ID: 1149401586

View in Genome Browser
Species Human (GRCh38)
Location 17:56301951-56301973
Sequence TTGCCAAGACTGTTGAAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 222}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149401586_1149401588 -3 Left 1149401586 17:56301951-56301973 CCACTCTTCAACAGTCTTGGCAA 0: 1
1: 0
2: 0
3: 13
4: 222
Right 1149401588 17:56301971-56301993 CAATTGAAAAAGGAATTCCTTGG 0: 1
1: 0
2: 1
3: 35
4: 337
1149401586_1149401589 1 Left 1149401586 17:56301951-56301973 CCACTCTTCAACAGTCTTGGCAA 0: 1
1: 0
2: 0
3: 13
4: 222
Right 1149401589 17:56301975-56301997 TGAAAAAGGAATTCCTTGGCAGG 0: 1
1: 0
2: 2
3: 51
4: 440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149401586 Original CRISPR TTGCCAAGACTGTTGAAGAG TGG (reversed) Intronic
901126261 1:6930843-6930865 TTCCCACGCCTGGTGAAGAGTGG - Intronic
901203342 1:7479265-7479287 TTGCCTAGACAGGTGAAGACAGG + Intronic
901351559 1:8601486-8601508 GTGACAAGACTGTTTGAGAGTGG + Intronic
904546875 1:31281672-31281694 TTGCCAAGACATTTGAAGGCTGG + Intronic
905611021 1:39351624-39351646 TTGCCAAGACTGGAGTACAGTGG + Intronic
906348786 1:45039058-45039080 TTTCCAGAACTGTTGCAGAGAGG - Exonic
907186124 1:52610568-52610590 TTGCCCAGGCTGAAGAAGAGTGG + Intergenic
908925957 1:69255351-69255373 TTGCCCAGACTGGAGTAGAGTGG - Intergenic
909358395 1:74733818-74733840 TTGCCAGAGCTGTTGATGAGCGG - Intronic
909550258 1:76891842-76891864 ATGCCAAGACAATTGAATAGGGG - Intronic
912440916 1:109697166-109697188 TTGCCCAGACTGGAGAGGAGTGG - Intronic
914257045 1:145969136-145969158 TTGCCCAGACTGGTGCACAGTGG + Intronic
916015768 1:160748609-160748631 TTGGCAAGAATGTGGGAGAGGGG + Intronic
916194389 1:162209933-162209955 TAGCCAAGGCTGATGCAGAGTGG + Intronic
916541530 1:165760389-165760411 TTGCCCAGACTGGAGTAGAGTGG - Intronic
917737812 1:177936587-177936609 TTTCCAAGATTCCTGAAGAGTGG - Intronic
918120377 1:181532960-181532982 TTGCCTAGCTTGTGGAAGAGTGG + Intronic
918213767 1:182375196-182375218 TTGCCCAGACTGTAGTACAGTGG + Intergenic
919102414 1:193110737-193110759 TTGCCCAGACTGGAGAACAGTGG - Intergenic
921089967 1:211832841-211832863 GTGCCAAGAGTGTAGGAGAGGGG + Intergenic
921091272 1:211845725-211845747 TTGCCCAGACTGTAGTACAGTGG + Intergenic
922053699 1:222020049-222020071 TGGCCAGGACTCTTGAAGGGTGG - Intergenic
923753278 1:236766828-236766850 TTGCAAAGACTGTTAAATAAAGG - Intergenic
1063354499 10:5385439-5385461 GTGGCAAGACTGTTGATGAGAGG - Intergenic
1063570607 10:7211457-7211479 TTGGGAAGACTGTTGACCAGAGG - Intronic
1064087956 10:12359585-12359607 TTGCCCAGGCTGATGGAGAGAGG - Intronic
1064971676 10:21072949-21072971 TTGCCCAGGCTGTTGTACAGTGG - Intronic
1065028783 10:21564594-21564616 TAGCCAAAACTGATGAACAGAGG - Intronic
1066649910 10:37644569-37644591 TTGGCAAGACTGTGGAGCAGAGG - Intergenic
1068513655 10:57998303-57998325 CTGCCAAGACTGGTGAAGTAGGG + Intergenic
1069016267 10:63432580-63432602 ATGCCAGGGCTGTTGAAGACTGG - Intronic
1070394045 10:75996409-75996431 TTGCCAATTCTGAAGAAGAGGGG - Intronic
1074059859 10:109955108-109955130 TTGCCCAGGCTGGTGCAGAGGGG + Intergenic
1074998815 10:118779978-118780000 TCCACAAGACTGATGAAGAGAGG - Intergenic
1080505397 11:32908056-32908078 TTGCCCAGGCTGGAGAAGAGAGG - Intronic
1081760747 11:45575085-45575107 TTGCCAAGACTTTTGAGCACTGG - Intergenic
1082217004 11:49583508-49583530 TTGCCCAGGCTGAAGAAGAGTGG + Intergenic
1082880455 11:58031823-58031845 TTCCTAAGACTGTAGATGAGAGG - Exonic
1086632550 11:89040659-89040681 TTGCCCAGGCTGAAGAAGAGTGG - Intronic
1088688319 11:112303758-112303780 CTGGCAAGCCTGTGGAAGAGAGG - Intergenic
1091481099 12:831850-831872 TTATCAAGACTTTTGAACAGTGG - Intronic
1092684581 12:11027773-11027795 CTGACAAGCCTGTTGGAGAGGGG + Intronic
1098317798 12:69210313-69210335 TTTCCAGGAATGTTGCAGAGTGG - Intergenic
1100941285 12:99724845-99724867 TTTCTAAGACTGTTGAATATTGG - Intronic
1101050338 12:100856599-100856621 TTGGCAAGAAGGATGAAGAGTGG + Intronic
1103157432 12:118698145-118698167 TTCCCTAGACTGTTAAGGAGAGG + Intergenic
1108498653 13:51048804-51048826 TAGCCAAGCCTGCTGAAAAGAGG + Intergenic
1110701931 13:78559096-78559118 TTGCCAAGATTCTTGAGGGGAGG - Intergenic
1111726532 13:92016992-92017014 TTGACAAGACTTTAGCAGAGAGG + Intronic
1114513100 14:23278713-23278735 TTGCCTAGACTGGAGTAGAGTGG + Intronic
1115481027 14:33861086-33861108 TTGCCAAGCTTCTTGAAAAGAGG - Intergenic
1115909164 14:38236330-38236352 TGTCCAGGACTGATGAAGAGGGG - Intergenic
1116244766 14:42395382-42395404 TTGCCAAGATTGCTGGAGATGGG + Intergenic
1117781449 14:59237032-59237054 TTACCAAAACTGTTGGTGAGGGG + Intronic
1119064405 14:71511322-71511344 TTGCCCAGGCTGTAGTAGAGTGG + Intronic
1121282064 14:92706100-92706122 TTCCCAAGACAGTTGAAGTCAGG - Intronic
1121755402 14:96398360-96398382 TGGCCATGTCTGTGGAAGAGAGG - Intronic
1122782879 14:104151003-104151025 TGGCCCTGACTGTTGCAGAGTGG + Intronic
1125383231 15:39109903-39109925 TTGCCAATAGTGTAGAAGTGTGG - Intergenic
1125701589 15:41690446-41690468 GTGCCAAGACAATTCAAGAGAGG - Intronic
1126427168 15:48540874-48540896 ATCCCAACAGTGTTGAAGAGAGG - Intronic
1126630212 15:50727082-50727104 TAGCCAAGTCTGTTGTGGAGAGG + Intronic
1128608981 15:69058794-69058816 TTCCCAAGCCTGATGAAGAGGGG - Intronic
1129443568 15:75600226-75600248 CTGACAAGACTGTTGAGGACTGG + Intronic
1130852837 15:87814391-87814413 TTGGCAAGACTGTGGAACAATGG + Intergenic
1131721684 15:95175838-95175860 TTGCCTAGACTGTAGTACAGAGG + Intergenic
1132165785 15:99588154-99588176 TTGCCCAGGCTGTTGTACAGTGG + Intronic
1132389677 15:101429121-101429143 TTGACAAGACTCTTGCTGAGGGG - Intronic
1133776434 16:8899165-8899187 TTGCAAAGACAGTTGCACAGAGG - Exonic
1133960262 16:10486972-10486994 TTGCCAAAACTTTTGGAGTGAGG - Intergenic
1134088632 16:11376457-11376479 ATGCCAAGACTATTGAATTGGGG - Intronic
1134682520 16:16136378-16136400 TGGCCAGGACTGTTGAAGGTGGG - Intronic
1136485441 16:30569148-30569170 TTGCCCAGACTGTAGTACAGTGG + Intergenic
1137877741 16:52013444-52013466 TTGCTAAGACTGTTGGAAAAGGG + Intronic
1137897528 16:52230124-52230146 TTGCCAAGACAAGGGAAGAGAGG + Intergenic
1138449717 16:57086402-57086424 TTAGCAAGACTGTAGATGAGTGG + Intergenic
1138659274 16:58508135-58508157 TTGGCAAGACTGTGGGAAAGTGG - Intronic
1139184057 16:64783172-64783194 TTGACAAGTCTTTTGCAGAGTGG + Intergenic
1139935191 16:70565385-70565407 TTTCCAACACTGGTGAAGACTGG + Exonic
1140600069 16:76464684-76464706 CTGTCAAGACTGGTAAAGAGTGG - Intronic
1140647669 16:77050634-77050656 CTACCAAGCCTGTTGATGAGGGG - Intergenic
1142018275 16:87764100-87764122 TTGCCAGGACTGTGAAAGAATGG + Intronic
1142837684 17:2600767-2600789 TTGCCCAGACTGTAGTACAGTGG + Intronic
1142941940 17:3386788-3386810 TTGCGAAGGCTGTTGATGAAAGG - Intergenic
1144362965 17:14513444-14513466 TTTCCAAGACTCATGATGAGTGG - Intergenic
1148036103 17:44661246-44661268 TTGCCCAGACTGGAGTAGAGTGG - Intronic
1149401586 17:56301951-56301973 TTGCCAAGACTGTTGAAGAGTGG - Intronic
1150663146 17:67103971-67103993 TTGCCAAGACTATTCAATGGGGG + Intronic
1153822896 18:8847479-8847501 GTGCCCAGAGTGTAGAAGAGTGG - Intergenic
1154367592 18:13726001-13726023 TTCCGAAGCCAGTTGAAGAGGGG - Intronic
1156655650 18:39282820-39282842 TTGCCAAAAATGTTGCAGTGTGG - Intergenic
1157699721 18:49753595-49753617 TGGCCAAGGTTGTTGATGAGAGG - Intergenic
1158052702 18:53242447-53242469 TTCCCAAGTAAGTTGAAGAGGGG + Intronic
1159132898 18:64300836-64300858 TTTCTAAGACTGGAGAAGAGTGG - Intergenic
1159605663 18:70471951-70471973 TTTCCAAGACATTTTAAGAGAGG + Intergenic
1165985144 19:39762097-39762119 TTGCCAAGACTGGAGTATAGTGG + Intergenic
1168282646 19:55313622-55313644 TGGCCAAGAAGGATGAAGAGAGG - Intronic
925641473 2:5989662-5989684 GGGCCATGAGTGTTGAAGAGAGG - Intergenic
927536272 2:23862448-23862470 TTGCCCAGACTGTAGTACAGTGG + Intronic
927663723 2:25014906-25014928 CAGCCAGGACTGTAGAAGAGGGG - Intergenic
927676851 2:25112413-25112435 TTGCAAAGAGTCTTGAAGGGGGG + Intronic
929337836 2:40772490-40772512 TTGGCAAGAGTGTTGGGGAGAGG - Intergenic
931566044 2:63616603-63616625 TTGCCAATAATGTTGATTAGTGG + Intronic
931832624 2:66068317-66068339 GTGGCAATAATGTTGAAGAGTGG + Intergenic
932184301 2:69679174-69679196 TTGCCCAGACTGTGGCACAGTGG + Intronic
933148141 2:78881494-78881516 TTGCCAAGACTGTTGGAGCATGG - Intergenic
937280810 2:120716107-120716129 TGGCCAGGACTGCTGAGGAGTGG - Intergenic
937498999 2:122457431-122457453 TTGGCAAGACTGTGGAGGAAAGG + Intergenic
939224245 2:139344900-139344922 TTGCCCAGACTGGAGAACAGTGG - Intergenic
942028056 2:171930652-171930674 TTGCCAAGGCTGGAGTAGAGTGG + Intronic
942132160 2:172891089-172891111 TTGCCCAGACTGGAGTAGAGTGG - Intronic
943817927 2:192279530-192279552 TTGCCCAGACTGATGTACAGGGG - Intergenic
944430604 2:199629560-199629582 TTTTCAGGAATGTTGAAGAGGGG - Intergenic
946719043 2:222584650-222584672 TTGCTAAGACTGTTGGAAAAGGG - Intronic
946877149 2:224140508-224140530 TTGCAAAGAATTTTGATGAGTGG - Intergenic
947416568 2:229902338-229902360 TTGCCCAGACTGGAGTAGAGTGG - Intronic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1170045945 20:12085330-12085352 TTCCCAAGATTGCTGGAGAGTGG + Intergenic
1170126567 20:12970401-12970423 TTGTCAAGACTGGCAAAGAGAGG - Intergenic
1175343164 20:58248131-58248153 CTGACAAGTCTGATGAAGAGCGG + Intergenic
1175594337 20:60218450-60218472 TTGCCAAGACTGGAGTACAGTGG - Intergenic
1178246406 21:30957191-30957213 TTCCCAAGACAGATAAAGAGTGG + Intergenic
1179410804 21:41161732-41161754 GTGCCATGACTGTGGAAGAATGG - Intergenic
1179493724 21:41758272-41758294 TTGCCTAGAATGTAGAAAAGAGG - Intronic
1181957270 22:26597037-26597059 TGGCCAAGAGTGTTGAGGTGGGG + Intergenic
1184297550 22:43534579-43534601 TTGCCCAGACTGGAGAACAGTGG - Intronic
950035799 3:9884613-9884635 GAGCCATGACTGTTGAAGGGAGG - Intergenic
950571191 3:13801075-13801097 TTGCCCAGAGTGGGGAAGAGGGG + Intergenic
951916086 3:27802338-27802360 CTGCCAAGACTGTTTACCAGAGG + Intergenic
952468647 3:33619716-33619738 TTCCCAAAACTGTTGAAAGGTGG + Exonic
952819957 3:37477761-37477783 TTGGCAAGTCTGATGAAAAGGGG - Intronic
954530829 3:51318337-51318359 TTGCCCAGACTGGTGAGCAGTGG - Intronic
955040743 3:55315459-55315481 TTACTATGACTGTTGAAGGGAGG + Intergenic
955091217 3:55752503-55752525 TTGCCAAGACTGCTGAACAAGGG + Intronic
956050843 3:65246629-65246651 TTGCCCAGAGTGCTGAGGAGTGG - Intergenic
956928462 3:74015601-74015623 ATGCCAAGTGTGTTGAGGAGAGG + Intergenic
958122652 3:89311906-89311928 TGGCCAAGAATATTGAAGAGTGG + Intronic
959278397 3:104306138-104306160 TTGCTAAGAATGTTGAATATTGG - Intergenic
960586956 3:119328906-119328928 TTTCCAGGATTGTTGAGGAGAGG + Intronic
960639701 3:119813582-119813604 TTGCCAAGCCTGGTCAAGTGGGG + Intronic
962123582 3:132590294-132590316 TTGCCAAGGCTGGAGTAGAGTGG + Intronic
963318208 3:143783889-143783911 TTTCTAAAACAGTTGAAGAGAGG - Intronic
965467891 3:169055119-169055141 TTGCCAGGACTTATGAAGGGTGG - Intergenic
966738412 3:183209526-183209548 TTGCCAAGGCTGCAGTAGAGTGG + Intronic
969246104 4:5933873-5933895 GTGACAAGACTGTTGGGGAGAGG + Intronic
970285812 4:14513273-14513295 TTGTCGAGATTCTTGAAGAGTGG - Intergenic
970490516 4:16568888-16568910 TTCCTCTGACTGTTGAAGAGGGG - Intronic
971717914 4:30204621-30204643 TTGGAAAGACTGTGGAAAAGGGG + Intergenic
971981503 4:33757141-33757163 TTGTCAAGACTTTTGTAAAGAGG + Intergenic
972360668 4:38322954-38322976 GTTCCCAGACTGTGGAAGAGAGG - Intergenic
973770362 4:54200483-54200505 TTGCCAAGACTGGAGTGGAGTGG - Intronic
976747777 4:88421744-88421766 TTGGCAAGAATGTGGAAAAGTGG - Intronic
979491293 4:121331222-121331244 TTGCCCAGGCTGTAGAGGAGTGG + Intronic
979569877 4:122209063-122209085 TTTCCAAGATTGTTGTAGACAGG + Intronic
980045830 4:127987310-127987332 TTGCCAAGACTGGAGTACAGTGG - Intronic
981926724 4:150148424-150148446 TTGCCCAGGCTGTAGTAGAGTGG + Intronic
984888322 4:184470648-184470670 TTGCCCAGACTGGTGTACAGTGG - Intronic
985470824 5:44361-44383 TTGCCCAGACTGGAGTAGAGTGG + Intergenic
987389385 5:17361840-17361862 TTGCCCAGACTGTAGTACAGTGG + Intergenic
988128493 5:27073656-27073678 TTGCAGAGACTGTTGCAGAGAGG - Intronic
994202906 5:96999137-96999159 TTGAAAAGACTTTTGAACAGAGG + Intronic
994708016 5:103229917-103229939 TTGGCAAGACTGTGGAGAAGAGG + Intergenic
998084084 5:139301926-139301948 ATGACAAGAATGTTGCAGAGTGG - Intronic
998530632 5:142881161-142881183 CTGCCAAGCATGTTCAAGAGTGG - Intronic
999439817 5:151592452-151592474 TTGCCAGGAATGTTGCAGAGGGG - Intergenic
999662602 5:153881387-153881409 TTGCCAAGAATGTTGTAAAAGGG - Intergenic
999684940 5:154094081-154094103 TTGCCAATACAGGTGAAGAATGG - Intronic
1000029850 5:157392483-157392505 GTGCCAAGACTGTTCAATGGGGG - Intronic
1003143203 6:3488735-3488757 TTGCCCAGGCTGTTGTAGAATGG + Intergenic
1006684018 6:35816875-35816897 ATGCCAAGACTATTTAATAGGGG + Intronic
1007399922 6:41597805-41597827 ATGCCAGGGCTGTTGAGGAGGGG - Exonic
1007506924 6:42342731-42342753 CAGCCAAGACTGTTGAAGACAGG - Intronic
1008399754 6:51051157-51051179 CTGCCAAGACTGTTCATGAATGG + Intergenic
1011678936 6:89764174-89764196 TTGCCCAGACTGTAGTACAGTGG - Intronic
1012366802 6:98450986-98451008 ATGCCAAGACAGTTGAATGGGGG - Intergenic
1012384847 6:98668202-98668224 TTGCCCAGACTGTAGGACAGTGG - Intergenic
1012871704 6:104680576-104680598 TTGCCAAAACTTTGGAACAGGGG + Intergenic
1013717922 6:112985592-112985614 TTGCCTTGACTGCTGAAAAGAGG + Intergenic
1013887728 6:114989921-114989943 TTGTCAAGAGGTTTGAAGAGAGG - Intergenic
1015757714 6:136624873-136624895 CTACCAAGACAGTAGAAGAGAGG + Intronic
1017567275 6:155701116-155701138 TTGGCAAGAATGTAGAATAGTGG - Intergenic
1017999323 6:159564969-159564991 TTGCCCAGGCTGTAGAACAGTGG + Intergenic
1018009263 6:159655034-159655056 TTGCCAAGGCTGTTGAGGTTGGG - Intergenic
1022266827 7:28764621-28764643 TTGCAAAGAGTTTTGAAAAGTGG - Intronic
1022806985 7:33832187-33832209 TTTCCAAGACTGTTGGAGCCCGG - Intergenic
1023321062 7:38998166-38998188 TTCACATGACTGTTGAAAAGGGG - Intronic
1024213597 7:47227901-47227923 TTGCCATGACAGTTGAGCAGCGG - Intergenic
1024608522 7:51043177-51043199 TTACAAAGACTGTGTAAGAGTGG - Intronic
1026618077 7:71925199-71925221 TTGCCCAGACTGTAGTACAGTGG - Intronic
1028794634 7:94889281-94889303 TTGCCAAAACTGTCAAGGAGGGG + Intergenic
1029164913 7:98581475-98581497 TTGCCAAGACAGTTCAATGGGGG + Intergenic
1032047443 7:128621564-128621586 TTGCCAAGACCTTTGATGACCGG - Intergenic
1032762168 7:134953589-134953611 TTACCAAGACTGTTCAAGGAAGG - Intronic
1033228045 7:139576247-139576269 TTGCCAAGGGGGCTGAAGAGTGG + Intronic
1033426928 7:141253105-141253127 GAGCCAAAACTGTGGAAGAGAGG - Intronic
1033791529 7:144796922-144796944 TTGCTGAGATTGTTGCAGAGAGG - Intronic
1034609566 7:152353531-152353553 TTACCCAGACTGGTGAACAGTGG + Intronic
1035561742 8:609772-609794 TTGCCAGGGCTGGTGAAGAGAGG - Intergenic
1036190716 8:6667868-6667890 TTGCCAAGGCTGTAGCACAGTGG - Intergenic
1037956114 8:23060403-23060425 ATGCCAAGACTGTTGAATGGAGG - Intronic
1038218102 8:25581533-25581555 ATGCCAAGACTCTAGAAGAATGG - Intergenic
1039094558 8:33869468-33869490 TGGCCAGGACTGGTGGAGAGAGG + Intergenic
1042990414 8:74633057-74633079 TTGCCCAGACTGTAGTACAGTGG + Intronic
1043036478 8:75206627-75206649 TTGTTAAGACTGTTGAATATTGG + Intergenic
1046001117 8:108421737-108421759 TTGCCAAGAATCTGGAAGTGGGG + Intronic
1046469884 8:114656856-114656878 TTGCCAAGACGGAGGAACAGTGG + Intergenic
1046571107 8:115967294-115967316 TAGCCAGTACTGTTGAAGTGAGG + Intergenic
1046773578 8:118140309-118140331 TTGCCCAGACTGGAGTAGAGTGG + Intergenic
1047237968 8:123059296-123059318 TTGCCAAGACTGTAGTGCAGTGG + Intronic
1050407667 9:5327200-5327222 TTGCTAAGACTGTTGGAAAAGGG - Intergenic
1051177160 9:14372359-14372381 TTGCAAAACATGTTGAAGAGAGG + Intronic
1052465281 9:28821888-28821910 GTGCATAGACTGTTGGAGAGTGG + Intergenic
1052794232 9:32908261-32908283 TAGCCAAGATTCCTGAAGAGAGG + Intergenic
1053338570 9:37301558-37301580 TTGCCAAGACTGGAGTACAGTGG - Intronic
1054977770 9:71168445-71168467 TTGCCAAGAATGGTGAACAGAGG - Intronic
1055628499 9:78199067-78199089 TTGCCCAGCCTGTTGTACAGTGG + Intergenic
1056924062 9:90817979-90818001 TTTCTTAGAGTGTTGAAGAGAGG - Intronic
1057459608 9:95248768-95248790 TTGACAAGAGGGTTGAAGAAGGG + Intronic
1058151155 9:101465035-101465057 TTGCCAAGAATTTTCAATAGTGG + Intergenic
1058792543 9:108464989-108465011 TTGCCAAGACAAATGAAAAGTGG - Intergenic
1059677540 9:116553775-116553797 TTTCCCAGACTGTCTAAGAGAGG - Intronic
1059869472 9:118555625-118555647 TTGCCCAGCCTGCTGAACAGTGG - Intergenic
1060916395 9:127394012-127394034 TTGCCCAGACTGGAGAACAGTGG - Intergenic
1061125078 9:128669716-128669738 TTGCCTAGGCTGGTGATGAGTGG + Intergenic
1061370428 9:130194560-130194582 TTGTCAAGGTTGTTGAGGAGTGG - Intronic
1185938622 X:4288071-4288093 TTGCACAGACTGTGGGAGAGAGG + Intergenic
1186045402 X:5531268-5531290 TTGCCCAGACTGTAGCAGAGTGG - Intergenic
1186649153 X:11540437-11540459 TTGCCATGATTATTGAAAAGAGG - Intronic
1188607363 X:32048560-32048582 TTAGCAAGAGTGGTGAAGAGAGG - Intronic
1188944738 X:36285492-36285514 TTGTCAAGACAGCTGAAGAAAGG - Intronic
1190773583 X:53534974-53534996 TTGCCCAGGCTGGAGAAGAGTGG + Intronic
1191208697 X:57861722-57861744 TTGCCAAGGCTGATGTTGAGAGG - Intergenic
1192249780 X:69402218-69402240 TTGTCAAAGCTGCTGAAGAGAGG - Intergenic
1192419108 X:71013174-71013196 TTGCCAAGACTGGAGTACAGTGG + Intergenic
1192931451 X:75810630-75810652 TTGCTAAGACTGTTGGAAAAGGG + Intergenic
1197690096 X:129490115-129490137 CTGACAACACTGTTGAAGAGAGG - Exonic