ID: 1149409725

View in Genome Browser
Species Human (GRCh38)
Location 17:56393023-56393045
Sequence GCCTGGAACAAAATGACCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149409725_1149409731 17 Left 1149409725 17:56393023-56393045 CCTTAGGTCATTTTGTTCCAGGC 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1149409731 17:56393063-56393085 TCCTTTCATTGGCCTTCATATGG 0: 1
1: 0
2: 0
3: 14
4: 162
1149409725_1149409727 6 Left 1149409725 17:56393023-56393045 CCTTAGGTCATTTTGTTCCAGGC 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1149409727 17:56393052-56393074 ATATCCCCTGTTCCTTTCATTGG 0: 1
1: 0
2: 1
3: 9
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149409725 Original CRISPR GCCTGGAACAAAATGACCTA AGG (reversed) Intronic
903405694 1:23093539-23093561 ATCTGGAAAGAAATGACCTACGG - Exonic
904447663 1:30587871-30587893 GCCTGGAACACAGTGTCCTAGGG - Intergenic
907716018 1:56926801-56926823 GCCTGGCACAGAATGCCCTTGGG - Intergenic
907808861 1:57848686-57848708 ACCAGGAGCAAAATAACCTAAGG + Intronic
909812323 1:79945576-79945598 GCTTGGAACACAATGACTAAAGG + Intergenic
910074457 1:83261020-83261042 GTATGGACCAAAATGACATATGG + Intergenic
911671091 1:100608860-100608882 GCCTTGAAGAAAATGTTCTAAGG + Intergenic
913314191 1:117536277-117536299 GGCTGGAGCAGAATGAGCTAGGG + Intergenic
917195725 1:172463393-172463415 GTCTGGAACAAATGGCCCTAAGG - Intronic
919759151 1:201086043-201086065 GGCTGGAAGAAAAGGACCCAAGG + Intronic
919868156 1:201799347-201799369 GCCTGGATCAACATGAACTGAGG - Intronic
920367958 1:205457813-205457835 GCCTGGAAGGAAATGCCCTCTGG + Intergenic
921577047 1:216847586-216847608 GCCTGGACTAAAATGACTCATGG - Intronic
1067438524 10:46295125-46295147 CCCTGAAACAAAAAGACCAAAGG - Intronic
1067581042 10:47446240-47446262 CCCTGAAACAAAAAGACCAAAGG - Intergenic
1067658285 10:48213940-48213962 GCCAGGAAGAAAATGAACTCGGG + Intronic
1072832622 10:98675187-98675209 GCCTGGAACATACTTCCCTAAGG + Intronic
1074510892 10:114110908-114110930 TCTTGGAACCAAATGAACTAAGG - Intergenic
1075611921 10:123861400-123861422 GGCAGGAACAAAATGCCCTGGGG + Intronic
1075735755 10:124663767-124663789 CCCTGGAACAAAATGAGCCCTGG - Intronic
1079087263 11:17455471-17455493 GCCCCCAACAAAATAACCTAGGG + Intronic
1080038771 11:27736934-27736956 GGTTGGAACAAAATGAGCGATGG - Intergenic
1081280608 11:41205145-41205167 GACTGGAACAGAATGAACAAAGG + Intronic
1085836043 11:79957796-79957818 CCCTGGAATACAATGACCTCTGG + Intergenic
1087602780 11:100337954-100337976 GACTGGGACAAATTGACTTATGG - Intronic
1097080171 12:56424480-56424502 GCTTTGAGTAAAATGACCTACGG - Intronic
1103480538 12:121247499-121247521 GCCTGGAACACAGTAACCCACGG + Intronic
1106342771 13:28847152-28847174 GCCTGCCAGAAAATCACCTAAGG + Intronic
1108399226 13:50022495-50022517 TCCTGGAACCAAAGGACCCATGG + Intergenic
1116135402 14:40916895-40916917 ACCTGGAAAAAAATCACCCATGG + Intergenic
1116767018 14:49085125-49085147 CAATGGAACAAAATCACCTATGG + Intergenic
1117742235 14:58830725-58830747 GGCTGAAGCAAAATGACCCAAGG + Intergenic
1118038403 14:61892502-61892524 CCCTGGAACAAAATTAGCAAAGG - Intergenic
1121497536 14:94404802-94404824 GGCTGGAACATAATGACATGTGG + Intergenic
1123110375 14:105864348-105864370 GCTGGGGACAAAATGACCTTGGG - Intergenic
1123723967 15:23084079-23084101 GCTTGGAAGTAAATGACCCAAGG + Intergenic
1125526924 15:40382537-40382559 GGCTTGAAGAAAAGGACCTATGG - Intergenic
1126161429 15:45617229-45617251 ACAGGGAACAAAATGGCCTAAGG + Intronic
1128646404 15:69381701-69381723 GTCTGGATCAAGATGCCCTAAGG + Intronic
1130211741 15:81930102-81930124 GGCTGGAAAAAAAAGTCCTATGG - Intergenic
1130805292 15:87314337-87314359 GTCTGGGATAAAATGACTTAAGG + Intergenic
1133550159 16:6846868-6846890 GCCTGGAAGAAAATTACAAAGGG + Intronic
1135569646 16:23538850-23538872 GTCTGGAAAAAAAAGTCCTAAGG + Intronic
1140506631 16:75477728-75477750 GCCTGGACCAGAAGGACCAAGGG + Exonic
1141213939 16:82006833-82006855 CCTTGGAAGAAAATTACCTAAGG + Intronic
1143817800 17:9532921-9532943 GACTGGAAAAAAATGTGCTAAGG + Intronic
1149409725 17:56393023-56393045 GCCTGGAACAAAATGACCTAAGG - Intronic
1149413292 17:56431406-56431428 GCAGGGAATAATATGACCTAAGG + Intronic
1154245402 18:12692475-12692497 GCCTAGAACAAAAGCCCCTATGG - Intronic
1157932312 18:51836479-51836501 GCCTGCCACAAAAGTACCTAAGG + Intergenic
1164803113 19:31093939-31093961 GCCTGGAGAAAGATGAGCTATGG + Intergenic
1164941736 19:32256245-32256267 GCCTGGAAATAAATAACCAAGGG + Intergenic
1166099266 19:40561341-40561363 GCTAGGAAGAAAAGGACCTAGGG + Intronic
926559498 2:14400704-14400726 GCATGGAATAAACTGCCCTAGGG - Intergenic
930372318 2:50517678-50517700 TAGTGGAACAAAATGACCTAAGG + Intronic
930773885 2:55154191-55154213 GCATGTAATAAAATGAACTAGGG + Intergenic
935040825 2:99425510-99425532 GCCTAGAAAAGGATGACCTATGG + Intronic
935571825 2:104670182-104670204 GCTTGGAAAAAAATGTCCTAAGG + Intergenic
938229130 2:129642797-129642819 GCCTGTAACGAAATGAACAAAGG - Intergenic
947057099 2:226117223-226117245 GCATGGAAGAAAATGAACTTCGG - Intergenic
947159646 2:227199481-227199503 GACTGGATCAAACAGACCTAAGG + Intronic
1170809304 20:19661257-19661279 GGCAGGGAAAAAATGACCTACGG - Intronic
1172240917 20:33412103-33412125 GCTTGGAACAAAAGGATATAAGG - Intronic
1173533955 20:43794592-43794614 GCCAGGAACAAAAGCAGCTAAGG + Intergenic
1174442751 20:50569114-50569136 GCATGGTACAAAATGAACTATGG - Intronic
1174582928 20:51585432-51585454 GCCTAGAAAAAGATGGCCTATGG - Intergenic
1175484329 20:59334531-59334553 GCCTGGATCAAAAAGAGCTTGGG - Intergenic
1181550947 22:23638903-23638925 GGCAGGAACAGAATGACCGACGG + Intergenic
951235146 3:20226363-20226385 GCCTGGAACAAAATGCTCAATGG + Intergenic
953406872 3:42664090-42664112 GGCTGGCACAAAATGCCCCAGGG + Intronic
958646889 3:96885833-96885855 GCCTGTAACAAAAAGACTGAAGG - Intronic
958806319 3:98815173-98815195 GCATGTAAAGAAATGACCTATGG + Intronic
962141117 3:132791895-132791917 GCTTGGAAGAAAATGACACAAGG - Intergenic
964650630 3:159007688-159007710 GCCTGGAAAAAAATCAGCAAGGG - Intronic
965268916 3:166587026-166587048 GCCCGGAACAGAAAGACCTCAGG - Intergenic
966442091 3:179957000-179957022 TCCTGGAAAAAAATTGCCTAAGG + Intronic
966723529 3:183088041-183088063 GGCTGGAACACAATGAGCAAGGG + Intronic
967879255 3:194287672-194287694 GCTTGGAACCACATGCCCTAAGG - Intergenic
970015780 4:11510949-11510971 ACCTGGAACAAAAGGTCTTATGG + Intergenic
974715364 4:65662596-65662618 GTATGAAACAAAATGAACTAGGG + Intronic
982108058 4:152028605-152028627 GGCTGAAACAAAATGCCCAAGGG + Intergenic
982902200 4:161021415-161021437 TGCAGGAACAAATTGACCTATGG + Intergenic
982996967 4:162361212-162361234 GCATGGAAAAAAATAACCTCAGG - Intergenic
984756257 4:183328254-183328276 GACTGGAACAGAAAGACATAAGG - Intergenic
985222132 4:187718167-187718189 GCCTGCAACAAAAAGGCCTATGG + Intergenic
986124153 5:4869760-4869782 GGCTGGCACAAAATGCCCTGAGG - Intergenic
987213420 5:15708114-15708136 CCCTGGCATAAAATGATCTAGGG - Intronic
987424696 5:17759230-17759252 ACCTGGGAAAAAACGACCTAAGG - Intergenic
989064175 5:37443190-37443212 GACCGGAGCAAAATGACATATGG - Intronic
991619439 5:68530432-68530454 GCCTGCATCAGAATCACCTAGGG + Intergenic
992744323 5:79804429-79804451 GCTTGGAACAAAAACACCTTAGG + Intergenic
993916791 5:93753923-93753945 GCCTGGTACAAAGTGGCCAAAGG + Intronic
994417988 5:99499021-99499043 GACTGGAGCAAAATGACATATGG - Intergenic
994461977 5:100076132-100076154 GACTGGAGCAAAATGACATATGG + Intergenic
995128764 5:108607794-108607816 TCCTGGAATAAAATCTCCTAAGG + Intergenic
996325637 5:122269687-122269709 CCCTGGAACAAATGGACTTAAGG + Intergenic
1000939590 5:167344468-167344490 GCTTGGAACCAAATGTACTAAGG + Intronic
1015757627 6:136623707-136623729 GACTGGAACTAAATGATTTAGGG + Intronic
1018259206 6:161952669-161952691 GCCTGGCACAGAATGAGCAATGG + Intronic
1018505576 6:164464265-164464287 GCCTTCACCAAAAGGACCTATGG - Intergenic
1024453760 7:49579799-49579821 GACAGGACCAAAATGCCCTAGGG + Intergenic
1026234798 7:68517728-68517750 GCCTGGAACAGATTGAGCAAAGG - Intergenic
1027292157 7:76725885-76725907 GTATGGACCAAAATGACATATGG + Intergenic
1030763559 7:113380874-113380896 TCCTGGAACAACATTATCTAGGG - Intergenic
1033469216 7:141629284-141629306 CCCTGGGAGAAAATGGCCTAGGG - Intronic
1035679538 8:1477890-1477912 GCCTGGGGCAAAATGACTCAGGG - Intergenic
1040988592 8:53324256-53324278 GGCTGGAACAAAAAGAGCAAAGG + Intergenic
1048279290 8:133093264-133093286 GCCTGGAATTCAATGACCCAAGG - Intronic
1048822389 8:138392065-138392087 GCATGGAACCAAATAACATATGG + Intronic
1049328622 8:142038013-142038035 GCCTCTAACACCATGACCTATGG - Intergenic
1053319762 9:37086008-37086030 GACAGAAACAAAATGATCTAGGG + Intergenic
1057627419 9:96689936-96689958 GCTTGCAACAAAATCACCTGGGG - Intergenic
1057933108 9:99212867-99212889 GCCTGGGAAAAAGAGACCTAGGG - Intergenic
1058498186 9:105582584-105582606 GCCTGGAAAAAATGGAGCTAGGG - Intronic
1188532163 X:31153897-31153919 GCCTGCAACCAAATGAAATAAGG + Intronic
1189767091 X:44382841-44382863 ACCTGGAACAAAATCACCCAGGG - Intergenic
1191675147 X:63785305-63785327 GCATGGAACAAACTGACTGAAGG - Intronic
1193639912 X:84000560-84000582 ACCTGTATCAAAATCACCTAAGG + Intergenic
1196149931 X:112362590-112362612 AGCTGGAGCAAAATGACCAACGG + Intergenic