ID: 1149410031

View in Genome Browser
Species Human (GRCh38)
Location 17:56395512-56395534
Sequence AAATTGTTCTAGAGGACCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149410028_1149410031 13 Left 1149410028 17:56395476-56395498 CCATAAAGAATTCCAGGGTGAAA 0: 1
1: 0
2: 2
3: 28
4: 217
Right 1149410031 17:56395512-56395534 AAATTGTTCTAGAGGACCAATGG 0: 1
1: 0
2: 1
3: 10
4: 149
1149410029_1149410031 1 Left 1149410029 17:56395488-56395510 CCAGGGTGAAAAGACTGAAAAGA 0: 1
1: 0
2: 8
3: 66
4: 620
Right 1149410031 17:56395512-56395534 AAATTGTTCTAGAGGACCAATGG 0: 1
1: 0
2: 1
3: 10
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149410031 Original CRISPR AAATTGTTCTAGAGGACCAA TGG Intronic
901873462 1:12152340-12152362 AAATTGTTCTACAGGAGCTGGGG + Intergenic
903312832 1:22473292-22473314 AAACTGTTCTAGTGGATAAAGGG + Intronic
903636640 1:24822896-24822918 ATATTGTTCTAGGGCACCCAGGG + Intronic
907719291 1:56956702-56956724 TAATGGTTCTTGATGACCAAGGG - Intronic
909943340 1:81635442-81635464 ATTTTGTTCTAGAAGCCCAAAGG - Intronic
911184561 1:94890332-94890354 AAAATTTTATAGAGGACCCATGG - Intronic
913043113 1:115048846-115048868 AAATTTTTCTAGAAGAACAAAGG - Exonic
913974400 1:143443007-143443029 AAATTGGCCTAGAGGTCCAGGGG + Intergenic
914068790 1:144268621-144268643 AAATTGGCCTAGAGGTCCAGGGG + Intergenic
914110365 1:144697733-144697755 AAATTGGCCTAGAGGTCCAGGGG - Intergenic
919331950 1:196183137-196183159 AAATTGTTTAATAGGAACAATGG + Intergenic
921363797 1:214355054-214355076 AAAATGTGCTAAAGAACCAAAGG + Exonic
922289959 1:224201791-224201813 AAACTGTTTTTGAGAACCAAAGG + Intergenic
1067219995 10:44337108-44337130 AAATTGTCCTGGAGGACGACGGG + Intergenic
1068624046 10:59220698-59220720 AAATAGTTCTAGAGCAACTATGG + Intronic
1069058553 10:63869853-63869875 AAATTTTTTTAGAGGAACAATGG - Intergenic
1069968351 10:72141918-72141940 AAATTTTTTTAGAAGACCAATGG - Intronic
1072955134 10:99881403-99881425 AAATTGCCCAAGATGACCAAGGG + Intronic
1073982730 10:109173381-109173403 AAAGTGTTCCAGAGGCCCCAGGG + Intergenic
1077859915 11:6168880-6168902 AAGTTTTTCCAGATGACCAAAGG + Intergenic
1079672018 11:23182871-23182893 ATATTTCTCTTGAGGACCAATGG + Intergenic
1087621058 11:100542620-100542642 AAATTCTGCTAGAGCACTAAGGG - Intergenic
1090170305 11:124596343-124596365 AAAGTGTTCTAGCAGAACAAAGG - Intergenic
1090431983 11:126653851-126653873 AAATGGCTATAGAGGAACAAAGG - Intronic
1090613990 11:128497900-128497922 AAATTTAGCTACAGGACCAAGGG - Intronic
1090940548 11:131384396-131384418 AAATGTTTCTAAAGGATCAAGGG + Intronic
1091752228 12:3030158-3030180 AACTTTTTAAAGAGGACCAAAGG - Intronic
1091829289 12:3538223-3538245 AAATTGTTCTGGAGGTTCACAGG - Intronic
1095363261 12:41370381-41370403 AAATATTTTTAAAGGACCAAGGG - Intronic
1095517552 12:43023389-43023411 AAATTTTTTTAAAGGACCTAAGG - Intergenic
1096366959 12:51036188-51036210 AAATGGTGCTAGTGGAACAACGG + Intergenic
1097278852 12:57831967-57831989 AAACTATTCCACAGGACCAAGGG + Intronic
1097925191 12:65119661-65119683 AATTTACTCTAGAGGACAAATGG - Intronic
1098226369 12:68329321-68329343 AATTTGGTCTAGAGAACAAAGGG - Intronic
1098674385 12:73270353-73270375 GAATTGTTCCAGAGGTACAAGGG + Intergenic
1104555951 12:129800062-129800084 AAAGTCTTCTAGATGACCTAGGG + Intronic
1108717851 13:53099591-53099613 AAGTTCTTCGAGAGGACCACGGG + Intergenic
1111222060 13:85218188-85218210 AAAGTGTTCTAAAGACCCAAAGG - Intergenic
1111782817 13:92751281-92751303 AAATGTTTCTGGATGACCAAAGG - Intronic
1112220887 13:97488609-97488631 ACATTTTTCTTAAGGACCAAAGG - Intergenic
1113007750 13:105726387-105726409 AAAGTCTTCTGTAGGACCAAAGG - Intergenic
1114093555 14:19309739-19309761 ACATGGTTCTAGAAGTCCAATGG + Intergenic
1116508317 14:45713554-45713576 AAACTGTTTTAAAGGACCCAGGG + Intergenic
1116876624 14:50118662-50118684 AAAGTGTTCTGGAGGCCGAAGGG + Exonic
1117153045 14:52908825-52908847 AAATTTTTATTGAGGACCCAAGG - Intronic
1117431910 14:55675085-55675107 AAACAGTTCTAGAGGCCCAAAGG - Intronic
1127321270 15:57848728-57848750 AAATGCTCATAGAGGACCAATGG + Intergenic
1127585979 15:60378610-60378632 AAATTATTTTAAAGGACCAATGG + Intronic
1131615248 15:94009628-94009650 AAATTGGTGTAGATAACCAAAGG + Intergenic
1132297604 15:100752721-100752743 GAATTGAACTGGAGGACCAAAGG - Intergenic
1134276064 16:12777285-12777307 AAACTGTTCTAAAGGCTCAAAGG + Intronic
1134862950 16:17577124-17577146 AAATTGGTTTAGATGATCAATGG - Intergenic
1135645871 16:24161618-24161640 AAATTGTCCTAGAAGCACAAAGG + Intronic
1135675546 16:24411942-24411964 TAATTGCTCTGGAGGAACAAAGG + Intergenic
1140462042 16:75147738-75147760 AAACTGTTCTAAAGGATGAAAGG + Intergenic
1141292928 16:82737122-82737144 AAATTGTTCTAGAGGGTTCAAGG - Intronic
1144734616 17:17548128-17548150 AAAGTGTTCTTGAGGACCAAAGG - Intronic
1148948842 17:51290613-51290635 AAATTGTTTTAGAAAACCATGGG + Intronic
1149410031 17:56395512-56395534 AAATTGTTCTAGAGGACCAATGG + Intronic
1158921741 18:62199737-62199759 ATATTATTCAAGAGAACCAATGG + Intronic
1164222707 19:23210632-23210654 AAATAGTTGTACAGGACTAATGG - Intergenic
1166395236 19:42434786-42434808 TATTTGTTCCAGAGGAACAAAGG - Intronic
929480292 2:42300154-42300176 AATTTTTTCAAGAGGACTAAGGG + Intronic
930368523 2:50474640-50474662 AAATTGTTCTATAGCTCCCATGG - Intronic
930514870 2:52393743-52393765 AAAGTTTTCAAGAGGACCATGGG - Intergenic
931069528 2:58629073-58629095 ATTTTGATCTAGAGCACCAAAGG + Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
932774435 2:74519094-74519116 AAATTGTGGTAGAGCACCCATGG + Exonic
932929214 2:76013869-76013891 AGATTCCTCTAGGGGACCAAAGG + Intergenic
934179105 2:89603982-89604004 AAATTGGCCTAGAGGTCCAGGGG + Intergenic
934289389 2:91678252-91678274 AAATTGGCCTAGAGGTCCAGGGG + Intergenic
938916442 2:135945797-135945819 AAATTGTTCTACTGAATCAACGG + Intronic
941873034 2:170405571-170405593 AAATACTTCTGGAGGCCCAAAGG + Exonic
944100965 2:196026269-196026291 AAATTGTTGCAGTAGACCAAAGG - Intronic
944793346 2:203155973-203155995 ACATTGTTCTAGAGTTCAAAAGG - Intronic
945165277 2:206936622-206936644 ACATTGTTCTAGGGGAAAAAGGG - Intergenic
945233958 2:207617358-207617380 AAATTCTTCAAGAGGAGCAGAGG + Intronic
1173692570 20:44974781-44974803 AAATTGTTCGGGAGGATGAATGG + Intronic
1174937489 20:54886982-54887004 ATATTGATATAGAAGACCAATGG - Intergenic
1178146084 21:29741542-29741564 AAATGGTTCTAGAATTCCAAAGG - Intronic
949165581 3:936957-936979 AAATTGTTCTAGAGGTAGATGGG + Intergenic
949574420 3:5325044-5325066 AGGTTGTTCTTGTGGACCAAGGG - Intergenic
949975052 3:9449005-9449027 ACAGTGTTCTAGAGGACCCAGGG - Intronic
951090125 3:18562610-18562632 AAATTGTTATAAAGGAAGAAAGG + Intergenic
952059678 3:29492365-29492387 TAATTGTTCATGATGACCAAGGG + Intronic
952524903 3:34199726-34199748 TAATTGTTCTAGGGGTCCATAGG - Intergenic
955868447 3:63410893-63410915 AAGTTGTTCAATAGTACCAATGG + Intronic
956919940 3:73917307-73917329 AAATTGTTGTAGAGGATTTATGG - Intergenic
957742497 3:84289761-84289783 AAATTGTCCTAAATGTCCAATGG + Intergenic
959363053 3:105419426-105419448 TAATGGTTCTAGAGCACTAATGG + Intronic
959810911 3:110618107-110618129 AATTTTTTCTAAAGCACCAATGG + Intergenic
963691325 3:148506449-148506471 AAATTCTACTAGAGGTACAAAGG - Intergenic
964148080 3:153490518-153490540 AAATTATTATAGAGGAAGAAGGG - Intronic
964409995 3:156388098-156388120 AATTTGTTCATGAAGACCAAGGG + Intronic
974626279 4:64431758-64431780 AAATTGTCCTCGGGAACCAAAGG - Intergenic
974812472 4:66962561-66962583 AAATTCTTCTAAAGTACCAAGGG + Intergenic
975747554 4:77489766-77489788 AAATTGGTTATGAGGACCAAGGG - Intergenic
975992111 4:80267960-80267982 TAACTGTTCTTGGGGACCAAAGG - Intronic
978196820 4:105981646-105981668 AAATTCTTCCAGAGGTACAAGGG - Intronic
978647654 4:110957363-110957385 AAAATGTACAAGAGGGCCAAAGG + Intergenic
981613555 4:146622316-146622338 AAATGGTACTAGAGCACCACAGG + Intergenic
983139786 4:164135910-164135932 AGATTCTTCTAAAGGCCCAAAGG + Intronic
983445242 4:167842309-167842331 AAATTGTTCTGGAGAACAAGAGG + Intergenic
984172463 4:176376940-176376962 AAACTGTTCTAGAGAAAAAAAGG + Intergenic
985310094 4:188588495-188588517 AAATTGGACTGGAGGACAAAGGG + Intergenic
986780436 5:11060285-11060307 AAATTGTTTTAGGGGCCCATAGG - Intronic
987850273 5:23343389-23343411 AAATTATAAAAGAGGACCAATGG + Intergenic
989608875 5:43272678-43272700 AAATACGTCTACAGGACCAAGGG - Intronic
991183251 5:63778921-63778943 AACTTGTTCTAGGGGCCCCAGGG + Intergenic
992073641 5:73171704-73171726 AAATGCTTCTAGGAGACCAAAGG - Intergenic
992281891 5:75186794-75186816 AAAATGTAATAGTGGACCAATGG - Intronic
992297659 5:75341856-75341878 CAATAGTGCTAGAAGACCAATGG - Intronic
993440241 5:87947948-87947970 GAAGTGTTCTATAGGAGCAATGG - Intergenic
993596428 5:89862392-89862414 AAACTTTTCTAGGGCACCAATGG + Intergenic
999285367 5:150391359-150391381 ACATTGTTCTCAAGGAGCAAGGG - Intronic
999776901 5:154819216-154819238 AAATTGTTCTTGGGAACCACAGG + Exonic
999933285 5:156457281-156457303 AAATTATTTTAGAGGATCAAAGG - Intronic
1003876769 6:10444749-10444771 GAATGTTTCTAAAGGACCAAAGG + Intergenic
1006054400 6:31372102-31372124 AAATTGTTCCTGAAGAACAATGG + Intergenic
1008594982 6:53033089-53033111 AAATTGTTCAAAACGACGAAGGG + Intronic
1011738002 6:90331950-90331972 AAACCATTCTAGAGGTCCAATGG - Intergenic
1012102585 6:95109056-95109078 AAAATATTCTAAAGTACCAAAGG + Intergenic
1012864264 6:104598621-104598643 AAGCTTTTCTATAGGACCAATGG - Intergenic
1012979363 6:105813572-105813594 AAGGTGTTCTTGAGGTCCAAAGG - Intergenic
1014287083 6:119512691-119512713 ATATGATTCTAGAGCACCAAGGG - Intergenic
1014872474 6:126613820-126613842 AAATTGATCAAGAGGAATAAAGG - Intergenic
1017234032 6:152100528-152100550 TAATTGTGCTAGAGAAGCAAAGG - Exonic
1017668433 6:156744907-156744929 AAATTGTTTTAGATGCTCAATGG - Intergenic
1020733644 7:11917523-11917545 ATATTGTTGTAAAGGACAAAGGG - Intergenic
1020817793 7:12927459-12927481 AAATTGACCTTGAGGAACAAAGG + Intergenic
1021345215 7:19518998-19519020 AAATGGTTCTACAAGTCCAAGGG - Intergenic
1021566109 7:22018087-22018109 AAATTGTTGGCAAGGACCAAGGG - Intergenic
1023306542 7:38835278-38835300 AAATTGTTCTAAAGTAAAAAGGG - Intronic
1025238256 7:57249730-57249752 AAATTGTCCTAGAAAACCTAAGG - Intergenic
1028323761 7:89496411-89496433 AAATTATACTGGAGGACCAAGGG - Intergenic
1029202446 7:98848101-98848123 AAATTGTTCGTGAGAACCACGGG - Exonic
1029941536 7:104485581-104485603 AAATGGTTCCAGAGCATCAAGGG - Intronic
1030192520 7:106823797-106823819 AAATTGATCCAGACTACCAAGGG - Intergenic
1032300391 7:130680970-130680992 AATTTGTTCTAGAGAACCTTCGG - Exonic
1036545013 8:9759588-9759610 ACAATGTTCTAGAGGAGTAATGG - Intronic
1037020762 8:13967391-13967413 CAAATGTTCTTGAGGTCCAACGG - Intergenic
1037457705 8:19080702-19080724 GAATTGGTTTTGAGGACCAACGG + Intronic
1039023318 8:33230835-33230857 ACATTGTTATAGAGGGCTAATGG + Intergenic
1039857848 8:41431814-41431836 TGATTGATCTAGAGCACCAAAGG + Intergenic
1045348173 8:101313635-101313657 AAAGTGCTCTGGAGAACCAAAGG - Intergenic
1045942630 8:107756298-107756320 AAATTTTTCTAAGGGACCAGAGG + Intergenic
1046216867 8:111160174-111160196 AAATAGTTGTAGAGGAACAGAGG + Intergenic
1046840099 8:118846838-118846860 AAATTCTTTTAGAGGTACAATGG - Intergenic
1047429417 8:124778007-124778029 AAATTCCTATAGAGGACAAATGG + Intergenic
1047677358 8:127217436-127217458 AAATTGATCTATCGGACCAACGG + Intergenic
1047720564 8:127635139-127635161 AAAGTGTTTTAGAGGATCCAGGG - Intergenic
1048910862 8:139133678-139133700 AAATTATTCTATAGGCTCAATGG + Intergenic
1055782703 9:79836691-79836713 AAATCATTTAAGAGGACCAAAGG - Intergenic
1056579313 9:87878892-87878914 AAATGGTGTTACAGGACCAACGG - Intergenic
1061209011 9:129179993-129180015 AGATTGTTCGAGGGGGCCAAGGG - Intergenic
1189091461 X:38087246-38087268 ACATTGTTCTAAAGAACCTATGG + Intronic
1189953380 X:46254958-46254980 AAAATGTTGTAAATGACCAAAGG - Intergenic
1196974886 X:121148504-121148526 AAATTGCCCTTGAGGACCACTGG + Intergenic
1198219646 X:134587652-134587674 AAATTGTTCTGGAGAACTGAGGG - Intronic
1198669575 X:139064940-139064962 AAATTGATCAAGAGGAAGAAAGG - Intronic
1199463520 X:148110719-148110741 AAATTTTTCATGAGCACCAACGG + Intergenic