ID: 1149408034

View in Genome Browser
Species Human (GRCh38)
Location 17:56375011-56375033
Sequence TTCTTCAGTGTTTCCTACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 267}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149408034_1149408040 15 Left 1149408034 17:56375011-56375033 CCTGAGTAGGAAACACTGAAGAA 0: 1
1: 0
2: 2
3: 17
4: 267
Right 1149408040 17:56375049-56375071 GGATCTGAGGGGTTGTGATATGG 0: 1
1: 0
2: 0
3: 12
4: 129
1149408034_1149408035 -6 Left 1149408034 17:56375011-56375033 CCTGAGTAGGAAACACTGAAGAA 0: 1
1: 0
2: 2
3: 17
4: 267
Right 1149408035 17:56375028-56375050 GAAGAATCAGACTTGATCCAAGG 0: 1
1: 0
2: 1
3: 16
4: 163
1149408034_1149408036 2 Left 1149408034 17:56375011-56375033 CCTGAGTAGGAAACACTGAAGAA 0: 1
1: 0
2: 2
3: 17
4: 267
Right 1149408036 17:56375036-56375058 AGACTTGATCCAAGGATCTGAGG 0: 1
1: 0
2: 0
3: 8
4: 120
1149408034_1149408041 30 Left 1149408034 17:56375011-56375033 CCTGAGTAGGAAACACTGAAGAA 0: 1
1: 0
2: 2
3: 17
4: 267
Right 1149408041 17:56375064-56375086 TGATATGGAACATACTAAGTAGG 0: 1
1: 0
2: 0
3: 12
4: 107
1149408034_1149408038 4 Left 1149408034 17:56375011-56375033 CCTGAGTAGGAAACACTGAAGAA 0: 1
1: 0
2: 2
3: 17
4: 267
Right 1149408038 17:56375038-56375060 ACTTGATCCAAGGATCTGAGGGG 0: 1
1: 0
2: 1
3: 5
4: 101
1149408034_1149408037 3 Left 1149408034 17:56375011-56375033 CCTGAGTAGGAAACACTGAAGAA 0: 1
1: 0
2: 2
3: 17
4: 267
Right 1149408037 17:56375037-56375059 GACTTGATCCAAGGATCTGAGGG 0: 1
1: 0
2: 0
3: 5
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149408034 Original CRISPR TTCTTCAGTGTTTCCTACTC AGG (reversed) Intronic
902618764 1:17638454-17638476 TTCTTCAGTTTCTCTTCCTCTGG + Intronic
904318834 1:29683454-29683476 TGCTCCAGTGTCTCCTCCTCCGG + Intergenic
905336471 1:37248082-37248104 TTTGTCAGTGTTTCCTACTCAGG - Intergenic
905673586 1:39809123-39809145 TTCTTCAGGCTTCCCTTCTCTGG + Intergenic
905942440 1:41874852-41874874 TTCTCCAGTGTGTCCACCTCAGG + Intronic
907368124 1:53979448-53979470 TACTTCAGTGTTTCCTAACTTGG - Intergenic
907845591 1:58203396-58203418 TACTTCAGGGTTCCCTAATCTGG + Intronic
910179525 1:84466243-84466265 TTCTTCCAGGTTTCCTTCTCAGG - Intergenic
912639736 1:111333368-111333390 TTCTGGAGTGCTTCCTCCTCTGG - Intergenic
912665534 1:111576230-111576252 TTCTTCAGTGTTGCCTGGTGTGG - Intronic
913999467 1:143680350-143680372 TTCTTCAGAGTGTCCTCCCCAGG - Intergenic
914194576 1:145438954-145438976 CTCTTCAGAGTGTCCTCCTCAGG - Intergenic
914475909 1:148021836-148021858 CTCTTCAGAGTGTCCTCCTCAGG - Intergenic
914783572 1:150807926-150807948 TTCTGCAGTGTTTTCTACTTTGG - Intronic
914894241 1:151654145-151654167 TTTTTCAGTGTTTTGTCCTCAGG + Intronic
915671530 1:157492786-157492808 CTCTATAGTGTTTCCTATTCTGG + Intergenic
916060882 1:161098060-161098082 GGCTTCAGGGTTTCTTACTCGGG - Intergenic
916315897 1:163447065-163447087 TTCTTGAGTGACTCCTACCCGGG + Intergenic
918350340 1:183648842-183648864 GTCTTCAGTTTTTCCTGCGCTGG - Intronic
920428428 1:205897841-205897863 TTCTGCAGTGTGCCCTTCTCTGG - Intergenic
920429487 1:205907944-205907966 TTCTGCAGTGTGCCCTCCTCTGG + Intergenic
920532126 1:206710657-206710679 TTCTGCAGTGTCACCTCCTCTGG - Intronic
922119074 1:222644395-222644417 TTTTTCAGAGCTTCCTCCTCCGG - Intronic
923012994 1:230103952-230103974 TTCAGCAGTGTTCCTTACTCAGG + Intronic
924422102 1:243919007-243919029 TTCTCCATTGATTCCTACTAGGG - Intergenic
1063971156 10:11382092-11382114 GTCTGTAGTCTTTCCTACTCAGG - Intergenic
1064910765 10:20399407-20399429 TTCTTCTGTGTCTCCTCCACGGG - Intergenic
1065029477 10:21570266-21570288 TTCTGCAGTGTTGCCCACACTGG + Intronic
1065577197 10:27133312-27133334 TTCTTAAGTCTTTCCCACTCAGG + Intronic
1066668429 10:37811217-37811239 TTCTACAGTGGTTCTTACACTGG - Intronic
1067328536 10:45292787-45292809 GTCACCAGTGTTGCCTACTCTGG - Intergenic
1071114715 10:82204498-82204520 TTCTGCAGTGTTTCCTTTACTGG + Intronic
1071404065 10:85311656-85311678 TTCTTGAGTTTTTACTTCTCAGG + Intergenic
1071569350 10:86688131-86688153 TTCCTCACTGTTTTCTACTTGGG + Intronic
1072605846 10:96982139-96982161 TTCTTCAGGGTTGTCTTCTCTGG - Exonic
1072769679 10:98127111-98127133 TTCTTCAAGGTTTCCTTCCCAGG - Intergenic
1072875950 10:99173465-99173487 TTCTCCTGTGTTCCCTACTTTGG - Intronic
1072909706 10:99488802-99488824 TTCTAAAGTGTTTACTACTCTGG + Intergenic
1073191356 10:101652513-101652535 TTCTTGAGGGTTGCCTACTTTGG - Intronic
1073631156 10:105150504-105150526 TTCTTCACTATTTCCTCCCCAGG - Intronic
1075586706 10:123663825-123663847 TTCTGCCCTGTTTCCTTCTCTGG + Intergenic
1077940356 11:6834284-6834306 TTCTTCAATGTCTCCCACACTGG + Intergenic
1078657321 11:13253789-13253811 TTCTTTTGTGTTTCCTATCCTGG - Intergenic
1080714997 11:34791678-34791700 TTCTAAAGGGTTTCCAACTCTGG - Intergenic
1081103172 11:39030668-39030690 TTCTTCAGTGTATCATGCTAAGG + Intergenic
1082056516 11:47822086-47822108 TTCTTCACTGTTCACTTCTCAGG - Exonic
1082733323 11:56826657-56826679 TTCTTTAGTGTTTGCTTGTCTGG - Intergenic
1087804987 11:102545668-102545690 GTGTTCAGTGCTTCCTCCTCAGG + Intergenic
1088451870 11:109990020-109990042 TTCTTCTGTCTCTCCTGCTCTGG - Intergenic
1088589772 11:111393431-111393453 GTCTTCAGTGTGTCCTTCTCAGG - Intronic
1089193518 11:116675684-116675706 TTTTTCATTGTTTCCTTGTCTGG - Intergenic
1090038781 11:123272057-123272079 CTCTTTAGTATTTCTTACTCTGG - Intergenic
1090374616 11:126280046-126280068 CTCTTCAGTGTCCCCTTCTCTGG - Intergenic
1090987937 11:131788990-131789012 TTCTTGAGTGTTTCCTTCCAGGG + Intronic
1092964071 12:13624890-13624912 TCCTTCCATCTTTCCTACTCTGG + Intronic
1093150590 12:15616684-15616706 TGCTTAATTGTTTTCTACTCGGG - Intergenic
1095592551 12:43920111-43920133 AACTTCAGTGTTTCAAACTCAGG - Intronic
1096488128 12:51997477-51997499 GTCTTCAGTGGTTACTCCTCTGG + Intergenic
1100629699 12:96375421-96375443 TTCTTCTATGTTTCCTCCTTAGG + Intronic
1102193816 12:111009630-111009652 ATCTTCAGGGTTTCTTCCTCAGG - Intergenic
1102874699 12:116440695-116440717 TTGTTCAGTGTCTCCTCCTTAGG + Intergenic
1105063462 12:133175135-133175157 TCCTTCAGTGTTTGCTTGTCTGG - Intronic
1105555397 13:21443331-21443353 GTTTTCAGTATTTCCCACTCGGG + Intronic
1106329551 13:28726883-28726905 TTCCTCACTGTTTCCTACCTGGG + Intergenic
1106980979 13:35279729-35279751 GTCTTCAGTCTGTCCTTCTCAGG + Intronic
1107528096 13:41253868-41253890 ACCTTCAGTGTTTCTTACTCTGG - Intronic
1108538559 13:51412922-51412944 TATTTCAGTGTTACCTACTGAGG - Intronic
1108632866 13:52303150-52303172 CTCTTGAGTGTGCCCTACTCTGG - Intergenic
1109093711 13:58083179-58083201 TTCTTCATTGTTTCTTAATGTGG - Intergenic
1110036462 13:70692052-70692074 TTCTTCAGTTTTTGTTTCTCTGG + Intergenic
1111859650 13:93685839-93685861 CTCTTCAATCTTTCCTACTGGGG - Intronic
1112158920 13:96848521-96848543 TGCTTAAGTGCTTTCTACTCAGG - Intergenic
1112435223 13:99387067-99387089 TTCTTGAGTGTTTGCTAATCAGG + Intergenic
1114689631 14:24568487-24568509 TCCCTCAGTGTTTGCTTCTCTGG - Intergenic
1115596177 14:34911605-34911627 CTCTACAGAGTTTCCTATTCTGG - Intergenic
1116465261 14:45224193-45224215 TTCTTTGGTGTTTCCTGCTTTGG + Exonic
1118351734 14:64976980-64977002 TTACCCTGTGTTTCCTACTCTGG + Intronic
1118903396 14:70005061-70005083 TTCTTCAGCAGTTCCTCCTCTGG + Intronic
1120096111 14:80389812-80389834 TTAGTCAGTGTTTCCTATTATGG + Intergenic
1120409285 14:84131579-84131601 AGCTCCAGTGTTTCCTACTGAGG + Intergenic
1124720041 15:32104022-32104044 TGCTTCAGTGTTGCCTCTTCTGG + Intronic
1124850105 15:33328412-33328434 ATCTTCAGTTATTCCTTCTCAGG + Intronic
1125285365 15:38087135-38087157 GTCTACAGTGTTTCCTAATTTGG - Intergenic
1126607908 15:50498588-50498610 TTCTGCAGTTTTTCCTACGATGG + Exonic
1127036626 15:54925683-54925705 TTCTTCAGCTTTTCCTTGTCTGG + Intergenic
1127632665 15:60841267-60841289 TTCCTCTGTGTTTCATACCCAGG - Intronic
1128056102 15:64701355-64701377 TATTTCAGTGTTTCTTACCCTGG - Intronic
1131813218 15:96195222-96195244 TCTCTCAGTTTTTCCTACTCTGG + Intergenic
1135060804 16:19269897-19269919 TTCTTTAGTGTTTTCTACAGGGG - Intergenic
1136670830 16:31855395-31855417 TTCTTCAGTTTTTGCTTGTCTGG - Intergenic
1143915584 17:10290160-10290182 TTGTTCAGTGTTTCCTGGGCTGG + Intergenic
1146291276 17:31609141-31609163 TCCTTCAGTCTTCCCTTCTCAGG - Intergenic
1149330405 17:55575663-55575685 TTCCCCAGTGTTTCCCCCTCTGG - Intergenic
1149408034 17:56375011-56375033 TTCTTCAGTGTTTCCTACTCAGG - Intronic
1150531274 17:65984942-65984964 TTGTTCAGTCTTTCTTCCTCAGG - Intronic
1151288238 17:73129090-73129112 TTCTGCAGAGTTCCCTATTCTGG - Intergenic
1152322724 17:79617245-79617267 CTCTTCTGTCTTTCCTGCTCTGG + Intergenic
1153734014 18:8045606-8045628 CTCTACAGATTTTCCTACTCTGG - Intronic
1155204935 18:23550363-23550385 TTCATCAGTCTTTCCTTTTCGGG + Intronic
1155206004 18:23558522-23558544 TTCCTCAGTCTTTCCTTTTCTGG - Intronic
1155688330 18:28583236-28583258 TGCCTCAGTGTTTCTCACTCTGG - Intergenic
1156649361 18:39206178-39206200 TTCTTCTGTGTTTCTCAGTCAGG - Intergenic
1158001275 18:52622188-52622210 TTCTTCATTTTTTCCTACTAGGG + Intronic
1158257680 18:55571647-55571669 TTGTTAAGTGTTTTCTACACAGG - Intronic
1158617345 18:59000427-59000449 TACTACAGTGTTTCCTACCATGG - Intergenic
1159161828 18:64651940-64651962 TTCCTAAGTCTTTCCTATTCTGG + Intergenic
1159579265 18:70217033-70217055 TCCTTCAGTGTTTCCTATTTCGG + Intergenic
1161014500 19:1977051-1977073 TTCTGCAGCGTATGCTACTCGGG + Intronic
1163172936 19:15545210-15545232 TTCTTCAGTGCCTTCTGCTCAGG - Intronic
1165481631 19:36067933-36067955 ACCTTCTGTGTGTCCTACTCGGG + Exonic
1166693048 19:44835613-44835635 TCCTCCAGTCTTTCCTCCTCAGG - Intergenic
1168715968 19:58527589-58527611 TGGTTCAGTGTTTTCCACTCAGG + Intronic
925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG + Intronic
926761873 2:16285268-16285290 TTCTTCTGTCTGTCCTACTTTGG - Intergenic
926990442 2:18674494-18674516 TCCTTCAGTATTTGCTAATCTGG + Intergenic
927400593 2:22706191-22706213 TTCTTCAGTGTTTGCTTTTCTGG - Intergenic
928452440 2:31388604-31388626 TTCTTCAGTGCTGCTTCCTCAGG + Intronic
928476048 2:31629103-31629125 TTATTCAGTGTTTTCTAGACCGG - Intergenic
928710027 2:33993908-33993930 TGCCACAGTGTTTCCTACTATGG - Intergenic
929091954 2:38226479-38226501 TTCTTCATTTGTTCCTTCTCTGG - Intergenic
931124117 2:59254612-59254634 ATCTTCTGTATTTCCTACACAGG - Intergenic
931749070 2:65315068-65315090 TTATTCAGTGTCTGCTGCTCTGG - Intronic
932506648 2:72239279-72239301 TACTTCAATGTTTCTTTCTCAGG + Intronic
933607936 2:84403655-84403677 TGCTTCTGTGTTTTCTACACTGG + Intergenic
933615971 2:84482867-84482889 TTTTTAAGTGTCTCCTCCTCAGG - Intergenic
933937368 2:87217421-87217443 TTCTTTCTTGTTTCCTCCTCTGG + Intergenic
935764028 2:106346825-106346847 TGCTTCAGTGTTGACTATTCTGG + Intergenic
936355772 2:111748381-111748403 TTCTTTCTTGTTTCCTCCTCTGG - Intergenic
936915422 2:117634981-117635003 TTTTTCAGTCTTTCTTATTCTGG + Intergenic
937406760 2:121636854-121636876 TTCTTCAAAGTTTTTTACTCAGG - Intronic
937787758 2:125922321-125922343 TTCTTCTGTCTATCCCACTCTGG - Intergenic
937789139 2:125939806-125939828 TTCTTAAGTGTTTTCTCCTTGGG + Intergenic
938187458 2:129244240-129244262 TTCTTCAGTGGTTCTTGGTCTGG + Intergenic
938855426 2:135305781-135305803 TCCTTCAGTTTTTCCTTGTCTGG + Intronic
940368430 2:152874717-152874739 GTCTTCACTGCTTCCTACTGTGG + Intergenic
943657526 2:190525515-190525537 TCCTTCAGTGTTTCCAACCAAGG + Intronic
944568900 2:201022523-201022545 TTCTGGAATGTTTCCTGCTCTGG - Intronic
945555937 2:211275991-211276013 GTCTTCAGAGTTTCCTACAGGGG - Intergenic
947824668 2:233097247-233097269 TTCTTGTGTGTTTCCTTATCTGG + Intronic
1171933134 20:31246576-31246598 TGCTAGAGTGCTTCCTACTCTGG + Intergenic
1173015094 20:39218085-39218107 TTCTTTGTTGTTTCCTAGTCAGG + Intergenic
1173756119 20:45518031-45518053 TCCTGCAGTGTTGCCTCCTCTGG + Intergenic
1173929893 20:46809853-46809875 TTGTTCAATGTTGCCTTCTCAGG - Intergenic
1174167748 20:48597511-48597533 TTCTTCAATGTCACCTCCTCAGG - Intergenic
1177423272 21:20890015-20890037 TTCTTCAGTGTCTGCTCCACAGG + Intergenic
1178807230 21:35849572-35849594 TTCTTTAGAATTTCCTAGTCAGG - Intronic
1179279926 21:39925539-39925561 TACTTCTTTGTTTCCTTCTCTGG - Intronic
1181710840 22:24687058-24687080 TTGTTCAATGTTTCCCACTTTGG - Intergenic
1181716390 22:24733112-24733134 TTCTTCAGGGTATCCTACAAGGG + Intronic
1182165685 22:28170737-28170759 TTCATCAGTGTTGGTTACTCTGG + Intronic
1182793703 22:32974956-32974978 ATCTTCAGTCTATCTTACTCTGG + Intronic
1183917519 22:41134224-41134246 TTCTTGAGTTTTACCTAATCAGG + Intronic
950889912 3:16394620-16394642 TTCTTGAGTGTTGGTTACTCAGG + Intronic
952143007 3:30500466-30500488 TTCTTTGTTGTTTCCTATTCTGG + Intergenic
952207446 3:31194025-31194047 TTCTGCACTGTTCCTTACTCAGG - Intergenic
952627078 3:35418585-35418607 TTCTTCAGTGTTCACTGCACAGG - Intergenic
953024658 3:39137928-39137950 TCCTTTAGTGTTCCCTCCTCTGG - Intronic
954449246 3:50562884-50562906 TTGTACAGGGTTTCTTACTCTGG - Intronic
955376236 3:58399675-58399697 TCCTTCAGTATTTCCTAAGCTGG - Intronic
955587471 3:60496465-60496487 TTTTTAAGTGTTTGCCACTCTGG - Intronic
956260722 3:67337544-67337566 TCCCTCAGTGTTTGCTTCTCTGG - Intergenic
956837490 3:73107405-73107427 TGCTTAAGTGTGTCCAACTCAGG - Intergenic
957235464 3:77583211-77583233 TGCTTCAGTCTTTTCAACTCAGG + Intronic
958600864 3:96295006-96295028 CTCTTCAGTGCTGCCTACGCTGG + Intergenic
959139614 3:102470219-102470241 TGCTACAGTGTTTCTTACCCTGG - Intronic
959686078 3:109148127-109148149 TTTTCCAGAGTTTCCTCCTCAGG + Intergenic
960523852 3:118686243-118686265 TTTCTAAGTCTTTCCTACTCTGG - Intergenic
961230737 3:125305362-125305384 TTCTTCAGTTTTTGTTAGTCTGG - Intronic
962442236 3:135431351-135431373 TTCCTCAGTGTTTGCTCATCTGG - Intergenic
962886244 3:139630598-139630620 GTCTTCACTGATCCCTACTCTGG - Intronic
963079180 3:141375542-141375564 TTCTTCAGTGCTACCACCTCAGG - Intronic
966156604 3:176923091-176923113 CTCTTAAGTGTCTCATACTCTGG - Intergenic
970538412 4:17053269-17053291 TTCTTCCCTGTTTCTTCCTCAGG - Intergenic
970777204 4:19689424-19689446 ATCTTCAGTGTTTTCTGCTTTGG - Intergenic
971443641 4:26717857-26717879 TAATTCATTATTTCCTACTCAGG - Intronic
971894068 4:32567454-32567476 AACTTCAGTGTTTCCTTCTTGGG - Intergenic
974146584 4:57955531-57955553 TGCTTCAGTTTTTACTATTCAGG + Intergenic
975052841 4:69887504-69887526 TTCTTCAGAGATTCTTAATCTGG - Intergenic
975218664 4:71787853-71787875 TTCTTCAGTGTCTTCTATTTTGG - Intronic
976256438 4:83105433-83105455 TTCCTGAGCATTTCCTACTCAGG - Intronic
980424399 4:132607868-132607890 TTCTCAAGTGTTTCCAACTAGGG + Intergenic
981457452 4:144970041-144970063 TTCTTCAGGGTTACTTCCTCAGG + Intronic
982162371 4:152583174-152583196 TTCTTCAGCCATTCCTTCTCAGG + Intergenic
983704236 4:170638426-170638448 TTCTTCAGTGTCTGTGACTCTGG + Intergenic
984102958 4:175508797-175508819 TTATTCATTGGTTCCTTCTCAGG + Intergenic
984689354 4:182707955-182707977 TTCATCAGTTTTTTCTACTGGGG + Intronic
985009239 4:185565800-185565822 TTCTCCACTGTTACTTACTCTGG + Intergenic
985209179 4:187573453-187573475 GTGTACAGTGTTTCCTGCTCAGG - Intergenic
985371848 4:189293415-189293437 TGCTTCATTGTTGCCTGCTCTGG + Intergenic
986808936 5:11335577-11335599 TTCTTCAATGTGTACTACTATGG - Intronic
987147029 5:15001735-15001757 TTTTCCAGTGTTTCATAGTCTGG - Intergenic
987690312 5:21257702-21257724 ATCTTCAGTGTTTAATCCTCAGG + Intergenic
991139067 5:63217702-63217724 TTTTTCAGTCTTTTCTTCTCCGG - Intergenic
991960662 5:72040741-72040763 TCCTTCAGTGCTTGCTTCTCTGG - Intergenic
992406991 5:76468868-76468890 TTTTTCAGGGTATCCTTCTCTGG + Intronic
993067821 5:83122314-83122336 TAGGTCAGTGTTTCCTACCCAGG + Intronic
994405189 5:99336528-99336550 TTCCTCAGTGTTTACTTGTCAGG - Intergenic
995314488 5:110752668-110752690 TCTTTCAGTGTTCCCTACTCAGG - Intronic
996134451 5:119822345-119822367 TCCTTTTGTGTATCCTACTCTGG + Intergenic
997228091 5:132224513-132224535 ATCTTCACTGTTCCCTAGTCTGG - Intronic
997314467 5:132920688-132920710 TTCTTCAGTGTTTTCTTTTACGG - Intronic
997758915 5:136425843-136425865 ATCTTCTGTTTTTCCTAGTCTGG - Intergenic
998925588 5:147121492-147121514 TCCTTCAGTGTTTGCTTGTCTGG + Intergenic
999924696 5:156362134-156362156 TTCTTCATTGGCTCCTACTTAGG - Intronic
1001130365 5:169058723-169058745 TTCTAATCTGTTTCCTACTCTGG + Intronic
1001172756 5:169436636-169436658 TTGTTCAGATTTGCCTACTCTGG - Intergenic
1003493334 6:6642418-6642440 TTTTTCAGTGTGTCCTAATTTGG - Intronic
1004063181 6:12218224-12218246 TTCTTCTCTGTTTCCTTTTCTGG + Intergenic
1005145985 6:22690582-22690604 TTCCTCATTGTTTCCTAGTTAGG - Intergenic
1007806571 6:44454454-44454476 TGCTTCTGTGTTTCCTATTGTGG - Intergenic
1008556114 6:52674301-52674323 TTCTTCAGAGTTTTCAATTCTGG - Intronic
1008821351 6:55635340-55635362 TTCTGCAATGTTTCATACTAAGG - Intergenic
1010017708 6:71123509-71123531 TTCTTAGGAGTTTCCAACTCTGG + Intergenic
1010673196 6:78711225-78711247 TAAGTCAGTGTTTCTTACTCAGG + Intergenic
1010816953 6:80369299-80369321 ATTTCCAGTGTTTCCCACTCTGG + Intergenic
1010943759 6:81950796-81950818 TTCATCAGAATTTCCTACCCTGG + Intergenic
1012025113 6:93979820-93979842 TTCATCTGAGTTTCCTGCTCTGG + Intergenic
1013253349 6:108357772-108357794 TTCTTCTGTGTTTTATAATCTGG + Intronic
1014294511 6:119602209-119602231 TTCTTCAGATATTCCTTCTCTGG + Intergenic
1014436531 6:121426765-121426787 TTATTCAATGTTTCCAATTCTGG + Intergenic
1014943656 6:127472513-127472535 TTATAGAGTATTTCCTACTCTGG + Intronic
1018307504 6:162473004-162473026 TATATCAGTCTTTCCTACTCAGG + Intronic
1018978573 6:168583843-168583865 TTCTTCAGTTTGTCCCACTCAGG - Intronic
1023176786 7:37443242-37443264 CTCTCCAGTGTTTTCTACTGAGG + Intronic
1023758242 7:43440048-43440070 TTCTGCAGTGCTGCCTCCTCCGG + Intronic
1023770856 7:43555434-43555456 CTCTTCAGTGCTTCCTGATCAGG - Intronic
1024842895 7:53607790-53607812 TTCTTCGGTTTTTCCTAAACAGG - Intergenic
1027945574 7:84741172-84741194 TTCCACACTGTTTTCTACTCTGG - Intergenic
1027972410 7:85102317-85102339 TTCTACTATGTCTCCTACTCTGG + Intronic
1028255621 7:88593199-88593221 TTCCTCAGTGTTTGCTTATCTGG - Intergenic
1028712235 7:93922165-93922187 ATTTTCAGTTTTTCCTTCTCTGG - Exonic
1029867752 7:103653710-103653732 TTCTACAGTGTCTTCTACCCAGG + Intronic
1030104198 7:105973090-105973112 TTGTTCAGGGTTTTCTTCTCAGG + Intronic
1030483053 7:110128253-110128275 TTTGTCAGTGTTGCCTCCTCTGG - Intergenic
1035901800 8:3465120-3465142 TTCTTCTGTGTTTGCTGCTGGGG + Intronic
1037394518 8:18428016-18428038 TTCTTTAGTGCTTCTTACTTTGG + Intergenic
1037416257 8:18653151-18653173 TATTTCAGTGTTTCCTCCTGTGG - Intronic
1037418459 8:18676577-18676599 TTGTTCGGCATTTCCTACTCAGG - Intronic
1039740759 8:40380512-40380534 TTTTTCACCCTTTCCTACTCTGG - Intergenic
1041705243 8:60839971-60839993 TTCTACAGATTTGCCTACTCTGG + Intronic
1043340524 8:79232007-79232029 TACCTCAGTGTTTCCTTGTCTGG - Intergenic
1043624357 8:82237327-82237349 TTCTCTAGTTTTTCCTATTCAGG + Intergenic
1044262099 8:90137380-90137402 CTCTTAAGTGTTTTCTACTGTGG + Intergenic
1044446420 8:92282304-92282326 TTATTCAGTGTTTCCCACTGGGG + Intergenic
1044776592 8:95695353-95695375 TTCTGCAGTGTTTGCTACAGAGG - Intergenic
1044941281 8:97346699-97346721 TTCTTCTGTGTTTTCTAATCAGG + Intergenic
1046299098 8:112262602-112262624 TTTTTCAGTATTGCCTTCTCTGG - Intronic
1047346730 8:124036177-124036199 TTCTCCAGTGTTTCCAACATTGG - Intronic
1047914455 8:129566622-129566644 TTCTTCCATTTTTCATACTCAGG - Intergenic
1047918450 8:129608146-129608168 TTCTTCCCTGTTTCCCTCTCTGG + Intergenic
1050518782 9:6474759-6474781 TTCTTCAAAGTTTCCTACTACGG - Intronic
1050927948 9:11289161-11289183 TTCTCCATTGTTTCATACTAAGG - Intergenic
1051168523 9:14293445-14293467 TTGTTGAGTTTTTCATACTCAGG - Intronic
1051720502 9:20032129-20032151 TTCTTCAGTTTTTGTTACCCTGG + Intergenic
1051893011 9:21962238-21962260 TGGTTCAGTGTATCCTACTCAGG - Intronic
1052207966 9:25866455-25866477 TGCCTCAGTTTTTCCCACTCAGG + Intergenic
1052411283 9:28124813-28124835 TTCTTCAGTGATTCTTGCTGTGG + Intronic
1053362455 9:37498755-37498777 ATCTTCTGGGTTTCCAACTCTGG - Intronic
1055163420 9:73160263-73160285 TTCTTCAGTGTTTCATCCAGGGG - Exonic
1055383496 9:75735194-75735216 TTCTTCTGTGTTGCCTACTCAGG + Intergenic
1055823701 9:80299331-80299353 TTGTTCAGTTTTGCCCACTCTGG + Intergenic
1056186763 9:84142648-84142670 TTCTTCAGATTTGCCTATTCTGG + Intergenic
1057357374 9:94342898-94342920 TTCTTAAGTGCTTCCTCCTCTGG - Intergenic
1057650378 9:96914728-96914750 TTCTTAAGTGCTTCCTCCTCTGG + Intronic
1057802705 9:98199709-98199731 TTATTCATTGTTTCCTCCTGAGG - Intronic
1057982785 9:99679225-99679247 CACTTCATTGGTTCCTACTCTGG + Intergenic
1058694040 9:107544228-107544250 TACTTCCGTGTTTGCAACTCAGG - Intergenic
1059789664 9:117626986-117627008 TTATTATGTGTTCCCTACTCAGG - Intergenic
1060809806 9:126605112-126605134 CTCTTCCGTGGCTCCTACTCAGG + Intergenic
1061835960 9:133330012-133330034 TTCATCAGTGATTACAACTCAGG + Intergenic
1186197407 X:7122955-7122977 TTTTTAAGTGTTTCCAAATCTGG - Intronic
1186995672 X:15119301-15119323 CTTTTCAGTGTTTGCTATTCGGG + Intergenic
1189737921 X:44090166-44090188 TTCTTCAGTGTTATCTTCTATGG + Intergenic
1190089223 X:47423081-47423103 TTCCCCAGTTTTGCCTACTCTGG - Intergenic
1194017632 X:88644069-88644091 TCCTTCAGTGTATCATACTTTGG - Intergenic
1194295720 X:92124190-92124212 TACTTCAGTGGTTACAACTCAGG + Intronic
1194652308 X:96530637-96530659 TTCTTTAGAGTTCCCTATTCTGG - Intergenic
1195829967 X:109046025-109046047 TTCTTCGAAGTTTCCTTCTCAGG + Intergenic
1195903171 X:109819321-109819343 TTCTTCAGCATTTCTTTCTCGGG - Intergenic
1196131576 X:112162807-112162829 TTGTTCAGTATTTTCTGCTCCGG + Intergenic
1198927913 X:141820648-141820670 TTCTTCAGTGTTTCCACTGCTGG - Intergenic
1200613224 Y:5348773-5348795 TACTTCAGTGGTTACAACTCAGG + Intronic
1200712184 Y:6496275-6496297 TACTTTAGCGTTTTCTACTCTGG - Intergenic
1201021744 Y:9665689-9665711 TACTTTAGCGTTTTCTACTCTGG + Intergenic
1202188278 Y:22212897-22212919 TGCTTTAGAGTTTCTTACTCTGG + Intergenic
1202345115 Y:23914259-23914281 TTCTTTTGTGTTTCTTTCTCAGG - Intergenic
1202525655 Y:25755830-25755852 TTCTTTTGTGTTTCTTTCTCAGG + Intergenic