAGATTGAGGGGGG - Intronic
995428181 5:112047368-112047390 GTGCCCACCCAGATTAAGGGTGG + Intergenic
995474551 5:112534498-112534520 ATGCCCACCCAGATTGAGGGTGG - Intergenic
995710205 5:115027481-115027503 GTTCCCACCTGGATTAAGAGTGG + Intergenic
995832965 5:116373970-116373992 GTGCCCACCCAGATTAAGGGTGG - Intronic
996018873 5:118570355-118570377 GTGCCCACCCAGACTGAGGGTGG - Intergenic
996036057 5:118759952-118759974 GTGCCCACCCAGATTGAGGGTGG + Intergenic
996110949 5:119565827-119565849 GTGCCCACCCAGACTGAGGGTGG + Intronic
996164627 5:120209922-120209944 GTGCCCACCTAGACTGAGGGTGG + Intergenic
996165434 5:120216417-120216439 GTGCCCACCCAGATTGAGGGTGG + Intergenic
996223234 5:120958904-120958926 GTGCCCACACACACTGAGAGTGG - Intergenic
996313101 5:122129094-122129116 GTGCCCACCCAGATTGAGGGTGG + Intergenic
996399769 5:123048971-123048993 GTGCCCACTCAGATTGAGGGTGG + Intergenic
996468346 5:123829625-123829647 ATGCCAACCCAGACTGAGGGAGG + Intergenic
996556613 5:124785186-124785208 GTGCCCACCCAGATTAAGAGTGG - Intergenic
996606931 5:125334357-125334379 GTGCCCACCCAGATTAAGGGTGG + Intergenic
996657619 5:125960336-125960358 GTGCCCACCCACATTGGGAGTGG + Intergenic
996761948 5:126995048-126995070 GTGCCCACCCAGATTGAAGGTGG + Intronic
996909174 5:128635744-128635766 GTACCCACCCATACTGAGGGTGG + Intronic
997037723 5:130213184-130213206 GTGCCCACCCAGATTGAGGGTGG + Intergenic
997068935 5:130596031-130596053 GTGCCCACCCAGATTAAGGGTGG - Intergenic
997209007 5:132066792-132066814 CTGCCCTCCTGGACTGAGAAGGG + Intergenic
997730505 5:136169319-136169341 GTGCCTACCCAGATTGAGGGTGG + Intronic
997793247 5:136782104-136782126 GTGCCCACCCAGATTCAGGGTGG + Intergenic
998486123 5:142504094-142504116 GTGCCCACCCAGATTGAAGGTGG - Intergenic
998701331 5:144703266-144703288 GTGCCCACCCAGATTGAGGGTGG - Intergenic
998746624 5:145267267-145267289 GTGCCCACCCAGATTAAGAGTGG + Intergenic
998977404 5:147663307-147663329 GTGCCCACCTAGACTGATGGTGG - Intronic
999351689 5:150877287-150877309 GTGCTCACCCAGATTGAGTGTGG - Intronic
999576092 5:152978972-152978994 GTGCCCACCCACATTGAGGGTGG - Intergenic
999659992 5:153851053-153851075 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1000111420 5:158111669-158111691 CTGCCCACATGGACTGAGAAGGG - Intergenic
1000416542 5:160990348-160990370 GTGCCCACCCAGACTAAGACTGG - Intergenic
1000448172 5:161350681-161350703 GTGCCCACCCAGATTGAGGGTGG - Intronic
1000679781 5:164168879-164168901 GTGCCCACCCACACTGAGGGTGG + Intergenic
1001543495 5:172555516-172555538 GTGCCCACCCAGATAAAGAGTGG - Intergenic
1001699411 5:173695969-173695991 GTGCTCAGCTGGACTGAGAAGGG + Intergenic
1002645988 5:180655143-180655165 GTGCTCACCCAGACTGAGGGTGG - Intergenic
1002938154 6:1692004-1692026 CTGACCACCCAGACTGAGGGTGG - Intronic
1003691797 6:8362129-8362151 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1003732685 6:8843598-8843620 GTGCCCACCTAGATTGAGGGTGG - Intergenic
1003761111 6:9180068-9180090 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1004021592 6:11780756-11780778 GTGCCTACCCAGACTGAGGGTGG - Intronic
1004518969 6:16344420-16344442 GTGCCCACCCAGATTGAGGGTGG - Intronic
1005047152 6:21653342-21653364 GTGCCCACCCACACTGAGGGTGG - Intergenic
1005204093 6:23380809-23380831 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1005265702 6:24109974-24109996 GTGCCCACCTAGACTGGGGGTGG + Intergenic
1005545712 6:26868099-26868121 GTGCCCACCCGCATTGAGGGTGG - Intergenic
1006037262 6:31223371-31223393 GTGCCCACCCAGATTTAGGGTGG - Intergenic
1006235969 6:32632793-32632815 GAGCCCACATGGATTGAGAGAGG + Intronic
1006242607 6:32698387-32698409 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1008079810 6:47182071-47182093 GTGCCCACCCATATTGACAGTGG + Intergenic
1008198345 6:48553975-48553997 TTGTCCACCCAGACTGAGGGTGG + Intergenic
1008246374 6:49178874-49178896 GCGCCCACCCACATTGAGAGTGG - Intergenic
1008260442 6:49359715-49359737 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1008266852 6:49438741-49438763 GTGCCCACCCAGATTAAGGGTGG - Intronic
1008325727 6:50178926-50178948 GTGCCCACCCAGACTGAGGGTGG + Intergenic
1008340180 6:50354947-50354969 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1008390665 6:50947725-50947747 GTGCCCACCCAGACTGAAGGTGG + Intergenic
1008588900 6:52973888-52973910 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1009016424 6:57908875-57908897 GTGCCCACCCGCATTGAGGGTGG - Intergenic
1009021202 6:57949679-57949701 ATGCCCACCCAGATTGAGGGTGG + Intergenic
1009389815 6:63132593-63132615 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1009587360 6:65624601-65624623 ATGCCCACCCAGATTGAGGGTGG - Intronic
1009631064 6:66201797-66201819 GTGCCTACCCAGATTGAGGGTGG + Intergenic
1009660776 6:66607583-66607605 CTGCCCACCCAGATTGAGAGTGG + Intergenic
1009760762 6:68002449-68002471 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1009851571 6:69206313-69206335 GTGCCCACCCAGATTAAGAGTGG + Intronic
1009970163 6:70616871-70616893 TTGTCCACCCAGACTGAGGGTGG - Intergenic
1010108250 6:72192860-72192882 GTGCCCACTCAGATTGAGGGTGG + Intronic
1010448944 6:75980491-75980513 GTGCCCACCCAGATTGAGTGTGG - Intronic
1010495457 6:76529775-76529797 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1010497041 6:76546720-76546742 GTGCCCACTCGGATTGAAGGTGG - Intergenic
1010563831 6:77384295-77384317 GTGCCCACCCACACTAAGGGTGG + Intergenic
1010580503 6:77591772-77591794 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1010581160 6:77597342-77597364 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1010617659 6:78032008-78032030 GTGCCCACCCAGACTGAGGGTGG + Intergenic
1010629449 6:78180048-78180070 GTGCTCACCCAGATTGAGGGTGG + Intergenic
1010831777 6:80540202-80540224 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1011039813 6:83016956-83016978 GTGCCCACCCAGATTAAGGGTGG + Intronic
1011068583 6:83357644-83357666 GTGCCCACCCAGATTAAGGGTGG - Intronic
1011186569 6:84683361-84683383 GTGCCCACACAGATTGAGAGTGG - Intergenic
1011294165 6:85808715-85808737 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1011324455 6:86134168-86134190 GTGCCCACCCACATTGAGGGTGG + Intergenic
1011327999 6:86172313-86172335 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1011417181 6:87134107-87134129 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1011530654 6:88317514-88317536 GTGTCCACCCAGATAGAGAGTGG - Intergenic
1011589762 6:88961050-88961072 GTGCCCACCCAGATTAAGGGTGG - Intronic
1011646002 6:89458689-89458711 GTGCCCACCCAGATTGAGGGTGG + Intronic
1011830167 6:91362788-91362810 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1011830354 6:91364400-91364422 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1012096836 6:94972800-94972822 GTGCCCACCCACATTGAGGGTGG + Intergenic
1012158317 6:95849094-95849116 GTGCCCACCCAGATTGAGGTTGG + Intergenic
1012420148 6:99056067-99056089 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1012577407 6:100819755-100819777 GCACCCACCCCGACTGAGGGTGG + Intronic
1012720508 6:102736686-102736708 GTGCCCACCCACATTGAGGGTGG - Intergenic
1012750790 6:103160988-103161010 GTGCCCACCTAGACTGAGAGTGG - Intergenic
1013038675 6:106411983-106412005 GTGTCCACCCGCATTGAGCGTGG + Intergenic
1013193082 6:107820358-107820380 GTGACCAGCCGCACTGGGAGGGG + Intronic
1013430121 6:110048081-110048103 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1013451575 6:110286775-110286797 GTGCCCACTCGGATTAAGGGTGG - Intronic
1013623677 6:111916458-111916480 GTACCCACCCAGATTGAGGGTGG + Intergenic
1013839252 6:114370925-114370947 GTGCCCACCCAGATTGAGGATGG + Intergenic
1013887489 6:114987937-114987959 GTGCCTACCCAGATTGAGGGTGG - Intergenic
1013935681 6:115590083-115590105 GTGCCCACCCAGCTTGAGGGTGG + Intergenic
1014042839 6:116849832-116849854 GTGCCCACCCACACTGAGAGTGG - Intergenic
1014066484 6:117132876-117132898 GTGCCCACACAGATTAAGAGTGG + Intergenic
1014160101 6:118157784-118157806 GTGCCCACCCAGATTGAGGGTGG + Intronic
1014175831 6:118330359-118330381 GTGCCCACCCGGATTAAAGGTGG + Intergenic
1014328928 6:120035516-120035538 GTGCCCACCCAGATTGAGAGTGG - Intergenic
1014415009 6:121173109-121173131 GTGCCCACCCAGACTGAGGGTGG - Intronic
1014433710 6:121398770-121398792 GTGCCCACCCAGATTGAAGGTGG + Intergenic
1014555395 6:122839115-122839137 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1014581016 6:123137411-123137433 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1014629079 6:123767214-123767236 GTGTCCACCCAGATTGAGGGGGG + Intergenic
1014851418 6:126343791-126343813 GTGCCCACCCAGATTGAGGGTGG + Intronic
1014879807 6:126709744-126709766 GTGCCTATCCTGATTGAGAGTGG + Intergenic
1014908170 6:127056061-127056083 GGGCCTACCCAGACTGAGGGTGG + Intergenic
1015082179 6:129240231-129240253 GTGCCTACCCAGAATGAGGGTGG + Intronic
1015095130 6:129407122-129407144 GTGCCCACCCACATTGAGGGTGG + Intronic
1015218132 6:130773606-130773628 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1015402897 6:132806786-132806808 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1015470417 6:133599232-133599254 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1015516273 6:134085676-134085698 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1015657825 6:135539895-135539917 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1016165433 6:140936377-140936399 GTGCCCACCCACACTGAGGGTGG - Intergenic
1016287430 6:142488629-142488651 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1016435761 6:144035513-144035535 GTGCCCAACCAGACTGAGGGTGG + Intronic
1016439715 6:144070437-144070459 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1016769075 6:147828467-147828489 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1016777448 6:147920179-147920201 GTGCCCACCCAGACTGAAGGTGG - Intergenic
1016859908 6:148707202-148707224 GTGCCCATCCAGACTGAGGGTGG + Intergenic
1016875259 6:148858399-148858421 GTGCCCACCCAGATAGAGGGTGG + Intronic
1016938013 6:149462648-149462670 GTGCCCACCCAGATTGAGGGAGG - Intronic
1016998262 6:149976416-149976438 GTGCCCACCCACACTGATAGGGG - Intergenic
1017221705 6:151973031-151973053 GTGCCCACCCAGATTGAGGGCGG + Intronic
1017228290 6:152044785-152044807 GTGCCCACCCAGATTGAGGATGG + Intronic
1017293347 6:152766305-152766327 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1017379893 6:153815672-153815694 GTGCCCACTCAGATTGAGGGTGG + Intergenic
1017424402 6:154305693-154305715 GTGCCCACCCGTATTGAAGGTGG - Intronic
1017528653 6:155266038-155266060 GTGCCCACCCAGATTGAGGGCGG + Intronic
1017564329 6:155667946-155667968 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1017584138 6:155901634-155901656 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1017618835 6:156273969-156273991 GTGCCCACCCAGACTAAGGGTGG - Intergenic
1017857125 6:158359621-158359643 GTGCCCACCCGGATTGAGGGTGG + Intronic
1017862977 6:158416186-158416208 GTGCCCACCCAGATTGAGGGGGG + Intronic
1017934186 6:158989922-158989944 GTGCCCACCCCGATTAAGGGTGG - Intronic
1017952570 6:159148648-159148670 GTGCCCACCCAGACTGAGGGTGG - Intergenic
1017970720 6:159310394-159310416 ATGCCCACCCAGATTGAGGGTGG - Intergenic
1018107779 6:160505435-160505457 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1018254769 6:161906962-161906984 GTGCCCACCCAGATTGAGGGTGG + Intronic
1018382486 6:163271251-163271273 GTGCCCACCCAGATTGAGGGTGG + Intronic
1018479064 6:164171817-164171839 GTGCTCACCCAGATTGAGTGTGG - Intergenic
1018530219 6:164755114-164755136 GTGCCCACCCAAATTGAGAGTGG - Intergenic
1018564049 6:165132814-165132836 GTGCCAACCCAGATTGAGAGTGG + Intergenic
1018654447 6:166020539-166020561 GTGCCCACCCACACTGAGGGTGG - Intergenic
1018666739 6:166145571-166145593 GTGCCCACCCAGACTGAGGATGG - Intergenic
1018723946 6:166596373-166596395 GTGCCCACCCAGATTGAGGGTGG - Intronic
1018758334 6:166868749-166868771 GTGCCCACCCAGATTAAGGGTGG - Intronic
1018780760 6:167063223-167063245 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1018830379 6:167438056-167438078 GTGCCCACCCACACTGAGGGTGG - Intergenic
1018894720 6:168005794-168005816 GTGCCCACCCAGATTAAGGGCGG + Intronic
1019029607 6:168999093-168999115 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1019040326 6:169098729-169098751 GTGCCCACCCAGAGTGAGGGTGG - Intergenic
1019256050 7:51920-51942 ATGCCCACCCAGATTGAGGGTGG + Intergenic
1019462017 7:1164889-1164911 GTGCCCACCCCCACTGAGGGTGG + Intergenic
1019806415 7:3129544-3129566 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1019954554 7:4402985-4403007 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1019974613 7:4570749-4570771 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1020501035 7:8920687-8920709 ATGCCCACCCAGATTGAGTGTGG + Intergenic
1020623710 7:10551079-10551101 GTGCCCGCCCAGATTGAGGGTGG - Intergenic
1020742883 7:12043985-12044007 GTACCCACCCAGATTGAGGGTGG + Intergenic
1020886273 7:13822537-13822559 GTGCCCACCCGGATTGAGGGTGG - Intergenic
1020890216 7:13869070-13869092 GTGTCCACCCAGACTGAGGGTGG + Intergenic
1021147400 7:17106165-17106187 GTGGCCACCCACACTGAGAGTGG + Intergenic
1021367226 7:19794963-19794985 GTGCCCACCCACATTGAGGGTGG - Intergenic
1021527707 7:21607327-21607349 GTGCCCACCCAGATTGAGGGTGG + Intronic
1021989137 7:26125412-26125434 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1022225044 7:28354287-28354309 GTGCCCACCCAGATTAAGGGTGG - Intronic
1022276326 7:28858759-28858781 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1022884229 7:34625231-34625253 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1022979245 7:35588665-35588687 GTGCCCACCCACATTGAGGGTGG - Intergenic
1023198943 7:37672692-37672714 GTGCCCACCCAGACTGAGGGTGG - Intergenic
1023287442 7:38633514-38633536 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1023463704 7:40429688-40429710 GTGCACACCCAGATTGAGGGTGG + Intronic
1023576864 7:41637033-41637055 GTGCCCATCCAGATTGAGGGTGG + Intergenic
1023790905 7:43752884-43752906 GTGCCCACCCAGATTGAAGGAGG - Intergenic
1024108325 7:46116815-46116837 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1024205493 7:47156112-47156134 GCGCCCACCCAGATTGAGGGTGG + Intergenic
1024431389 7:49292078-49292100 GTGCCCACCCAGGTTGAGGGTGG + Intergenic
1024468276 7:49737881-49737903 GCGCCCACCCGGGTTGAGGGTGG - Intergenic
1024602981 7:51001498-51001520 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1024747267 7:52422456-52422478 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1024884797 7:54128252-54128274 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1025621997 7:63181887-63181909 GTGCCCATCCAGATTGAGGGTGG + Intergenic
1026104636 7:67411126-67411148 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1026134509 7:67647496-67647518 GTGCCCACGCAGATTGAGTGTGG + Intergenic
1026140719 7:67704044-67704066 GTGCCCACCCACATTGAGGGTGG + Intergenic
1026176630 7:68003281-68003303 GTGCCCTCCCAGATTGAGGGTGG + Intergenic
1026181227 7:68042650-68042672 GTGCCCATCCAGATTGAGGGTGG - Intergenic
1026242628 7:68590195-68590217 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1026261691 7:68761038-68761060 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1026431031 7:70347519-70347541 CTGCTCACCTGGAATGAGAGCGG + Intronic
1026530369 7:71192228-71192250 GTGCCCACCCCCATTGAGGGTGG + Intronic
1026613417 7:71880985-71881007 GTGCCCACCCAGATTGAGGGTGG - Intronic
1026646717 7:72177250-72177272 GTGCTTACCCTGACTTAGAGAGG + Intronic
1026823090 7:73562805-73562827 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1027193994 7:76015811-76015833 GTGCCCACTCAGATTGAGGGTGG - Intronic
1027347019 7:77271211-77271233 GTGCCCACCCAGATTAAGGGTGG - Intronic
1027498032 7:78912466-78912488 GTGCCCACCCAGATTAAGGGTGG - Intronic
1027580429 7:79987986-79988008 GTGCCCACCTGGATTGAGGGTGG - Intergenic
1027610398 7:80352708-80352730 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1027619844 7:80470983-80471005 GTGCCCACCCAGATTAAGGGTGG - Intronic
1027655774 7:80929555-80929577 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1027807853 7:82852354-82852376 GTACCCACCCAGACTGAGGGTGG - Intronic
1027840792 7:83308444-83308466 GTGCCCACCCACACTGAGGATGG + Intergenic
1027885621 7:83900965-83900987 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1027922875 7:84418514-84418536 GTGCCCACCCACATTGAGGGTGG - Intronic
1027929250 7:84510040-84510062 GTGCCCGCCCAGATTGAGAGTGG - Intergenic
1027942511 7:84702212-84702234 GTGCCTGCCCAGACTGAGGGTGG + Intergenic
1027994348 7:85405543-85405565 GTGCCCACCCAGGTTGAGGGTGG - Intergenic
1028204286 7:87998194-87998216 GTGCCCACCCAGATTGAGGGTGG + Intronic
1028559307 7:92155974-92155996 GTGCCCACCCAGATTGAGGGTGG + Intronic
1028639817 7:93029521-93029543 GTGCCCACCCAGATTGTGGGTGG - Intergenic
1028688934 7:93627494-93627516 GTGCCCACCCAGATTGAGAGTGG - Intronic
1028828287 7:95299553-95299575 GTGCCCACCCAGATTAAGGGTGG - Intronic
1029013038 7:97282725-97282747 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1029171845 7:98636024-98636046 GCGTCCACCCAGAATGAGAGTGG - Intergenic
1029191223 7:98773669-98773691 GTGCCCACCCAGAATGAGGGCGG + Intergenic
1029573200 7:101385079-101385101 GTGCCCACCCACATTGAGGGTGG + Intronic
1029574374 7:101393497-101393519 GTGCCCACCCAGATTGAGGGTGG + Intronic
1029590781 7:101505708-101505730 GTGCCCACCCAGATTGAGGGGGG + Intronic
1029607401 7:101607181-101607203 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1029635933 7:101783774-101783796 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1029732595 7:102447839-102447861 CTGGCCACACGGACTCAGAGGGG + Exonic
1030037707 7:105422112-105422134 GTGCCCACCCAGATTGAGGATGG + Intergenic
1030277863 7:107739114-107739136 GTGCCCACCCAGATTAAGTGTGG - Intergenic
1030360203 7:108587674-108587696 GTGCCCACCCAGATTGAGGATGG + Intergenic
1030394248 7:108965714-108965736 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1030406019 7:109114561-109114583 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1030524229 7:110634328-110634350 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1030532689 7:110730232-110730254 GTGCCCACCCAGATTGAGGGTGG - Intronic
1030708745 7:112723891-112723913 GTGCCCACCCACATTGAGGGTGG + Intergenic
1030784905 7:113646935-113646957 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1030882798 7:114902050-114902072 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1031144145 7:117979191-117979213 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1031176747 7:118362211-118362233 GTGCCCACACAGATTGAGGGTGG - Intergenic
1031185492 7:118474668-118474690 GTGCCCACCCAGATTGAAGGTGG + Intergenic
1031281899 7:119814589-119814611 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1031296260 7:120008781-120008803 GTGCCCACCCACACTGATAGTGG - Intergenic
1031338983 7:120575469-120575491 GTTCCCACCCAGATTGAGGGTGG + Intronic
1031474139 7:122202870-122202892 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1031474863 7:122208956-122208978 GTGCCCACCCAGATTAAGAGTGG + Intergenic
1031643442 7:124193666-124193688 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1032248798 7:130235240-130235262 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1032634647 7:133693409-133693431 GTGCCCACCCTGCTTGAGGGTGG + Intronic
1032672340 7:134096808-134096830 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1032715177 7:134502885-134502907 GTGCCCACCCAGATGGAGGGTGG + Intergenic
1032890610 7:136191167-136191189 GTGCCCACCCAGACTGAGGTTGG + Intergenic
1032923168 7:136573666-136573688 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1032923849 7:136579352-136579374 GTGCCCACTCAGATTAAGAGTGG + Intergenic
1033501119 7:141950739-141950761 GTGCCCACCCAAATTGAGGGTGG - Intronic
1033784595 7:144715912-144715934 GTGCCCACCCAGATTAAGGGTGG + Intronic
1033903158 7:146168119-146168141 GTGCCCACCCAGATTGAGGGTGG + Intronic
1034060309 7:148081392-148081414 GTGCCCACCCAGATTAAGGGTGG - Intronic
1034076925 7:148240954-148240976 GTGCCCACCCAGATTGAGGGTGG + Intronic
1034083057 7:148298509-148298531 GTGCCCACCCAGATTGAGGGTGG + Intronic
1034123190 7:148645735-148645757 GTGCCCACCCAGATTGAGGATGG - Intergenic
1034169441 7:149051441-149051463 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1034170336 7:149058002-149058024 GTGCCCACCCAGATTGAGAGTGG - Intergenic
1034298267 7:149993128-149993150 GTGCCCACCCACACTGAGGATGG + Intergenic
1034469690 7:151248647-151248669 GAGCCCAGCAGGACTCAGAGGGG - Exonic
1034728403 7:153361957-153361979 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1034807751 7:154103655-154103677 GTGCCCACCCACACTGAGGATGG - Intronic
1034824791 7:154251834-154251856 GTGCCCACCCACATTGAGGGTGG + Intronic
1034949339 7:155286449-155286471 GAGCCCATCCGGATTGAGGGTGG - Intergenic
1035061106 7:156070325-156070347 GTGCCCACCTACACTGAGGGTGG + Intergenic
1035150147 7:156863397-156863419 GTGCCCACCCAGATTAAGTGTGG + Intronic
1035360351 7:158309253-158309275 GTGCCCACCCAGACTGAGGGTGG - Intronic
1035369333 7:158368998-158369020 GTGCCCACCCAGACTGAGGGTGG - Intronic
1035673284 8:1436441-1436463 GTGCCCACCCAGACTGAGGGTGG + Intergenic
1035777162 8:2196842-2196864 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1035793545 8:2331468-2331490 GTGCCCACCCAGATAGAGGGTGG + Intergenic
1035799258 8:2390237-2390259 GTGCCCACCCAGATAGAGGGTGG - Intergenic
1036032293 8:4987737-4987759 GTGCCCACCCACATTGAGGGAGG - Intronic
1036491392 8:9229329-9229351 CTGCCCACCCAGATTGAGGGTGG + Intergenic
1037077209 8:14735323-14735345 GTGCCCACCCACATCGAGAGTGG - Intronic
1037177765 8:15967046-15967068 GTGCCCACCCAGACTGAGTGTGG - Intergenic
1037391102 8:18392552-18392574 GTGCCCACCCGGATTGAGGGTGG + Intronic
1037485051 8:19339259-19339281 GTGCCCACCCAGATTGAGGGTGG + Intronic
1037669105 8:20999045-20999067 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1037748578 8:21665213-21665235 GTGCCCACTCAGATTGAGGGTGG - Intergenic
1038202460 8:25426499-25426521 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1038665383 8:29532796-29532818 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1038715011 8:29983728-29983750 GTGCCCAACCAGATTGAGGGTGG - Intergenic
1039240208 8:35548084-35548106 GTACCCACCTGGATTGAGGGTGG + Intronic
1039264925 8:35814366-35814388 ATGCCCACCCAGATTGAGGGTGG - Intergenic
1039383887 8:37113437-37113459 GTACCCACCCAGATTGAGGGTGG + Intergenic
1039414053 8:37378702-37378724 GTGCCCACCCACACTGAGAGTGG + Intergenic
1039419729 8:37426185-37426207 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1039778218 8:40757844-40757866 GTGCCCACCCAGACTGAGGGTGG - Intronic
1040614521 8:49020877-49020899 GTGCCCACCCAGATTAAGAGGGG + Intergenic
1040725976 8:50382098-50382120 GTGCCCACCCAGATTAAGGGTGG + Intronic
1040780463 8:51101677-51101699 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1041985738 8:63920637-63920659 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1042651696 8:71049692-71049714 GTGTCCACACACACTGAGAGGGG + Intergenic
1042683957 8:71416959-71416981 GTGTCCACCCAGATTGAGGGTGG - Intronic
1042841059 8:73124319-73124341 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1043105416 8:76103969-76103991 GTGCCCACGCGGATTAAGGGTGG + Intergenic
1043258316 8:78162634-78162656 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1043273380 8:78362313-78362335 GTACCCACCAAGATTGAGAGTGG + Intergenic
1043690974 8:83151124-83151146 GTGCCCACCCAGATTAAGAGTGG - Intergenic
1043733695 8:83717879-83717901 GTGCTCACCCAGACTAAGGGTGG - Intergenic
1043742263 8:83828746-83828768 GTGCCCACCCAGAATGAGGGTGG + Intergenic
1043992333 8:86770897-86770919 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1044027472 8:87191380-87191402 GTGCCCACCCAAATTGAGGGTGG + Intronic
1044147871 8:88740292-88740314 GTGTCCACTCAGATTGAGAGTGG - Intergenic
1044150374 8:88769566-88769588 GTGCCCAACCAGATTAAGAGTGG - Intergenic
1044167652 8:89007037-89007059 GTGCCCACCCAGATGGAGGGTGG - Intergenic
1044285660 8:90410074-90410096 GTGCCCATCCAGATTGAGGGTGG + Intergenic
1044286520 8:90416739-90416761 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1044294060 8:90506672-90506694 GTGCCCACCCAGGTTGAGGGTGG - Intergenic
1044330618 8:90915979-90916001 GTACCCACCCAGATTGAGGGTGG + Intronic
1044344664 8:91091489-91091511 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1044435187 8:92153634-92153656 GTCCCCACCCAGATTGAGGGTGG - Intergenic
1044895762 8:96889855-96889877 GTGCCCACCCAGATTGAGGGTGG + Intronic
1045128853 8:99125409-99125431 GTGCCCACCCAGATTGAGGATGG + Intronic
1045393702 8:101739516-101739538 GTGCCCACCCAGATTGAGGATGG - Intronic
1045405185 8:101859077-101859099 GTGCCCACCCAGATTGAGGGTGG - Intronic
1045549754 8:103160879-103160901 GTGCCCACCCAGATTAAGGGTGG + Intronic
1045588398 8:103564740-103564762 GTGCCCACCCAGATTGAGGGTGG + Intronic
1045711809 8:104993428-104993450 GTGCCCACCCAGACTGAAGGTGG + Intronic
1045800136 8:106092673-106092695 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1045932760 8:107646446-107646468 GTGCCCACCCGGACTGAGGATGG + Intergenic
1046188053 8:110748720-110748742 GTGCCCACTCACACTGAGGGTGG + Intergenic
1046500751 8:115073158-115073180 GTGCCCACACAGATTGAGGGTGG - Intergenic
1046518138 8:115289570-115289592 GTGCCCACCCAGATTGACAGTGG + Intergenic
1046630801 8:116621470-116621492 GTGCCCACCCAGATTTAGGGTGG - Intergenic
1046647915 8:116805822-116805844 GTGCCCACCCACATTGAGGGTGG + Intronic
1046675317 8:117101664-117101686 GTGCCCACCTAGATTGAGGGTGG - Intronic
1046898575 8:119499476-119499498 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1047015504 8:120719202-120719224 GTGCCCACCCAGATTAAGGGTGG - Intronic
1047028836 8:120853792-120853814 GTGCCCATCCAGATTGAGGGTGG + Intergenic
1047054075 8:121144988-121145010 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1047196432 8:122726096-122726118 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1047325399 8:123830962-123830984 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1047550937 8:125871582-125871604 GTGCCCACCCAGACTGAGATTGG + Intergenic
1048126500 8:131641313-131641335 GTGCCCACCCAGATTAAGGGCGG - Intergenic
1048193198 8:132309029-132309051 GTGCCCACCCAGATTGAGGGTGG - Intronic
1048217323 8:132508273-132508295 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1048521505 8:135159716-135159738 GTGCCCACCTGGATTGAGGGTGG - Intergenic
1048584794 8:135765031-135765053 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1048625858 8:136184310-136184332 GTGCCAACCCAGACTGAAGGTGG + Intergenic
1048634827 8:136284547-136284569 GTGCCCACTCAGACTGAGAGTGG + Intergenic
1048654827 8:136524093-136524115 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1048734448 8:137483068-137483090 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1048746956 8:137625040-137625062 GTGCCCACCCAAATTGAGGGTGG + Intergenic
1048923175 8:139248694-139248716 GTGGCCAACAGGAATGAGAGGGG + Intergenic
1048952828 8:139510283-139510305 GTGCCCACCCCGGTTGAGGGTGG + Intergenic
1050134744 9:2450060-2450082 GTGCCCACCGGGAGTAAGGGTGG - Intergenic
1050191402 9:3030221-3030243 GTGCCCACCCAGAATGAGGGTGG + Intergenic
1050447507 9:5740719-5740741 GTGCCCACCCAGATTAAGGGTGG + Intronic
1050483006 9:6105229-6105251 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1050636284 9:7616411-7616433 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1050639017 9:7645605-7645627 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1050895149 9:10877406-10877428 GTGCCCACCCAGACTGAGGGTGG + Intergenic
1050933435 9:11361205-11361227 GTACCCACCCAGATTGAGGGTGG - Intergenic
1050991005 9:12152080-12152102 GTGCCCACCCAGATTGATGGTGG - Intergenic
1051004436 9:12325751-12325773 GTGCCCACCCAGATTGAGGGCGG + Intergenic
1051004913 9:12332113-12332135 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1051008529 9:12380901-12380923 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1051036762 9:12756520-12756542 GTGCCCATCCAGACTGAGGGTGG - Intergenic
1051443894 9:17119828-17119850 GTGCCCACCCAGAGTAAGGGTGG + Intergenic
1051547461 9:18292542-18292564 GTGCCCACCCAGGCTGAGGGAGG - Intergenic
1051551671 9:18337116-18337138 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1051829764 9:21262776-21262798 GTGCCCACCCACACTGAAGGTGG - Intergenic
1051841885 9:21407091-21407113 GTGCCCACAGTGACTGAGTGTGG + Intergenic
1052136949 9:24924166-24924188 GTGCACACCCCCACTGAGTGAGG - Intergenic
1052227161 9:26103704-26103726 GTGCCCACCCAGATTAAGGGTGG - Intronic
1052368967 9:27643321-27643343 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1052411627 9:28128899-28128921 GTGCCCACGCAGACTGAGGGTGG - Intronic
1052561265 9:30087514-30087536 GTGCCTACCCAGATTGAGGGTGG + Intergenic
1052621201 9:30912404-30912426 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1052709044 9:32030321-32030343 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1053095836 9:35327600-35327622 GTGCCCACCCACATTGAGGGTGG + Intronic
1053262996 9:36686957-36686979 GTGCCCACCCAGATTAAGTGTGG + Intergenic
1053582811 9:39424762-39424784 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1053846997 9:42249627-42249649 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1054104390 9:60983505-60983527 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1054581954 9:66923345-66923367 GTGCCCACCCAGATAGAGGGTGG + Intronic
1054958518 9:70941186-70941208 GTGCCCACCCAGATTAAGGGTGG - Intronic
1055205188 9:73721568-73721590 ATGCCCACCCAGATTGAGGGTGG - Intergenic
1055461614 9:76524973-76524995 GTGCCCACCCAGACTGAGGGTGG + Intergenic
1055515407 9:77028423-77028445 GTGCCCACCCACACTGAGGGTGG + Intergenic
1055533944 9:77216965-77216987 GTGCCCACCCAGATTGAGGGTGG + Intronic
1055878074 9:80967000-80967022 GTGTCCACCCAGATTGAGGGTGG - Intergenic
1055882952 9:81023864-81023886 GTGGCCACCCACATTGAGAGTGG - Intergenic
1056079164 9:83072770-83072792 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1056276801 9:85001699-85001721 TTCCCCACACAGACTGAGAGAGG + Intronic
1056314735 9:85376849-85376871 TTGCCCACCCAGATTGAGGGTGG + Intergenic
1056518556 9:87378431-87378453 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1056900556 9:90595668-90595690 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1057706897 9:97401154-97401176 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1057834581 9:98434049-98434071 GTGCCCACTCAGATTGAGGGTGG - Intronic
1058090823 9:100803644-100803666 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1058094791 9:100847217-100847239 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1058229282 9:102406179-102406201 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1058230011 9:102413855-102413877 GTGCCCACCTGGATTGAGGGTGG + Intergenic
1058258965 9:102807201-102807223 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1058302533 9:103393863-103393885 GTACCCACCCAGATTGAGGGTGG + Intergenic
1058381303 9:104379792-104379814 GTGCCCACCCAGATTGAGCATGG - Intergenic
1058386691 9:104444715-104444737 GTACCCACCCAGACTGAGGGTGG - Intergenic
1058543773 9:106039548-106039570 GTGCCCATCCAGAATGAGGGTGG - Intergenic
1058768370 9:108205813-108205835 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1058926211 9:109666577-109666599 CAGCCCACCAGAACTGAGAGTGG - Intronic
1059014182 9:110496299-110496321 GTGCCCACCCAGACTGAGGGTGG - Intronic
1059196191 9:112373431-112373453 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1059550874 9:115227660-115227682 GTGCCCACCCAGATTGAGGGTGG + Intronic
1059868017 9:118538315-118538337 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1059880956 9:118688256-118688278 GTGCCCACCCAGAATGAGGGTGG - Intergenic
1059946487 9:119413726-119413748 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1059971004 9:119667968-119667990 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1060144321 9:121238280-121238302 GTGCCCACCCAGATTGAGGGTGG - Intronic
1061033922 9:128102999-128103021 CTGCACACCAGGACTCAGAGAGG - Intronic
1061450984 9:130666882-130666904 GCTTCCACCCGGGCTGAGAGCGG + Intronic
1061515498 9:131087659-131087681 GTCCCCACCCGGGCTGCCAGGGG - Intronic
1061656614 9:132096583-132096605 GTGCCTACCCAGTCTGAGGGTGG + Intergenic
1061918495 9:133769547-133769569 GTGCCCACCGTGACTGTGCGTGG - Intronic
1061982051 9:134111271-134111293 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1062092096 9:134683737-134683759 GGGCCCACCCCACCTGAGAGTGG + Intronic
1062168769 9:135122609-135122631 GTGGCCACCCCGACTGGGAGAGG - Intergenic
1062179230 9:135181838-135181860 GTGCCCGCCCAGATTGAGGGTGG - Intergenic
1062184130 9:135207612-135207634 GTGCCCACCCACAATGAGGGTGG - Intergenic
1203617359 Un_KI270749v1:79607-79629 GTGCCCACCCACATTGAGGGTGG + Intergenic
1185564078 X:1082761-1082783 GTGCCCACCCAGCTTGAGGGTGG + Intergenic
1185652194 X:1656061-1656083 GTGCCCACCCAGATTGAGGGGGG - Intergenic
1185710594 X:2300507-2300529 GTGCCCACCCCGATTAAGGGTGG - Intronic
1185769495 X:2754806-2754828 GTGCCCACCCAAATTGAGGGTGG + Intronic
1185823950 X:3231049-3231071 GTGCCCACCCACACTGAGGGTGG + Intergenic
1185826612 X:3257232-3257254 GTGCCCACTTAGACTGAGGGTGG + Intergenic
1185920248 X:4083499-4083521 GTGCACACCCACACTGAGGGTGG + Intergenic
1185950493 X:4427203-4427225 GTGCCCATCCAGATTGAGGGTGG - Intergenic
1185961344 X:4548815-4548837 GTGCCCATCCACACTGAGGGTGG - Intergenic
1186004159 X:5049815-5049837 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1186006589 X:5078814-5078836 GTGCCCACGAAGACTGAGTGTGG + Intergenic
1186032458 X:5384643-5384665 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1186053182 X:5622087-5622109 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1186101513 X:6162402-6162424 GTGCCCACCCAGATTAAGGGTGG - Intronic
1186151251 X:6676879-6676901 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1186217523 X:7315826-7315848 GTGCCCACCCAGATTGAGGGTGG + Intronic
1186304605 X:8242091-8242113 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1186334784 X:8574498-8574520 GTGCCCACCCAGATTGAGGGAGG - Intronic
1186424933 X:9456460-9456482 GTGCTCACCCGCACTGAGGAGGG + Intergenic
1186789822 X:12986048-12986070 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1187524243 X:20039663-20039685 GTACCCACCCAGATTGAGGGTGG - Intronic
1187575746 X:20552806-20552828 GTGCCCACCTAGACTGAGGGTGG + Intergenic
1187694001 X:21899870-21899892 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1187801632 X:23069922-23069944 GTGCCCACCCACAGTGAGGGTGG + Intergenic
1187927623 X:24264365-24264387 GTGCCCACCCAGATTGAGGGCGG + Intergenic
1188012596 X:25073630-25073652 GTGCCCACTCAGACTGAGGGTGG + Intergenic
1188364539 X:29298994-29299016 GTGCCCACCCAGATTAAGGGTGG - Intronic
1188387192 X:29575564-29575586 GTGCCCACCCACATTGAGGGTGG + Intronic
1188406096 X:29811491-29811513 GTGCCCACCGGTATTAAGAGTGG + Intronic
1188647611 X:32590500-32590522 GTGCCCACCCACATTGAGGGTGG - Intronic
1188786520 X:34353270-34353292 GTGCCCACCCAGGCTGACGGTGG - Intergenic
1189596711 X:42574144-42574166 GTGCCCACCCACACTGAGGGTGG - Intergenic
1190139745 X:47832384-47832406 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1190155306 X:47986719-47986741 GTACCCACCCAGACTGAGGGTGG - Intronic
1190169646 X:48101793-48101815 GTGCCCATCCACACTGAGGGTGG + Intergenic
1190322391 X:49186655-49186677 GTGGCCAACTGGACTGAGAGGGG + Intergenic
1190520597 X:51276075-51276097 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1190524670 X:51316837-51316859 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1190545600 X:51523176-51523198 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1190618656 X:52263782-52263804 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1190625952 X:52338804-52338826 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1190637630 X:52451933-52451955 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1190648020 X:52541091-52541113 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1190679011 X:52808527-52808549 GTGCCCACACAGACTGAGGGTGG - Intergenic
1190793294 X:53719868-53719890 GTGCCTACCCAGATTGAGGGTGG + Intergenic
1190959411 X:55230615-55230637 GTGCCCACCCAGATTGAGGGTGG + Intronic
1190970063 X:55340039-55340061 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1191178517 X:57534021-57534043 GTGCCCACCCACATTGAGGGTGG - Intergenic
1191226746 X:58052119-58052141 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1191718936 X:64213240-64213262 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1191719713 X:64219365-64219387 GTGCCCACCCAGACTGTGTGAGG + Intergenic
1191732453 X:64351874-64351896 GTGCCCACCCAGATTAAGGGTGG + Intronic
1191780363 X:64857801-64857823 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1191878029 X:65816085-65816107 GTGCCCACCTAGATTGAGGGTGG + Intergenic
1192324561 X:70121831-70121853 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1192661279 X:73045304-73045326 GTGTCCACCCAGATTGAGAGTGG + Intergenic
1192728825 X:73781622-73781644 GTGCCCACCCAAATTGAGGGTGG + Intergenic
1192827967 X:74718388-74718410 GTGCCCAACCACAGTGAGAGTGG - Intergenic
1192995793 X:76511982-76512004 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1192996479 X:76518089-76518111 CTGCCCACCCAGATTGAGGGTGG - Intergenic
1193121060 X:77823436-77823458 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1193276376 X:79593175-79593197 GTGTCCACCCGGATTGAGGGTGG - Intergenic
1193324585 X:80164857-80164879 GTGCCCACCCAGGTTGAGGGTGG + Intergenic
1193354948 X:80508307-80508329 GGGCCCACCCAGATTGAGGGTGG + Intergenic
1193356729 X:80527857-80527879 GTGTCCACCCAGATTGAGTGTGG - Intergenic
1193391564 X:80935373-80935395 GTGCCCACCTGGATTGAGGGTGG - Intergenic
1193398391 X:81013102-81013124 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1193413568 X:81195400-81195422 GTACCCAGCCAGACTGAGGGTGG + Intronic
1193446799 X:81615641-81615663 GGGCCCACCCAGATTGAGGGTGG - Intergenic
1193461736 X:81798233-81798255 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1193472916 X:81928433-81928455 GTGCCCACCTAGATTGAGGGTGG + Intergenic
1193484302 X:82067513-82067535 GTGCCCACCCAGATTGAGCATGG + Intergenic
1193563583 X:83050038-83050060 ATGCCCACCCACACTGAGGGTGG + Intergenic
1193568533 X:83111401-83111423 GTGCCCACCCAAATTGAGGGTGG + Intergenic
1193707204 X:84836156-84836178 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1193792921 X:85838224-85838246 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1193852295 X:86553382-86553404 GTGCCCACTCAGATTGAGGGTGG + Intronic
1193879304 X:86901673-86901695 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1193904162 X:87222936-87222958 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1193905053 X:87232072-87232094 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1193914508 X:87349468-87349490 GTGCCCACCCAGATTAAGAGTGG + Intergenic
1193915321 X:87355913-87355935 GTGCCCACCCAGATTGAAAGTGG + Intergenic
1193940651 X:87677587-87677609 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1194052417 X:89087700-89087722 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1194096125 X:89641095-89641117 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1194137496 X:90164460-90164482 GTGCCCACCAAGACTAAGGGTGG - Intergenic
1194180129 X:90700665-90700687 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1194198517 X:90926546-90926568 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1194230320 X:91314571-91314593 GTGCACACCCAGATTGAGGGTGG + Intergenic
1194278942 X:91923337-91923359 GTGCCCACCCAGATTGAGGGTGG - Intronic
1194343602 X:92733563-92733585 GTGCCCACCCATATTGAGGGTGG - Intergenic
1194433412 X:93839306-93839328 GTGCCCACCTAGATTGAGGGTGG - Intergenic
1194443833 X:93963584-93963606 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1194477795 X:94380236-94380258 GTGCCCACCCAGATTGAGGATGG + Intergenic
1194488976 X:94523322-94523344 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1194564632 X:95469596-95469618 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1194591053 X:95800261-95800283 GTGCCCACCCACATTGAGGGTGG - Intergenic
1194676714 X:96803062-96803084 GTGCCCACCCAGATTGAGGGTGG + Intronic
1194833487 X:98655188-98655210 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1194881927 X:99263536-99263558 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1194885489 X:99310799-99310821 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1195123976 X:101786729-101786751 GTGCCCACCCAGATTGTGGGTGG + Intergenic
1195198291 X:102520209-102520231 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1195270856 X:103229260-103229282 GTGCCCACCCAGATTGAGGTGGG + Intergenic
1195271674 X:103237264-103237286 GTGTCCACCCAGATTGAGGGTGG + Intergenic
1195309195 X:103614441-103614463 GTGCCTACCCAGATTGAGGGTGG - Intronic
1195420537 X:104670412-104670434 GTGCCCACCCATACTGAGGGTGG + Intronic
1195437718 X:104864645-104864667 GTGCCCACCCAGATTGGGGGAGG - Intronic
1195540451 X:106056958-106056980 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1196230754 X:113218124-113218146 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1196512280 X:116525728-116525750 GTGCCCACCCAGATTGAGAGTGG + Intergenic
1196534681 X:116829342-116829364 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1196564854 X:117193122-117193144 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1196585603 X:117423798-117423820 GTGCCCACCAAGATTAAGAGTGG - Intergenic
1196772313 X:119307388-119307410 GCGCCCACCCAGATTAAGAGTGG - Intergenic
1196852472 X:119950711-119950733 GAGCCCACCCTGACTGAGGGTGG + Intergenic
1196933914 X:120710201-120710223 GTGCCCACCTGGATGGAGGGTGG - Intergenic
1197013767 X:121598993-121599015 GTGCCCACCTGGATTGAGGGTGG + Intergenic
1197044017 X:121974673-121974695 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1197044704 X:121980784-121980806 GTTCCCACCCAGACTGAGAGTGG - Intergenic
1197113696 X:122806215-122806237 GTGCCCACCCAGACTGAGGGTGG - Intergenic
1197182420 X:123550248-123550270 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1197244738 X:124156497-124156519 ATGCCCACCCAGATTGAGGGTGG + Intronic
1197388401 X:125828611-125828633 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1197426185 X:126299253-126299275 GTGCCCACTCAGATTAAGAGTGG + Intergenic
1197457006 X:126689377-126689399 GTGCCCACCCAGACTGAGGGTGG + Intergenic
1197481687 X:126994657-126994679 GTGCCCACCCAGACTGAGTGTGG - Intergenic
1197495297 X:127172399-127172421 GTGCCCATCCAGATTGAGAGTGG - Intergenic
1197537638 X:127709272-127709294 GTACCCACCCACACTGAGGGTGG - Intergenic
1197554777 X:127939565-127939587 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1197679778 X:129369992-129370014 GTGCCCACCCAGATTAAGGGTGG - Intergenic
1197912721 X:131501944-131501966 GTGCCCACACAGATTGAGGGTGG + Intergenic
1198012457 X:132572251-132572273 GTGCCCACCCGGATTGAGGGTGG + Intergenic
1198047412 X:132916549-132916571 GTGCTCACCCAGATTGAGGGTGG - Intronic
1198546143 X:137694844-137694866 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1199081114 X:143577753-143577775 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1199114131 X:143970079-143970101 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1199152022 X:144498394-144498416 GTGTCCACCCAGATTGAGCGTGG - Intergenic
1199229957 X:145425134-145425156 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1199275593 X:145938716-145938738 GTGCCCACCTGGATTCAGAGTGG - Intergenic
1199379690 X:147155659-147155681 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1199414194 X:147560681-147560703 GTGCCCACCCAGACTTAGGGTGG + Intergenic
1199418907 X:147620142-147620164 GTTCCCACCCAGATTGAGGGTGG - Intergenic
1199785268 X:151099556-151099578 GTGCCTACCCAGATTGAGGGTGG - Intergenic
1200340746 X:155392670-155392692 GTGCCCACCCAGATTAAGGGTGG + Intergenic
1200449131 Y:3302476-3302498 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1200483226 Y:3734396-3734418 GTGCCCACCAAGACTAAGGGTGG - Intergenic
1200521582 Y:4214466-4214488 GTGTCCACCCAGACTAAGGGTGG - Intergenic
1200526786 Y:4282833-4282855 GTGCCCACCCAGATTGAGGGTGG + Intergenic
1200543223 Y:4486282-4486304 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1200596420 Y:5146838-5146860 GTGCCCACCCAGATTGAGGGTGG - Intronic
1200651956 Y:5850226-5850248 GTGCCCACCCATATTGAGGGTGG - Intergenic
1201182796 Y:11365742-11365764 GTGCCCACCCACATTGAGGGTGG + Intergenic
1201301011 Y:12504823-12504845 GTGCCCACCCAGATTGAGGGTGG - Intergenic
1201428714 Y:13883747-13883769 GTGCCCACCCAGATTGAGGGAGG + Intergenic
1202244268 Y:22802152-22802174 GTGCCCACTCGGATTAAGGGAGG + Intergenic
1202274645 Y:23103237-23103259 GTGGCCACCCAGAATGAGGGTGG - Intergenic
1202291382 Y:23317449-23317471 GTGGCCACCCAGAATGAGGGTGG + Intergenic
1202397256 Y:24435898-24435920 GTGCCCACTCGGATTAAGGGAGG + Intergenic
1202427637 Y:24736973-24736995 GTGGCCACCCAGAATGAGGGTGG - Intergenic
1202443154 Y:24933121-24933143 GTGGCCACCCAGAATGAGGGTGG + Intergenic
1202473525 Y:25234190-25234212 GTGCCCACTCGGATTAAGGGAGG - Intergenic