ID: 1149409636

View in Genome Browser
Species Human (GRCh38)
Location 17:56392240-56392262
Sequence AACCCACGCATTGTTACGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 25
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 23}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149409633_1149409636 8 Left 1149409633 17:56392209-56392231 CCATAATAAGTAGGGGCTGAGCA 0: 1
1: 0
2: 1
3: 12
4: 110
Right 1149409636 17:56392240-56392262 AACCCACGCATTGTTACGCAAGG 0: 1
1: 0
2: 0
3: 1
4: 23
1149409632_1149409636 9 Left 1149409632 17:56392208-56392230 CCCATAATAAGTAGGGGCTGAGC 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1149409636 17:56392240-56392262 AACCCACGCATTGTTACGCAAGG 0: 1
1: 0
2: 0
3: 1
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149409636 Original CRISPR AACCCACGCATTGTTACGCA AGG Intronic
900536603 1:3180843-3180865 TACACACGCAGTCTTACGCACGG + Intronic
908303091 1:62782227-62782249 AATCCAAGCATTGTTTCTCATGG + Intergenic
1075209019 10:120475383-120475405 AACCCACCCATTATTACGAAGGG - Intronic
1081091582 11:38875035-38875057 GACCAAAACATTGTTACGCATGG - Intergenic
1115966711 14:38898068-38898090 AAGCCACGCATAGTTACTCTCGG - Intergenic
1122872493 14:104646372-104646394 AACCCAAGCCTTCTTCCGCAGGG + Intergenic
1149409636 17:56392240-56392262 AACCCACGCATTGTTACGCAAGG + Intronic
929261804 2:39874429-39874451 AACCCAGGTATTGTGACTCAAGG + Intergenic
931695843 2:64869905-64869927 AACACACGCAGTGTGACACAGGG + Intergenic
941037311 2:160582472-160582494 AAACTAAACATTGTTACGCATGG - Intergenic
1169472739 20:5902157-5902179 AACCCACGCAGTGGTATTCATGG - Intergenic
1170334820 20:15257532-15257554 AACCAAAACATTGTTATGCAGGG - Intronic
1170506838 20:17035313-17035335 AACCCAGGTATTTTTACCCAAGG - Intergenic
951720440 3:25692091-25692113 AACCCTGGCATAGTTACACATGG - Intergenic
974694238 4:65344710-65344732 AAACCACGCAGTGTTCTGCAGGG + Intronic
977902657 4:102440088-102440110 AACCCAGGCATTGTCAAGCCTGG + Intergenic
995689598 5:114809586-114809608 AACCCATGCAAGGTTAGGCATGG - Intergenic
997377441 5:133407224-133407246 AACCCACTCCTTGTCATGCATGG + Intronic
1001185396 5:169566766-169566788 AAAACATGCATTGTTATGCAAGG + Intergenic
1006739057 6:36294369-36294391 GACCCACGCATTGTTCCCCCCGG + Exonic
1014980616 6:127942438-127942460 AACCCACTCATTCTAAAGCAGGG + Intergenic
1020065805 7:5187793-5187815 AAGCTGCGTATTGTTACGCAAGG - Intergenic
1020582488 7:10021618-10021640 AACCCAAGCACTGTTACCCTTGG + Intergenic
1022463651 7:30635923-30635945 AAATCACGCATTGCTACCCAGGG - Intergenic
1056251684 9:84754860-84754882 AAACCACGCATTGCTAGGGATGG - Intronic