ID: 1149406470

View in Genome Browser
Species Human (GRCh38)
Location 17:56356957-56356979
Sequence AATTATGCACAGGGGGCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 129}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149406470 Original CRISPR AATTATGCACAGGGGGCTTT GGG (reversed) Intronic
905184936 1:36189410-36189432 AATTAAGCACACAGTGCTTTGGG + Intergenic
905291305 1:36923466-36923488 AATTTTGCAGTGGGGGCTTAAGG + Intronic
906215294 1:44034889-44034911 AATTTGGCACTGGGGGCTCTGGG - Intergenic
907353758 1:53855187-53855209 AATGATGCAGAGAGGGCTTCTGG - Intronic
910968826 1:92833762-92833784 AATTATTCACTGGATGCTTTTGG - Intronic
916782953 1:168056184-168056206 AATTTTGCACAGGAAGCGTTGGG - Intronic
917015448 1:170526511-170526533 CTTTATGTACATGGGGCTTTTGG - Intergenic
921418298 1:214916208-214916230 AATCCTGCTCAGGGGGGTTTAGG + Intergenic
924146484 1:241081137-241081159 AATAATGCAAAGGTGACTTTTGG - Intronic
924270914 1:242331820-242331842 TATTATGCACAGGGCACTCTAGG - Intronic
924848465 1:247798046-247798068 AATTATGCCCAGTGGGGTGTGGG + Intergenic
1063802301 10:9594160-9594182 TATTAGGCAGAGGGGACTTTGGG - Intergenic
1066714036 10:38267038-38267060 TATTATGCACAGGGCACTCTAGG + Intergenic
1075001834 10:118804454-118804476 AATTAGGCACAAAGGGCATTAGG + Intergenic
1075412137 10:122236170-122236192 AATTCTGCACAGGTACCTTTAGG + Intronic
1076337493 10:129718225-129718247 GAATGTGCACAGGGAGCTTTAGG + Intronic
1076439630 10:130472160-130472182 AATTATCCACAGGGGCCCTTCGG - Intergenic
1078302898 11:10151723-10151745 AATTATGGACTGGGGGACTTTGG + Intronic
1080408680 11:32002870-32002892 AATTTTCCACAGTGGACTTTTGG + Intronic
1084685804 11:70694529-70694551 AATTATCCACAGTAGGCTGTGGG - Intronic
1086903430 11:92392912-92392934 AATTAGTGACAGGGAGCTTTGGG + Intronic
1087155269 11:94895786-94895808 AATTATTAACAGGAGGGTTTGGG - Intergenic
1090844301 11:130518074-130518096 AATTTTGCAAAGGCGGTTTTAGG - Intergenic
1091571056 12:1686453-1686475 AAATAGGCACAGGGGGATTGCGG + Intergenic
1094866806 12:34543346-34543368 AATTATGCAAAGGGATATTTGGG - Intergenic
1095873457 12:47055412-47055434 AAGTATGCACAAGGTGCTGTAGG - Intergenic
1098179205 12:67828136-67828158 CAAAATGCACAGGGTGCTTTAGG - Intergenic
1099920846 12:88955412-88955434 ATTGATGCACAGGAGGCCTTTGG - Intergenic
1101674231 12:106903187-106903209 AATAAGGCACAGGGCACTTTTGG + Intergenic
1103761745 12:123255130-123255152 AATCATGAACATGGGGTTTTGGG - Intronic
1103925765 12:124422682-124422704 AATTAAGCCCAGGGGGGTGTGGG + Intronic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1112642197 13:101288470-101288492 ATTTATGCACAAGTTGCTTTAGG + Intronic
1114217653 14:20668917-20668939 TTTTATTCACAGGGTGCTTTTGG - Intergenic
1118007566 14:61577300-61577322 AATTTTGGACTGGGGGCCTTGGG - Intronic
1122093264 14:99353636-99353658 ATTTATACACAGAGGGCTTAAGG + Intergenic
1123976245 15:25557038-25557060 AGTGATCTACAGGGGGCTTTTGG + Intergenic
1124991055 15:34674197-34674219 AAATATGCACAGGTGGCTGTGGG - Intergenic
1125034990 15:35112926-35112948 AATTAAGCACAGGGCACTTGAGG - Intergenic
1129496521 15:75987462-75987484 TATTATGAAGAGGGGCCTTTTGG + Intronic
1133313043 16:4863449-4863471 AAATATCCACATGTGGCTTTTGG - Intronic
1140991442 16:80216534-80216556 AAGTATGCACTGGGCACTTTAGG - Intergenic
1144264481 17:13554955-13554977 CATTATTCTCAGGGGGCTTGAGG - Intronic
1145695285 17:26782407-26782429 AATTAGGCAGAGGTGGCTGTGGG + Intergenic
1148729488 17:49823658-49823680 TATTATGCACAGGGTCCATTGGG - Intronic
1149297114 17:55271065-55271087 TATTATGCCCAGGGGACATTTGG - Intronic
1149406470 17:56356957-56356979 AATTATGCACAGGGGGCTTTGGG - Intronic
1152996676 18:413865-413887 AATTATGCTCAGTGGGGTTGGGG + Intronic
1154428181 18:14288266-14288288 AATTATGGACAGGAGGTTGTTGG + Intergenic
1155188200 18:23405740-23405762 AATTATGTACATGGAGCTGTTGG - Intronic
1157911924 18:51624492-51624514 ATTTATGCCCCGAGGGCTTTAGG - Intergenic
1159127678 18:64244124-64244146 AATTATGTACAGGTAGTTTTGGG + Intergenic
1162247089 19:9410478-9410500 ATTTCTGCACAGGTGGCTTCTGG - Intergenic
1162806247 19:13139317-13139339 AATTATGTACAGGGGGGTGGGGG - Exonic
925514958 2:4671545-4671567 AATTACGAACAGGTGGCTTCAGG + Intergenic
928632217 2:33205648-33205670 CATTCTGAACAGGGGGCTATGGG - Intronic
930130444 2:47844496-47844518 TATATAGCACAGGGGGCTTTTGG - Intronic
930585331 2:53260912-53260934 CATTAAGCATAGTGGGCTTTTGG - Intergenic
932813717 2:74844899-74844921 AGTTATACACAAGGGGCTATGGG - Intronic
933277699 2:80301409-80301431 AATTAAGAACAGGTGGCATTTGG + Intronic
936019363 2:108983222-108983244 CATTATGGACAGGAGGCTTTAGG + Intronic
942766811 2:179467123-179467145 AATTATGCACCTGGGGATATGGG - Intronic
945671539 2:212808068-212808090 AATTATGCTCAAGGTTCTTTGGG - Intergenic
947081516 2:226402377-226402399 ATTGAGGCACAGAGGGCTTTAGG - Intergenic
947131814 2:226934824-226934846 AATTATGCACAGAGGGATGTGGG - Intronic
1171154264 20:22858056-22858078 GATTATGCCCAGGGTGCTATGGG - Intergenic
1173057689 20:39632005-39632027 AATTCTTCAGAGTGGGCTTTAGG + Intergenic
1173682576 20:44895967-44895989 AATTATGTACAGGATGCTGTGGG + Intronic
1174940542 20:54921548-54921570 GACTTTGCACAAGGGGCTTTTGG - Intergenic
1175378254 20:58544257-58544279 AAATGTGCACAGGTAGCTTTAGG + Intergenic
1176846582 21:13881156-13881178 AATTATGGACAGGGGGTTGGTGG - Intergenic
1178700947 21:34833781-34833803 AATTTGGCACAGTGGGCCTTAGG + Intronic
1179107272 21:38413350-38413372 AAGTATGCAGAGAGGGCTCTTGG - Intronic
1180156443 21:45979741-45979763 ACTCAAGCACAGGGGGCTTCAGG - Intergenic
1184514109 22:44950694-44950716 TATTATGCAAAGAGGGCTTGGGG + Intronic
1184819540 22:46899120-46899142 AATGATGAGCAAGGGGCTTTAGG + Intronic
1184965793 22:47971112-47971134 AATTCAGTAAAGGGGGCTTTGGG + Intergenic
1185185997 22:49400618-49400640 CATTATTCACAGGAGGCTTATGG - Intergenic
949409537 3:3748899-3748921 AATTATGCACAGAGGGCTATGGG + Intronic
953941411 3:47101666-47101688 AATTATGCAAGTGGGTCTTTAGG + Intronic
954235266 3:49252192-49252214 AATTTTGCACAGGAAGTTTTGGG - Intronic
954364940 3:50140670-50140692 AATTATGCACCAGGAGCTGTAGG - Intergenic
955256036 3:57332442-57332464 ATTTTTGCACAGGGGGCAATAGG + Intronic
959946122 3:112126892-112126914 AAATATGCCTAAGGGGCTTTGGG + Intronic
961495490 3:127288189-127288211 ATTTATGCACAGGGGCTTCTCGG - Intergenic
961520361 3:127464218-127464240 AATTATCCACAGAGGGCATCAGG - Intergenic
963529773 3:146460496-146460518 AATTTTTCACAGGGTGCCTTTGG - Intronic
964989307 3:162786431-162786453 AATTATGCACAGGAATCATTTGG - Intergenic
967087715 3:186109338-186109360 ATTTATGCACCGGGGGCCATTGG + Intronic
969013952 4:4090688-4090710 AAATATTCACAAGGGACTTTAGG - Intergenic
970710303 4:18854044-18854066 AATTATTCACAGGGTATTTTTGG - Intergenic
975049655 4:69844655-69844677 GATTTTTCACAGGGGACTTTAGG - Intronic
976559798 4:86488391-86488413 AACTTTGCACAAGGGGCTTGAGG - Intronic
980215300 4:129844986-129845008 AAATAAGCACAGGGTGCTTGGGG - Intergenic
981746825 4:148060378-148060400 AAATATGGACAGGTTGCTTTTGG + Intronic
983329910 4:166312385-166312407 ATTTATTCAAAGGGGACTTTTGG + Intergenic
983608802 4:169620018-169620040 CTATAAGCACAGGGGGCTTTTGG + Intronic
985268474 4:188172498-188172520 AATTATGCAAGGGTGGTTTTAGG - Intergenic
986061967 5:4200356-4200378 AATTATGCACGGATGGCATTAGG - Intergenic
986785868 5:11113334-11113356 AATTATGCACAACCGGCTGTGGG - Intronic
989300677 5:39888846-39888868 AATTTTGCACAGGAAGCTTTGGG - Intergenic
990951365 5:61301809-61301831 AAATCTGGACAGTGGGCTTTAGG + Intergenic
991413336 5:66366790-66366812 AAATATGAACAGAGGGCTATGGG + Intergenic
993359713 5:86959208-86959230 CATTATGCACCAGGGCCTTTCGG + Intergenic
995839872 5:116433559-116433581 CTTTATGCACAGGGTGCTTTGGG + Intergenic
996084009 5:119285439-119285461 AATTCTGCACAAGTGGCTTTGGG + Intronic
997152432 5:131512729-131512751 AATTATGAAGTGGGGCCTTTGGG + Intronic
998409215 5:141896451-141896473 AATTTGGCACAGGAAGCTTTGGG - Intergenic
1004145486 6:13062260-13062282 AATTAGGCAGAGGGGTCTTAGGG - Intronic
1005357595 6:24999448-24999470 AGTCATGCACAAGGGGGTTTGGG - Intronic
1014829609 6:126086910-126086932 AGGTATGCACAGGGAGCTATGGG - Intergenic
1016178952 6:141119974-141119996 AACTAGGCACAGGGGGATTATGG + Intergenic
1016799182 6:148151840-148151862 AATTATGCCCAGGGATCATTAGG + Intergenic
1019145250 6:169971747-169971769 AATTATTCAAAGGGCGCTTGCGG - Intergenic
1024533759 7:50413236-50413258 CATTATGCATAATGGGCTTTAGG - Intergenic
1028367473 7:90050501-90050523 AAATTTTCTCAGGGGGCTTTTGG - Intergenic
1029162532 7:98562942-98562964 ATTCAGGCACAGGGGGTTTTTGG + Intergenic
1030616850 7:111746256-111746278 AACCATGCAGAGGGGGCTCTAGG + Intronic
1030770253 7:113465779-113465801 GATTATTAATAGGGGGCTTTAGG + Intergenic
1034482650 7:151334547-151334569 AATTTTGCAAAGGTGGTTTTAGG - Intergenic
1037044214 8:14276952-14276974 AATTATGTAACGGGGCCTTTTGG + Intronic
1038559354 8:28557892-28557914 AAATATGTACAGGGTGCATTGGG + Intronic
1039615142 8:38949662-38949684 AATTATACACAGAGCCCTTTTGG - Intronic
1040468432 8:47716575-47716597 GATAATGCTCAGGAGGCTTTGGG + Intronic
1042147749 8:65749129-65749151 ATGAATGCACAGGGAGCTTTGGG - Intronic
1042636591 8:70882892-70882914 GATAAAGCACAGGGGGATTTAGG - Intergenic
1043928983 8:86069323-86069345 AATTTTGGACAGGGTTCTTTCGG - Intronic
1046877096 8:119267391-119267413 AATTATACACAGAGTGCTATAGG + Intergenic
1047982278 8:130195702-130195724 CATTATGCAAAAGGGGCTTAAGG + Intronic
1050246889 9:3699727-3699749 AGTGATCAACAGGGGGCTTTTGG - Intergenic
1054724880 9:68640290-68640312 ACTTTGGCACAGGGGGCTTAGGG + Intergenic
1056938525 9:90936381-90936403 AATGATGCAGAGCAGGCTTTGGG + Intergenic
1185830254 X:3294989-3295011 AAATATGGACATGTGGCTTTTGG - Intergenic
1187106607 X:16249795-16249817 AGTTATGCACTGGGTGCTGTAGG + Intergenic
1187376475 X:18759944-18759966 AGTTATCCAAATGGGGCTTTTGG + Intronic
1190413041 X:50156060-50156082 ATTTATGCAGAGGAGGCTTCAGG + Intergenic
1192075481 X:67991242-67991264 CATTATGCACTGGGGCCTGTAGG + Intergenic
1198125589 X:133640539-133640561 ATATCTGCACAGGGGGCCTTCGG - Intronic
1200941917 Y:8792367-8792389 TATTATTTACAGGAGGCTTTTGG - Intergenic