ID: 1149403710

View in Genome Browser
Species Human (GRCh38)
Location 17:56325604-56325626
Sequence GGGCTGCTGAAGCTGTGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 1, 3: 50, 4: 260}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149403710_1149403715 24 Left 1149403710 17:56325604-56325626 CCCATGCACAGCTTCAGCAGCCC 0: 1
1: 0
2: 1
3: 50
4: 260
Right 1149403715 17:56325651-56325673 GATGCCCCCTAGCTCCTGCTAGG 0: 1
1: 0
2: 0
3: 20
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149403710 Original CRISPR GGGCTGCTGAAGCTGTGCAT GGG (reversed) Intronic
900179013 1:1303262-1303284 CAGCTGGTGAAGCTGTGCAGTGG - Exonic
900319364 1:2074944-2074966 GGGCTGCTGAAGGTGGGGACTGG + Intronic
900437421 1:2637918-2637940 TGGATGCTGAAGCTTGGCATGGG + Intronic
900930382 1:5733455-5733477 GGGAGACGGAAGCTGTGCATGGG - Intergenic
902334995 1:15749569-15749591 GTGCTGCTGGAGCTGTCCAAGGG - Intergenic
903517853 1:23924355-23924377 TGGCTGGAGAAGCTGTGGATAGG + Intergenic
904187401 1:28716125-28716147 AGGATGCTGCAGCTGTGCTTTGG + Intronic
904215530 1:28915413-28915435 GGGCTGCTGTACCTGTGGAGAGG + Intronic
904419128 1:30380115-30380137 GGGCTGCAGGAGCTGGGCACAGG + Intergenic
905215292 1:36402125-36402147 GGGTTGCTGCAGCTGTGCCCAGG + Intergenic
905545936 1:38800887-38800909 GGGCAGCTGCAGCTGTGCCCAGG - Intergenic
906051916 1:42881173-42881195 GGGTGGCTGCAGCTGTGCCTGGG + Intergenic
907619289 1:55959955-55959977 AGGCTGCAGAAACTATGCATGGG - Intergenic
907761689 1:57367841-57367863 GGGAGGCTGCAGCTGTGCCTGGG - Intronic
907985231 1:59523993-59524015 GGGCGGCTGCAGATGTGCCTGGG - Intronic
908806498 1:67938034-67938056 GTCCTGCTGACACTGTGCATGGG - Intergenic
910758171 1:90712411-90712433 GGGCCGCTGCAGCTGGGGATGGG + Exonic
911098202 1:94073010-94073032 GGGCTGCTGAAGGCCTGCCTGGG - Intronic
911288772 1:96029197-96029219 GGGCGGCTGCAGCTGTGCCCAGG + Intergenic
912093657 1:106113751-106113773 GGGCAGCTGCAGCTGTGCCTGGG - Intergenic
912094361 1:106120729-106120751 GGGTGGCTGCAGCTGTGCCTGGG - Intergenic
914442446 1:147719288-147719310 GCCCTGCTGATGCTGTGCATGGG + Intergenic
914956645 1:152168409-152168431 GGGCTGCTGAAGGTGAGTACAGG + Intergenic
915567401 1:156723261-156723283 GAGCTGGTGGAGCTGTCCATTGG + Exonic
916966247 1:169945367-169945389 GGGCGGCTGCAGCTGTGCCCAGG + Intronic
917334291 1:173912537-173912559 GGGATGGTGAAGGTGGGCATTGG - Intronic
918778755 1:188669688-188669710 GGCCTGCTGAAACTGTTCAAGGG - Intergenic
919249260 1:195031021-195031043 GGGCAGCTGTAGCTGTGCCCAGG + Intergenic
919453888 1:197801013-197801035 GGGCAGCTGCAGCTGTGCCTGGG - Intergenic
921097654 1:211901276-211901298 GGGTGGCTGAGGCTGTGCTTGGG - Intergenic
921699468 1:218251205-218251227 AGCCAGCTGAAACTGTGCATGGG + Intergenic
922133808 1:222805690-222805712 GGGCTGCAGAAGTGGTGCCTGGG + Intergenic
922488141 1:225992457-225992479 GGGCTGGTGAAGCAGTGCTTGGG + Exonic
1062770140 10:92549-92571 GGGCAGCTGCAGCTGTGCCTGGG + Intergenic
1062893291 10:1082754-1082776 GTGCTGCTGGAGCTGTGCAGGGG - Intronic
1063186899 10:3659928-3659950 GAGCTCCTGAGGCTGTGCAAGGG + Intergenic
1065796932 10:29316307-29316329 TGACTGCTGAATCTGTGAATCGG - Intronic
1065806017 10:29394478-29394500 GGGCAGCTGCAGCTGTGCCTGGG - Intergenic
1065973568 10:30823798-30823820 GTGCTGCTGACTCTGTGCACAGG + Intronic
1066101630 10:32122969-32122991 GGGCAGCTGCAGCTGTGCCTGGG + Intergenic
1066508112 10:36066299-36066321 GGGTGGCTGGAGCTGTGCATGGG - Intergenic
1068283779 10:54909645-54909667 GGGCAGCTGCAGCTGTGCCTAGG + Intronic
1068438168 10:57017617-57017639 GCCCTGCTGATGCTATGCATGGG + Intergenic
1068830117 10:61484443-61484465 GACCTTCTGAAGCTGTTCATGGG - Intergenic
1069561889 10:69436325-69436347 GGGCAGCTGCAGCTGTGCCTGGG + Intergenic
1070096324 10:73340913-73340935 GGGCAGCTGCAGCTGCACATGGG + Intronic
1070547738 10:77465821-77465843 TGCCTCCTGAAGCTGTGCAATGG - Intronic
1071242706 10:83725808-83725830 GGGCTACTGAGGCTGAACATGGG + Intergenic
1071819535 10:89265285-89265307 GGGCAGCTGTAGCTGTGCCTGGG + Intronic
1072619888 10:97072979-97073001 GGGTTGCTTAGGCTGTGCTTCGG - Intronic
1072753183 10:97999140-97999162 GGGCAGCTGCAGCTGTGCCTGGG - Intronic
1073490592 10:103850634-103850656 GGGTTCCTGGAGCTGAGCATTGG - Intronic
1074028643 10:109663215-109663237 GGGTAGCTGCAGCTGTGCGTGGG - Intergenic
1075311477 10:121417517-121417539 GGGCAGATAAAGTTGTGCATAGG - Intergenic
1075726619 10:124613826-124613848 GGGCTGCAAGATCTGTGCATAGG - Exonic
1076478061 10:130766372-130766394 GGGCTGCTGAGGCTGAGGCTAGG + Intergenic
1077131308 11:974113-974135 TGGCTGCAGATGCTGTGCACTGG - Intronic
1077790577 11:5435184-5435206 GGAATGCTGATGCTGAGCATGGG - Intronic
1078101450 11:8332647-8332669 GGGTTGCTGAAGCTGGGGCTTGG - Intergenic
1078345644 11:10545203-10545225 GGGCAGCTGCAGCTGTGCCCAGG + Intergenic
1078563706 11:12395450-12395472 GGGCTGCTGAAGATGAGCGCCGG + Intronic
1079391331 11:20024419-20024441 GGGCTGCTGAGGCTGTGCCCTGG + Intronic
1079472443 11:20790753-20790775 GGGCGGCTGCAGCTATGCCTGGG + Intronic
1081934627 11:46896260-46896282 GGGCAGAGGAAGCTGTGCAACGG - Exonic
1082687812 11:56260874-56260896 GGGTGGCTGCAGCTGTGCCTGGG + Intergenic
1083988430 11:66232092-66232114 GGGCTGCTGGACTGGTGCATGGG - Intronic
1084056869 11:66639709-66639731 AGGATGGTGAAGCTGTTCATCGG + Exonic
1084061277 11:66677060-66677082 AGGATGGTGAAGCTGTTCATCGG - Exonic
1084105005 11:66975409-66975431 GGGCTCCTGCAGCTTTCCATAGG - Exonic
1084760593 11:71268231-71268253 GGGCTGAGGGAGCTGTGCAGGGG - Intergenic
1084871309 11:72100312-72100334 GGGCTGCTGAAAATTTACATGGG - Intronic
1087036129 11:93758351-93758373 GAGCTGCTGCAGCTGCGCCTGGG - Intronic
1089305372 11:117523058-117523080 GGGATTATGTAGCTGTGCATGGG + Intronic
1089773717 11:120821376-120821398 GGGATCCTGATGCTGTGCCTAGG + Intronic
1090316994 11:125801169-125801191 GGACTGCAGAATTTGTGCATGGG - Intergenic
1090514789 11:127412942-127412964 GGACAGCTGCAGCTGTGCCTGGG + Intergenic
1091311520 11:134578309-134578331 TGTCTGCTTGAGCTGTGCATTGG + Intergenic
1091794765 12:3291761-3291783 GCTGTGCTGAAGCTGTGCCTTGG - Intergenic
1096216268 12:49799135-49799157 GCGCTGCTGCAGCTGGCCATAGG - Intronic
1097755290 12:63401002-63401024 GTCCTGCTGATACTGTGCATGGG + Intergenic
1098671532 12:73235832-73235854 GGGTGGCTGTAGCTGTGCCTGGG + Intergenic
1098951469 12:76644825-76644847 GGGCAGCTGCAGTTGTGCCTGGG - Intergenic
1099561070 12:84174309-84174331 GGGTGGCTGCAGCTGTGCCTGGG + Intergenic
1100799071 12:98212457-98212479 GCCCTGCTGACGCTGTGCACAGG - Intergenic
1100981750 12:100167533-100167555 GGGCAGGTGAAGCTTTGCAGGGG - Intergenic
1101372651 12:104143499-104143521 GGGCTGCTGAGGCTGAGGACAGG + Intergenic
1101857197 12:108453506-108453528 GGGCTGCTGCAGGAGTGCATAGG - Intergenic
1103403676 12:120660035-120660057 CAGCTGCTGAAGGTGTGCACAGG + Intronic
1104046306 12:125165536-125165558 GGGATGCTGAAGCTTAGAATGGG - Intergenic
1104742412 12:131188355-131188377 GGGCAGCTGCAGCTGTGCCTGGG - Intergenic
1105954601 13:25268813-25268835 GGGCGGCTGCAGCTGTGCCCGGG - Intronic
1105986371 13:25571201-25571223 CTGCTGGGGAAGCTGTGCATGGG + Intronic
1106543302 13:30709574-30709596 GGGCTGGTGAAGTTGTTCAAGGG + Intergenic
1107841023 13:44458577-44458599 GGGCAGCTGCAGCTGTGCCTGGG - Intronic
1108017126 13:46087158-46087180 GGGCAGCTGCAGCTGCGCCTGGG + Intronic
1109030103 13:57179888-57179910 GGGTGGCTGCAGCTGTGCCTGGG + Intergenic
1109271638 13:60262117-60262139 AGGCTGCTAAAACTGTGCAGAGG - Intergenic
1109348367 13:61145078-61145100 GGGCAGCTGCAGCTGTGCCTGGG - Intergenic
1109687685 13:65843369-65843391 GGGAAGCTGCAGCTGTGCCTGGG - Intergenic
1109837359 13:67877368-67877390 GGGCAGCTGCAGCTGTGCCCAGG - Intergenic
1109982194 13:69923836-69923858 GGGCAGCTGCAGCTGCGCCTGGG - Intronic
1109988014 13:70016338-70016360 GGGCTGCTGCAGATGTCCCTGGG - Intronic
1110217286 13:73036955-73036977 GGGCAGCTGAAGAGGTACATAGG - Intergenic
1110497664 13:76188506-76188528 GAGCTCCTGAAGCTGAGAATAGG - Intergenic
1111268716 13:85853317-85853339 GGGCTGCTGCAGCTGCACCTGGG - Intergenic
1113488903 13:110676894-110676916 GGGCAGCAGAGGATGTGCATGGG - Intronic
1113589661 13:111489441-111489463 GGGCTGCCGAGGGTGAGCATGGG + Intergenic
1115484872 14:33901034-33901056 GGGCAGCTGCAGTTGTGCCTGGG - Intergenic
1116356650 14:43938787-43938809 GGGCAGCTGCAGCTGTGCCGGGG - Intergenic
1116617166 14:47154442-47154464 GGGTGGCTGCAGCTGTGCCTGGG - Intronic
1116961539 14:50973012-50973034 GGGCTGCCGCAGCTGCGCCTGGG - Intergenic
1118708534 14:68501558-68501580 GTGCTGCTGACCCTGTGCTTGGG - Intronic
1119032898 14:71206343-71206365 TGGGTGCTGCAGCTGTGCATGGG + Intergenic
1121595958 14:95162543-95162565 GGGCTGCTGAACCTATGACTGGG - Intergenic
1121899824 14:97683851-97683873 GGGATGCTGACGTTGTGCACTGG - Intergenic
1122975868 14:105170493-105170515 GGGCTCCTGAGGGTGTGCAGGGG - Intergenic
1126688294 15:51267209-51267231 GAGCTGCTCCAGCTGTGAATGGG - Intronic
1128965166 15:72051471-72051493 GGGCGGCTGCAGCTGTGCCTGGG - Intronic
1129831284 15:78672582-78672604 GTCCTGCTGATGCTGTGCATGGG + Intronic
1130829554 15:87585385-87585407 GAGCTGCTGCAGATGTGCATGGG - Intergenic
1131711683 15:95062510-95062532 TGTCTGCTGAAGCTGTCCAGTGG + Intergenic
1135551143 16:23399171-23399193 GGGCTGCCGAGGCTGAGCCTGGG - Intronic
1136117500 16:28104073-28104095 GGGCAGATGCAGCTGTCCATTGG - Intronic
1138433165 16:56982309-56982331 GGGCACCTGAAGCTCTGCCTGGG - Intronic
1138730119 16:59185064-59185086 GGCCTGCTGAAGCTGCCCCTGGG + Intergenic
1139088798 16:63618634-63618656 GGGCGCCTGCAGCTGTGCCTGGG + Intergenic
1139150862 16:64380952-64380974 GGGCAGCTGCAGCTGTGCCTGGG - Intergenic
1139590627 16:67931033-67931055 GGGCTGCTGAGGCTGCCCCTAGG + Intronic
1142940788 17:3378516-3378538 GGGCAGCTGCAGCTGCGCCTAGG + Intergenic
1144764444 17:17725030-17725052 GGGCTGCTGACCCTGGGCCTCGG + Intronic
1145217214 17:21061340-21061362 GGGCTGCTGCAGCTGTGCTTGGG + Intergenic
1145861220 17:28211958-28211980 GGGATGCTGAAGCTTGGCAGGGG + Intergenic
1146086831 17:29837997-29838019 GGGCAGCTGCAGCTATGCCTGGG - Intronic
1146459362 17:33033471-33033493 GGGCAGCTGCAGCTGTACCTGGG - Intronic
1146711194 17:35042936-35042958 GCCCTGCTGAAGTGGTGCATGGG + Intronic
1149403710 17:56325604-56325626 GGGCTGCTGAAGCTGTGCATGGG - Intronic
1149568745 17:57657373-57657395 GGGCTGCTGAAGCTGCAAATTGG + Intronic
1151603280 17:75119782-75119804 GGGCTGCTTCAGCTCAGCATGGG + Intronic
1152530229 17:80914368-80914390 GGGTGGCTGCAGCTGTGCCTGGG - Intronic
1152602328 17:81270691-81270713 AAGCTGCTCAAGCTGTGCATCGG - Intronic
1153608051 18:6854732-6854754 GGGCAGCTGCAGCTGTGCCTGGG - Intronic
1156244574 18:35284959-35284981 GGGCAGCTGCAGCTATGCCTGGG + Intronic
1156782916 18:40873781-40873803 GGCCTTCTGCAGCTGAGCATGGG - Intergenic
1157946667 18:51988431-51988453 GGGCTGCGGAGGCTCTCCATGGG + Intergenic
1159774378 18:72586058-72586080 GGGTGGCTGCAGCTGTGCCTGGG + Intronic
1161508111 19:4655114-4655136 CGCCTGGTGAAGCTGTGCAGGGG + Exonic
1164984340 19:32637669-32637691 GGGCGGCTGCAGCTGCGCCTGGG - Intronic
1166059963 19:40320108-40320130 GGGCTGCTTAGGGTGTGCTTTGG - Exonic
1166570689 19:43794918-43794940 GGGCTGAAGCAGCTGTCCATAGG + Intergenic
1167109059 19:47448109-47448131 CGGCTGCTGAACCTGCGCGTGGG - Exonic
924963724 2:57333-57355 TGGCAGCTGCAGCTGTGCAAGGG - Intergenic
926889744 2:17629025-17629047 GGGCTTCTGAAGCTTTGCCTTGG - Intronic
926914498 2:17879063-17879085 GGGCTGTTGAAGCGGTGGCTGGG + Intronic
927857064 2:26534533-26534555 GGGCTGCAGCAGCTGGGCTTAGG - Intronic
928756167 2:34528214-34528236 GGGCTGTAAGAGCTGTGCATGGG + Intergenic
928840391 2:35598706-35598728 GGGCAGCTACAGCTGTGCCTGGG - Intergenic
928946756 2:36778706-36778728 GGGCTGTTGCAGCTGTGCCCAGG - Intronic
929943340 2:46351878-46351900 GGGCAGCAGGGGCTGTGCATTGG - Intronic
930743348 2:54856487-54856509 TGGCTGTTCAAGCTGTCCATAGG - Intronic
930946771 2:57084824-57084846 GGGCTGCTGGAGCCATGCCTGGG + Intergenic
931264286 2:60646703-60646725 GGGCCCCTGAAGATGTGCAGGGG - Intergenic
931309681 2:61066171-61066193 GGCCGGCTGAGGCTGTGCACGGG - Intronic
931734045 2:65177955-65177977 GGGCAGCTGCAGCTGTGCCCCGG + Intergenic
932054849 2:68433334-68433356 GGGCAGCTGCCGCTGTGCCTGGG + Intergenic
932144240 2:69304931-69304953 GGGCTGCTGTCGCTGAGGATGGG + Intergenic
932644751 2:73488509-73488531 GGGCAGCTGCAGCTGTGCCCAGG + Intronic
933801263 2:85961839-85961861 GGGCAGCTGCAGCTGTGCCTGGG + Intergenic
934653631 2:96106048-96106070 GGCCTGCTGAAGCTCTCCATGGG + Intergenic
934767976 2:96891163-96891185 CTCCTGCTGCAGCTGTGCATGGG - Intronic
935127074 2:100233842-100233864 GGGCTGATGAAGTTCAGCATTGG + Intergenic
935637328 2:105259415-105259437 GAGCTGCTGAAGCTGATCACAGG - Intergenic
940612310 2:156006862-156006884 GGGCAGTTGCAGCTGTGCCTGGG + Intergenic
942653968 2:178195181-178195203 CGGCTGGGGAAGTTGTGCATTGG + Intronic
943064021 2:183068790-183068812 GTGCAGCTGCAGCTGTGCCTGGG - Intergenic
943226416 2:185184953-185184975 GGGCAGCTGAAGCTGTGCCCAGG - Intergenic
946525432 2:220514211-220514233 GGGCTGCAGAATCTGGGCTTTGG + Intergenic
1168983517 20:2027348-2027370 GGGCAGCTGCAGCTGTGCCTGGG + Intergenic
1169345173 20:4823391-4823413 GGGCTGCTTCAGCTGCGCCTCGG + Intronic
1170251228 20:14285456-14285478 GGGCTGCTTAACCTGTATATTGG + Intronic
1172152224 20:32798510-32798532 GGGCTCCTGAAGCTTGGCCTCGG - Exonic
1172245642 20:33443568-33443590 GGGCTGCTGGAGCTGCGCGCCGG - Exonic
1173893763 20:46534192-46534214 GGGTGGCTGCAGCTGTGCCTGGG - Intergenic
1173963582 20:47093719-47093741 GCCCTGCTGACGCTGTGCACAGG - Intronic
1176043871 20:63082561-63082583 GAGCGGCTGCTGCTGTGCATGGG + Intergenic
1177624967 21:23647026-23647048 TGGGTCCTGAAGCTGTGCCTTGG + Intergenic
1177989379 21:28019352-28019374 GGGCAGTTGCAGCTGTGCCTGGG + Intergenic
1179009417 21:37544585-37544607 CTGCTGCTGAGGCTGTGCAGTGG - Intergenic
1179192352 21:39134113-39134135 GTGATGCTGGAGCTGGGCATTGG - Intergenic
1179797085 21:43791367-43791389 GAGCTGCTGAAGGTGTGGAAAGG + Exonic
1180074344 21:45455187-45455209 GGGCTGCTGAGTCTCTGGATTGG - Intronic
1182763968 22:32745264-32745286 GGGGAGCTGAGGGTGTGCATGGG - Intronic
1183025067 22:35058697-35058719 GGGTGGCTGAAGCTGTGCCTGGG + Intergenic
1184054496 22:42035328-42035350 GGGCAGCTGGAGCTGTGCCTGGG + Intronic
949226234 3:1699438-1699460 GGGCAGCTGCAGCTGTGCCCAGG - Intergenic
950269597 3:11603568-11603590 GGGCTTCTGAAGCTTTCCCTTGG - Intronic
950576348 3:13834364-13834386 GGGCTGCTGATGCTGGGGGTCGG + Intronic
952500179 3:33954321-33954343 GGGCCACAGAAGCTGTGCAAAGG + Intergenic
953769183 3:45765626-45765648 ATGCTGCTGATGCTGGGCATTGG - Exonic
954450502 3:50569054-50569076 GGCCGGGTGGAGCTGTGCATGGG - Intronic
955073261 3:55589458-55589480 TGCCTGCTGGAGCTGTGCAGTGG + Intronic
957346329 3:78965999-78966021 CGGCTGCTGCAGCTGGGGATTGG - Intronic
957922973 3:86771743-86771765 GGGTGGCTGCAGCTGTGCCTGGG - Intergenic
958908369 3:99966223-99966245 AGGCTGCAGAGGCTGGGCATGGG + Intronic
959702161 3:109308766-109308788 GGGTTGTTGAAACTGTGCAGGGG + Intronic
959877708 3:111405407-111405429 GCACTGCTGAAGCTGCTCATAGG - Intronic
962105381 3:132383559-132383581 GGGTGGCTGCAGCTGTGCCTGGG + Intergenic
962763938 3:138543556-138543578 GGGCAGATGCAGCTGTGCCTGGG + Intronic
962824651 3:139089092-139089114 GGGTGGCTGCAGCTGTGCCTGGG + Intronic
963906217 3:150775145-150775167 GGGCGGCTGCAGCTGTGCCCAGG + Intergenic
964927375 3:161975408-161975430 GGGCAGCTGCAGCTGTGCCCAGG + Intergenic
966254074 3:177898446-177898468 GGGCAGCTGCAGCTATGCCTGGG - Intergenic
966952323 3:184832907-184832929 GGTCTGTTGAAGCCTTGCATGGG + Intronic
967956270 3:194880133-194880155 TGGCTGCTGAGGCTGAGCGTTGG - Intergenic
968980889 4:3848823-3848845 GGGCAGCTGCAGCTGTGCCTGGG + Intergenic
971869492 4:32216649-32216671 GGGCAGCTACAGCTGTGCCTAGG + Intergenic
973880931 4:55270262-55270284 GGGATGCAGCAGCTGTGCCTAGG - Intergenic
974179058 4:58360914-58360936 GGGCAGCTGCAGCTGTGCCTGGG + Intergenic
974235711 4:59179367-59179389 GGGCAGCTGCAGCTGTACCTAGG - Intergenic
974420047 4:61662259-61662281 GGGCAGCTACAGCTGTGCCTGGG - Intronic
974514904 4:62896949-62896971 GGGCAGCTTCAGCTGTGCCTGGG - Intergenic
976137197 4:81951231-81951253 TGGCTGCAGAGGCTGTGCATGGG - Intronic
976680052 4:87746080-87746102 GGGCAGCTGCAGCTGTGCCCAGG + Intergenic
978663525 4:111155057-111155079 GGGCAGCTGCAGCTGTGCCTGGG + Intergenic
979638052 4:122978992-122979014 GGGCAGCTGCAGCTGTGCCTGGG + Intronic
979649610 4:123114675-123114697 AGGCAGCTGCAGCTGTGCCTGGG + Intronic
980180115 4:129392308-129392330 GGGTAGCTGCAGCTGTGCCTGGG - Intergenic
980744854 4:137000597-137000619 GGTCAGCTGCAGCTGTGCCTGGG - Intergenic
982545062 4:156724053-156724075 GGGCAGCTGCAGCTGTGCCTGGG - Intergenic
984285907 4:177728558-177728580 GCCCTGCTGATGCTGTGCAGGGG + Intergenic
984325081 4:178241582-178241604 GGGTGGCTGCAGCTGTGCCTGGG - Intergenic
985367356 4:189245741-189245763 GGGATGCTGGAGCTTGGCATGGG - Intergenic
988837074 5:35044218-35044240 GGCCTGCTGAAGCTGTGTTGGGG + Intronic
989153738 5:38324702-38324724 AGGCTGCAGAAGCTGTGGAAAGG + Intronic
989163403 5:38412601-38412623 GGGCTGCTGCAGCTGAACAATGG + Exonic
989264988 5:39463292-39463314 GTGATGCTGATGCTGAGCATAGG - Intergenic
989536125 5:42565547-42565569 CTGTTACTGAAGCTGTGCATGGG + Intronic
989730562 5:44642313-44642335 GGGCAGCTGCAGCTGTGCTTGGG + Intergenic
990898931 5:60729243-60729265 GGGATGCTGAAGTTGGGCAGGGG + Intergenic
992480916 5:77151950-77151972 AGGCTGCTGAAGCTGAGGAGAGG + Intergenic
993520636 5:88895648-88895670 GGCCTGCTGAAGGTGAGTATAGG - Intronic
994719808 5:103367352-103367374 GCCCTGCTGACACTGTGCATGGG - Intergenic
995028901 5:107457085-107457107 GGGCCACTGAGGCTGTTCATTGG - Intronic
995739327 5:115338402-115338424 AGGCTGCTGAAGGTTAGCATCGG - Intergenic
996594687 5:125186673-125186695 GGGCTGCTTGAGATGTGTATGGG - Intergenic
996923939 5:128800426-128800448 GGGTGGCTGCAGCTGTGCCTGGG + Intronic
999887299 5:155937178-155937200 GGGTGGCTGCAGCTGTGCTTGGG + Intronic
1005599048 6:27407532-27407554 GTCCTGCTGACACTGTGCATAGG - Intergenic
1005674647 6:28141563-28141585 GGGAGGCTGGAGCTGTGAATAGG - Intergenic
1005790511 6:29295576-29295598 GGACAGCTGCAGCTGTGCTTGGG - Intergenic
1005813344 6:29532174-29532196 GGGCTGCTGGAGCTGGGCTGTGG - Intergenic
1006411877 6:33878519-33878541 GGGCTGCTGAAGCCAGGCCTGGG + Intergenic
1006419698 6:33925410-33925432 GGGGTGCTGGAGCTGGGCCTGGG - Intergenic
1009241804 6:61193897-61193919 GGGCTTCTGCAGCTGTGCCTGGG + Intergenic
1009930167 6:70167616-70167638 GTGCTGATGAAGATGTGAATAGG - Intronic
1010519603 6:76817528-76817550 GGGTGGCTGCAGCTGTGCCTGGG - Intergenic
1010874262 6:81082098-81082120 GTGCTGGGGAAGCTGTCCATAGG - Intergenic
1014579725 6:123122369-123122391 GGCCTGTTGAAACAGTGCATGGG - Intergenic
1017124514 6:151052690-151052712 GTGCTGCTGGAGCTATGCAATGG - Intronic
1017574530 6:155787460-155787482 GTCCTGCTGACGCTGTGCATGGG + Intergenic
1017906571 6:158760856-158760878 GAGCTGCTGGAGCTGGGCACGGG - Intronic
1018536594 6:164827053-164827075 GCCCTGCTGATGCTGTGCACAGG + Intergenic
1018898862 6:168040994-168041016 GCCCTGCTGAACCTGAGCATGGG - Intronic
1021097124 7:16547385-16547407 GGGCAGCTGTAGTTGTGCCTGGG - Intronic
1021097147 7:16547475-16547497 GGGCAGCTGCAGCTGTGCCTAGG - Intronic
1022124056 7:27338728-27338750 GGGATGGTGAAGCTGGGCATAGG + Intergenic
1022391784 7:29950082-29950104 GAGCAGCTGCAGCTGTGCCTGGG - Intronic
1023155005 7:37240628-37240650 ATGCAGCTGAAGCTGTGCTTAGG - Intronic
1024043639 7:45573796-45573818 GGGCTGCGGGAGCTGTGCTGGGG - Intergenic
1024562158 7:50653685-50653707 GGGCTGGTGAAACGATGCATCGG + Intronic
1025042720 7:55662240-55662262 GGCCTCCTGAAGGTGTGCACAGG - Intergenic
1026370285 7:69691688-69691710 GGGCAGCTGCAGCTGTGCCCAGG + Intronic
1026482431 7:70790313-70790335 AGGCTGCTGATGCTGTTCATGGG - Exonic
1027687489 7:81295321-81295343 GGGTTGCTGCAGCTGTGCAGAGG + Intergenic
1028432814 7:90767114-90767136 GCCCTGCTGACACTGTGCATGGG - Intronic
1029973880 7:104814979-104815001 GGGCAGCTGCAGCTGCGCCTGGG + Intronic
1031265197 7:119572460-119572482 TGGCAGCTGCAGCTGTGCCTGGG - Intergenic
1031786459 7:126040439-126040461 GGGCAGCTGCAGCTATGCGTGGG - Intergenic
1032090861 7:128910815-128910837 GGGCGGGTGGAGGTGTGCATGGG - Intergenic
1032687285 7:134248205-134248227 GAGCAGCTGAAGCTGGGCCTAGG + Intronic
1033284599 7:140030007-140030029 GGGCTTCTTAAGCTGCGGATAGG - Intronic
1033807726 7:144973634-144973656 CAGCTGCTGAAGCTGTGGCTTGG - Intergenic
1034010133 7:147520839-147520861 GGTCTACGGAAGCTGAGCATGGG - Intronic
1034210506 7:149358624-149358646 GGGCAGCTGCAGCTGTGCCCAGG + Intergenic
1036188510 8:6647739-6647761 GGTCTGCTGCAGCTGGGGATGGG + Intergenic
1037721923 8:21451597-21451619 GTGATGTGGAAGCTGTGCATGGG - Intergenic
1039044399 8:33436681-33436703 AGGATGGTGAAGCTGTTCATCGG - Intronic
1043082673 8:75785139-75785161 GGGCAGCTGCAGCTGTGCCTGGG + Intergenic
1043533146 8:81172080-81172102 GGGTGGCTGCAGCTGTGCCTGGG + Intergenic
1045297150 8:100882055-100882077 GCCCTGCTGACACTGTGCATGGG - Intergenic
1046459805 8:114518409-114518431 GGGCAGCTGCAGCTGTGCTCAGG + Intergenic
1048802497 8:138206896-138206918 GGGATGCTGAAGTTGTGTGTAGG - Intronic
1049061233 8:140277759-140277781 GGGCTGCAGAGGCTGGGCAAGGG + Intronic
1049709795 8:144058340-144058362 GAGCCGCTGAAGGTGTCCATGGG + Exonic
1050808788 9:9718501-9718523 GGGCAGCTGCAGCTGTGCCTGGG - Intronic
1051069251 9:13143506-13143528 GTGCTGCTGAAGTTGTACTTAGG + Exonic
1051373083 9:16374808-16374830 GGTCTGCTGAAGTTCTGCCTGGG - Intergenic
1055816429 9:80212586-80212608 GCACAGCTGAAGCTGTGCCTGGG - Intergenic
1056939288 9:90941446-90941468 AGGCTGCTGCAGTTGTCCATGGG - Intergenic
1057643805 9:96854255-96854277 GGGCGGCTGAGGCTGAGCGTTGG - Exonic
1062311292 9:135938846-135938868 GGGCTGATGGAGCTGTGCCTGGG - Intronic
1062569966 9:137180489-137180511 GAGCTGCTGAAGCTGCGCTTTGG - Exonic
1188859974 X:35244548-35244570 GGGCGGCTGCACCTGTGCCTGGG + Intergenic
1189023812 X:37370673-37370695 GGGCAGCTACAGCTGTGCCTGGG - Intronic
1189856541 X:45229813-45229835 GGGTGGCTGCAGCTGTGCCTGGG + Intergenic
1192265426 X:69534158-69534180 GGGCAGCTGCAGCTGTGCCCAGG + Intergenic
1194891571 X:99385125-99385147 GGGCAGCTGCAGCAGTGCCTGGG + Intergenic
1197406912 X:126065081-126065103 GGGCAGCTGCAGTTGTGCCTGGG - Intergenic
1197609651 X:128623693-128623715 GGGTGGCTGCAGCTGTGCCTGGG + Intergenic
1197609674 X:128623783-128623805 GGGTGGCTGCAGCTGTGCCTAGG + Intergenic
1199360122 X:146907591-146907613 GGGCAGCTGCAGCTGTGACTGGG + Intergenic
1199691182 X:150310168-150310190 GGGCTGCTGCCGGTGTGCCTAGG - Intergenic
1200424962 Y:3009974-3009996 GGGCAGCTGCAGCTAAGCATGGG + Intergenic