ID: 1149415616

View in Genome Browser
Species Human (GRCh38)
Location 17:56456754-56456776
Sequence GACACTAAAGGGATGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 357}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149415606_1149415616 1 Left 1149415606 17:56456730-56456752 CCCTACATGAACCTGAGGATAAG 0: 1
1: 0
2: 1
3: 4
4: 93
Right 1149415616 17:56456754-56456776 GACACTAAAGGGATGGGGGAGGG 0: 1
1: 0
2: 1
3: 24
4: 357
1149415607_1149415616 0 Left 1149415607 17:56456731-56456753 CCTACATGAACCTGAGGATAAGT 0: 1
1: 0
2: 0
3: 7
4: 119
Right 1149415616 17:56456754-56456776 GACACTAAAGGGATGGGGGAGGG 0: 1
1: 0
2: 1
3: 24
4: 357
1149415608_1149415616 -10 Left 1149415608 17:56456741-56456763 CCTGAGGATAAGTGACACTAAAG 0: 1
1: 0
2: 0
3: 9
4: 146
Right 1149415616 17:56456754-56456776 GACACTAAAGGGATGGGGGAGGG 0: 1
1: 0
2: 1
3: 24
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149415616 Original CRISPR GACACTAAAGGGATGGGGGA GGG Intronic
900361570 1:2291600-2291622 GAGACTGAGGGGGTGGGGGAGGG - Intronic
900825972 1:4927243-4927265 GACACAAAAAGGAAGGAGGAGGG + Intergenic
901006568 1:6174551-6174573 GACACTGGACGGATGGTGGATGG + Intronic
903269557 1:22178783-22178805 GAGAAGGAAGGGATGGGGGAGGG - Intergenic
903426194 1:23256233-23256255 GAGAAAAAAGGGCTGGGGGAAGG - Intergenic
904191191 1:28745323-28745345 GACACTAAAAGCATTGGGAATGG + Intronic
904455707 1:30646894-30646916 GACACTGCAGGGCTGTGGGAGGG + Intergenic
904816930 1:33210783-33210805 CAAAATAAAGGGATGGAGGAAGG - Intergenic
905412399 1:37779584-37779606 GACACAGAAGGGACAGGGGAGGG + Intergenic
906679179 1:47713613-47713635 GTCACCACAGGGTTGGGGGAAGG - Intergenic
907327599 1:53650740-53650762 CAGACTAAAGAGATGGCGGAAGG + Intronic
909454130 1:75831073-75831095 CACAATAAAGGGATGGAGGAAGG + Intronic
910161794 1:84279985-84280007 GACACTAGAGGGATGGTGAGGGG + Intergenic
910444053 1:87282721-87282743 GCCACCAAAGAGTTGGGGGAGGG - Intergenic
910709983 1:90169112-90169134 CAAAATAAAGGGATGGAGGAAGG + Intergenic
911181494 1:94864451-94864473 CACCCTAAAGGGTTGGTGGATGG + Intronic
911450052 1:98050564-98050586 GGAAATATAGGGATGGGGGAGGG + Intergenic
912170805 1:107097187-107097209 ACCACTAGAGGGTTGGGGGAGGG - Intergenic
912993106 1:114509104-114509126 GGCACTTGAGGGATGAGGGAAGG - Intronic
913077624 1:115354252-115354274 GACCCAACAGGGATGGGGTAGGG - Intergenic
913191365 1:116416012-116416034 GACACAGAAGGGTTGGGGGGGGG + Intergenic
913467186 1:119155130-119155152 CAAAATAAAGGGATGGAGGAAGG - Intergenic
913942964 1:125125205-125125227 CAAAATAAAGGGATGGAGGAAGG + Intergenic
915543638 1:156583699-156583721 AACAGGAAAGGGAGGGGGGAGGG - Intronic
915798959 1:158768103-158768125 GACATTAAAAGGATGGGGCATGG - Intergenic
917052996 1:170945594-170945616 GACACAATAGAGATGGGAGAAGG + Intronic
917666141 1:177227745-177227767 GACACTAATTGCATGGAGGATGG - Intronic
919522523 1:198606128-198606150 GACCCTCAAGGGATGGGAGGAGG + Intergenic
920503087 1:206497671-206497693 CACTCTAAAGGCCTGGGGGAAGG + Exonic
920569903 1:207008673-207008695 GACACCAAAGGGACAGGGAAAGG + Intronic
920705659 1:208248689-208248711 CACACTAGATGGATGGAGGAGGG - Intergenic
923496832 1:234533038-234533060 GAAAATAAAGGGATCGGGGAGGG + Intergenic
923612810 1:235510286-235510308 GTCATTAAAGGGCTGGGGTAAGG - Intergenic
924940284 1:248808591-248808613 CACAGTACAGGAATGGGGGATGG + Intergenic
1063410429 10:5832955-5832977 GACACTGGTGGGATGGGGCAGGG - Intronic
1065077130 10:22091554-22091576 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1065258805 10:23903151-23903173 AAACCTAAAGGGATGGAGGAGGG - Intronic
1065368951 10:24963138-24963160 GAGAATAAAGGGATGAGAGATGG + Intergenic
1067148584 10:43711317-43711339 GAGGCTAAAGGGATAGGGGGTGG + Intergenic
1067346459 10:45441986-45442008 GTCACTAATGGGCTGGGGAAAGG - Intronic
1069659141 10:70112145-70112167 GATATTATAGGGATGGGGGCGGG - Exonic
1069718308 10:70534535-70534557 GACAGCAAAGGGCTGGGGCAGGG + Intronic
1069754406 10:70764339-70764361 GAGACTGAAGGCTTGGGGGAAGG + Intergenic
1069819307 10:71217695-71217717 GAAACAAAAGGGGTGGGGGTGGG - Intronic
1070050646 10:72886332-72886354 GTCAGTAAAGGGATGCTGGAAGG - Exonic
1070566072 10:77604882-77604904 GACAAGGAAGGGGTGGGGGAGGG - Intronic
1070994687 10:80766266-80766288 GAAAGAAAAGGGATTGGGGAGGG - Intergenic
1071446562 10:85754166-85754188 GACACTCAACAGATGGGGGGAGG + Intronic
1071520695 10:86330057-86330079 GACGCTACTGGGATGGGGGAGGG - Intronic
1072817768 10:98526658-98526680 GACACTAATGGGACGAAGGACGG + Intronic
1073141930 10:101253971-101253993 GACTCTGAAAGGATGGGGGTAGG - Intergenic
1073277902 10:102328635-102328657 TACACTGAAGGGATAGGGAAAGG + Intronic
1073506213 10:103994487-103994509 GAAAAGAAAGGAATGGGGGAAGG - Intronic
1073917936 10:108427724-108427746 GACAGGAAGGGGGTGGGGGAGGG + Intergenic
1074536712 10:114333164-114333186 GCCACTCCTGGGATGGGGGAAGG - Intronic
1074848707 10:117421402-117421424 GACACTAAATGGCTGGGGTGGGG - Intergenic
1075263364 10:120981097-120981119 GAGTGGAAAGGGATGGGGGAGGG - Intergenic
1075746822 10:124733829-124733851 GGCAGTAAAGGGAAGGGCGAAGG - Intronic
1076028047 10:127133068-127133090 GACATTGATGGGATGGTGGAGGG + Intronic
1076885425 10:133260017-133260039 GACCCTTAAGGGATGCTGGATGG - Intergenic
1077023623 11:430453-430475 GACAGGAAAGGGATGGGGGTGGG + Intronic
1077063838 11:629732-629754 GGAGCTGAAGGGATGGGGGAAGG - Intergenic
1077377779 11:2213354-2213376 GAGACTGCAGGCATGGGGGAGGG - Intergenic
1078150809 11:8758276-8758298 GAAGCTAATGGGATGGGGGTAGG - Intronic
1080536588 11:33227589-33227611 GACCCTAAAGGAATGGGAGAAGG - Intergenic
1083204919 11:61142796-61142818 GACTCTAAGGGGTGGGGGGAGGG + Intronic
1083609207 11:63997248-63997270 GAGAGTAAAGGGGAGGGGGACGG - Intronic
1083996215 11:66274192-66274214 GAGACTGACTGGATGGGGGAGGG - Intronic
1084952664 11:72675214-72675236 CAGACTACAGGCATGGGGGAAGG + Intergenic
1087028369 11:93675009-93675031 TACAGGAAAGGGAAGGGGGAAGG + Intronic
1087841447 11:102924926-102924948 GACACTTGAGGGATGGGAGTGGG - Intergenic
1088263878 11:107971327-107971349 GACACCAAGGGGAGGGGGGGCGG + Intergenic
1089666762 11:120025604-120025626 CACTCTACAGGGATGGGGGAAGG + Intergenic
1090232822 11:125121081-125121103 GAAACTAGAGGGCTTGGGGATGG + Intergenic
1090860108 11:130645533-130645555 GGCAAGTAAGGGATGGGGGAAGG - Intergenic
1091192542 11:133707228-133707250 GACAAAAAAGGGAAGGGGAAGGG + Intergenic
1091270909 11:134311203-134311225 GCCATTGGAGGGATGGGGGAGGG + Intronic
1091702689 12:2674318-2674340 GGCACAAGAGGGAAGGGGGAAGG + Intronic
1095089849 12:38093598-38093620 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1095506552 12:42904996-42905018 GCCACGAAAGGGGTGGGGGGAGG - Intergenic
1096143263 12:49260181-49260203 TATCCTAAAGGAATGGGGGAAGG + Intronic
1096756856 12:53806768-53806790 GAAACTGAAATGATGGGGGAAGG - Intergenic
1096881513 12:54676426-54676448 GACACTCAGGGTATGGGAGATGG + Intergenic
1099809144 12:87558452-87558474 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1100525033 12:95411036-95411058 GAGACAAAAGGGAAGGGAGAGGG - Intergenic
1101645607 12:106628270-106628292 GAGACTAAATGGAGGGTGGAGGG - Intronic
1102520874 12:113476910-113476932 GAAAAGAAAGGGAAGGGGGAGGG - Intergenic
1106263666 13:28090962-28090984 GACAGTACTGGGATGGGGGTGGG + Intronic
1107160568 13:37222361-37222383 GAAAGTAAATGGATGGGGAAAGG - Intergenic
1107774676 13:43825383-43825405 GACTCTAAAAGGAGGGGGTAGGG + Intronic
1108201946 13:48053001-48053023 GGGACTAAAGGGCTGGGGGATGG + Intergenic
1108203491 13:48064706-48064728 GTTTCCAAAGGGATGGGGGAGGG - Intronic
1108711648 13:53038876-53038898 GACACAAAAGAGCTTGGGGATGG - Intronic
1111424329 13:88059252-88059274 GACACTACAAGGTTGGGGGTGGG + Intergenic
1112359910 13:98708079-98708101 GATATTAAAAGGGTGGGGGAGGG + Intronic
1113107690 13:106789120-106789142 GACAAGCAAGAGATGGGGGAGGG + Intergenic
1113574090 13:111382223-111382245 GGCACTAGAGAGATGGTGGAGGG + Intergenic
1114651507 14:24287713-24287735 GACACATAAAGGATGGGCGAGGG - Intergenic
1116891916 14:50276976-50276998 GTCACAACTGGGATGGGGGAGGG - Intronic
1117255449 14:53972619-53972641 GACAATAAAGAGAGGGAGGAAGG + Intergenic
1117489389 14:56230884-56230906 GAAAATAAAGGGATGGAGGAAGG + Intronic
1118724531 14:68619616-68619638 GAAACCAAAGGTATGGTGGAAGG + Intronic
1118937900 14:70304895-70304917 TACAGTCAGGGGATGGGGGAAGG - Intergenic
1119558581 14:75572045-75572067 CACACTTAGGGCATGGGGGAAGG + Intergenic
1119715166 14:76853959-76853981 GAGACTGAGGGGCTGGGGGAAGG - Intronic
1120084096 14:80249544-80249566 CACAATAAAGGGATGGAGGAAGG - Intronic
1120939966 14:89938402-89938424 GACAGTGAAGGGGTGGGAGAAGG + Intronic
1122002532 14:98672264-98672286 GACCCTAAAAGGATGAGGGTAGG - Intergenic
1122312003 14:100803351-100803373 CACACCAGAGGGATGTGGGAGGG - Intergenic
1122385662 14:101344398-101344420 GAAAGTAAAAAGATGGGGGAAGG + Intergenic
1126401128 15:48271917-48271939 GGAACAAAAGGGATGGAGGAGGG + Intronic
1127500888 15:59553310-59553332 GAGACGAGAGGGAGGGGGGATGG - Intergenic
1129000209 15:72327029-72327051 TTCACTGAAGGGTTGGGGGAAGG - Intronic
1129604991 15:77020525-77020547 GTGACTAAATGGATGGAGGATGG - Intronic
1131610206 15:93952851-93952873 GAAACAAAAGGGAGAGGGGATGG + Intergenic
1131832570 15:96363131-96363153 GGCACTAGAGGGAAAGGGGATGG - Intergenic
1132422204 15:101680079-101680101 GACACTGCTGGGTTGGGGGAGGG + Intronic
1132981856 16:2742403-2742425 GACTCTAAAGGGCTGGGTCATGG + Intergenic
1133595549 16:7287849-7287871 CACACGAAATGGGTGGGGGAAGG - Intronic
1133677391 16:8087758-8087780 GAGACTGAAAGGATGGTGGAGGG - Intergenic
1135058706 16:19252833-19252855 TAGACTATAGTGATGGGGGAGGG - Intronic
1135172862 16:20201935-20201957 GACACTATAGGTATTGGGGCTGG + Intergenic
1135266809 16:21033799-21033821 GAAAATAAAGGGTTGGGGGCGGG - Intronic
1136381196 16:29896792-29896814 GACAGCAAGGGGATGGGGGTGGG - Intronic
1136770939 16:32840540-32840562 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1137856523 16:51799931-51799953 GAGACTCAAGGAATGGGTGAAGG - Intergenic
1138106679 16:54290750-54290772 GAAAAAAAAGGCATGGGGGAGGG - Intergenic
1141880680 16:86856956-86856978 GAAACCAAAGGGATGGGCGGGGG + Intergenic
1203073362 16_KI270728v1_random:1102653-1102675 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1142884827 17:2905965-2905987 GACTGAAAAGTGATGGGGGAAGG - Intronic
1142897304 17:2989897-2989919 GGAACTAAAGGAAAGGGGGATGG - Intronic
1143582634 17:7835656-7835678 GACAGGAAAGGGAGAGGGGAGGG + Intergenic
1143729673 17:8874071-8874093 GCCCCCAGAGGGATGGGGGATGG + Intergenic
1144408684 17:14977525-14977547 TACACTTAAGGGAGGGGGAACGG + Intergenic
1145103669 17:20097234-20097256 GAGACCAAAGGGATGGGGGGAGG - Intronic
1146324002 17:31869834-31869856 GACACTACAGGATAGGGGGAAGG - Intronic
1146930978 17:36777710-36777732 AACACAAATGGGAGGGGGGATGG + Intergenic
1147150742 17:38512125-38512147 TACAATAAAAGAATGGGGGAGGG - Exonic
1148591346 17:48818512-48818534 GACAACAGTGGGATGGGGGAGGG - Intergenic
1148598315 17:48874749-48874771 TACAATAAAGGAATGGGGAAGGG + Intergenic
1148665802 17:49373798-49373820 GATTCTAAAGGAATAGGGGAGGG - Intronic
1149415616 17:56456754-56456776 GACACTAAAGGGATGGGGGAGGG + Intronic
1149564056 17:57629060-57629082 GACACTAGGGAGATGGTGGAGGG - Intronic
1150618554 17:66791139-66791161 CAAACAAAAGGGAGGGGGGAGGG - Intronic
1151269403 17:72982168-72982190 AACCCTATAGGGATGGGGTATGG + Intronic
1151610150 17:75168183-75168205 TACAATAAAGGAATGGGGAAGGG + Intronic
1152841709 17:82573315-82573337 GACACTCCAGGTATGGGGGGTGG - Intronic
1153229814 18:2924981-2925003 GACTCTCAAGAGATGGAGGAAGG + Intronic
1153366816 18:4265696-4265718 GACACTGAAGAGAGGAGGGAAGG - Intronic
1153441484 18:5124273-5124295 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1153912129 18:9713669-9713691 AAGACATAAGGGATGGGGGAAGG - Intronic
1153984542 18:10340792-10340814 GACAATAAAGGGAACTGGGAGGG - Intergenic
1155557000 18:27030999-27031021 AACACTTATGGGATGGGGGTGGG - Intronic
1157828263 18:50832236-50832258 AACAGCAAAGGGAAGGGGGAAGG - Intergenic
1158070877 18:53469123-53469145 GACACGAAGGGGATGAGGGATGG - Intronic
1158106840 18:53895246-53895268 GACACGGAAGGGTTGGGGGTGGG - Intergenic
1158630415 18:59109267-59109289 GACCCTAAAGGGTGGGAGGATGG + Intergenic
1159624411 18:70675384-70675406 GTGTGTAAAGGGATGGGGGAAGG + Intergenic
1159865773 18:73702973-73702995 GACAGTAAAGAGCTGGGAGAGGG - Intergenic
1160769158 19:822464-822486 GAGACAAAAGAGCTGGGGGAGGG + Intergenic
1161019404 19:2000985-2001007 GAGACAGAAAGGATGGGGGACGG + Intronic
1162110326 19:8396556-8396578 CACACGAAGGGGATGAGGGAGGG + Intronic
1163914339 19:20227051-20227073 GAAAATAAAGGGACGGAGGAAGG - Intergenic
1165308012 19:35013903-35013925 GAGACAGAAGGGATGGGAGATGG + Intronic
1167270324 19:48502382-48502404 GCTACTAAGGGGAAGGGGGAAGG - Intronic
1202670541 1_KI270709v1_random:46058-46080 CAAAATAAAGGGATGGAGGAAGG + Intergenic
926070769 2:9888257-9888279 GACACTAAAGGATGGGAGGAGGG - Intronic
926995628 2:18732427-18732449 GACACAGAAGGATTGGGGGATGG + Intergenic
927139626 2:20120762-20120784 GAAAGGAAAGGGATGGGGAAAGG + Intergenic
927595203 2:24390375-24390397 GACAGAAAATGGATGGGAGAGGG - Intergenic
930084040 2:47480163-47480185 GAAAGGAAAGGGATGGGGGAAGG - Intronic
931385391 2:61793678-61793700 AACAGTAAAGGGATGGGTGCAGG - Intergenic
932918458 2:75882548-75882570 GACAATAAAGGGATGGGATGAGG - Intergenic
933899121 2:86836493-86836515 GAAACTTAAGGGATTGGGCATGG + Intronic
933907531 2:86910023-86910045 GGCACTAAAGGTATGGAGGCAGG - Intronic
933908777 2:86919715-86919737 GGCACTAAAGGTATGGAGGCAGG - Intronic
934023949 2:87983670-87983692 GGCACTAAAGGTATGGAGGCAGG + Intergenic
934606167 2:95696986-95697008 GGTACTAAAGGGATGAGGGATGG + Intergenic
934998875 2:98991338-98991360 CAAAATAAAGGGATGGAGGAAGG + Intergenic
934999870 2:99002769-99002791 CAAAATAAAGGGATGGAGGAAGG + Intronic
935603697 2:104948259-104948281 GACATAAAAGAGATGGGGCAGGG + Intergenic
935781433 2:106512733-106512755 GAAACTTAAGGGATTGGGCATGG - Intergenic
935989877 2:108709560-108709582 GAAAATAAAGGGATTGGGAAAGG + Intergenic
936364601 2:111841388-111841410 GGCACTAAAGGTATGGAGGCAGG + Intronic
936775124 2:115963873-115963895 CAAAATAAAGGGATGGAGGAAGG - Intergenic
937182175 2:120006651-120006673 CACACTAACAGAATGGGGGAAGG - Intergenic
937560444 2:123218267-123218289 CACTATCAAGGGATGGGGGAGGG - Intergenic
937878751 2:126849581-126849603 GACTCTAAAGGGATGGGGGGAGG - Intergenic
938125791 2:128670521-128670543 GACACCCCAGGGATGGGGGCAGG - Intergenic
941159425 2:162019396-162019418 GACACGGAAGCGATGGCGGAGGG - Intronic
941255203 2:163220635-163220657 GACACACAAGAGATTGGGGAGGG - Intergenic
941748521 2:169111833-169111855 GAGAGTAAAGGGCTGGGAGATGG - Intergenic
942411962 2:175718849-175718871 CAAAATAAAGGGATGGAGGAAGG + Intergenic
943680908 2:190766707-190766729 GACTCTGAAGGCCTGGGGGATGG - Intergenic
944175342 2:196822574-196822596 TACAATAAAGGAATGGGGAAGGG - Intergenic
946310522 2:218880471-218880493 GACACTAAATGGCGGGGGGGTGG + Exonic
948801305 2:240434868-240434890 GAAACCAAAGTGATGGGGCAGGG - Intergenic
949037506 2:241822687-241822709 GACAGAGAAAGGATGGGGGAGGG - Intergenic
949079682 2:242087097-242087119 GAAAAGAAAGGTATGGGGGAGGG - Intergenic
1170314164 20:15025474-15025496 GAAACAAAGGGGGTGGGGGAGGG + Intronic
1173480479 20:43394896-43394918 GACACTGAAGGCATTGGGAACGG + Intergenic
1174145125 20:48448008-48448030 GACACTGAAGGAATGGAGCAGGG - Intergenic
1174340355 20:49891426-49891448 GAGACTAAATGGAAGGGGGCTGG - Exonic
1175725881 20:61318030-61318052 GAGACTAAAGGGCTGGAGGGTGG + Intronic
1175804623 20:61820649-61820671 AACACAAGAGGGATGGGGGGCGG - Intronic
1176086611 20:63298116-63298138 GACACTAAGGGGCTGGTGGGAGG - Intronic
1176334489 21:5583370-5583392 GACAGTACAGGGTTGGTGGAAGG + Intergenic
1176393268 21:6237578-6237600 GACAGTACAGGGTTGGTGGAAGG - Intergenic
1176468151 21:7078596-7078618 GACAGTACAGGGTTGGTGGAAGG + Intronic
1176491712 21:7460374-7460396 GACAGTACAGGGTTGGTGGAAGG + Intergenic
1176508930 21:7678009-7678031 GACAGTACAGGGTTGGTGGAAGG - Intergenic
1178913734 21:36695826-36695848 GTCACTAAGGAGGTGGGGGAGGG - Intergenic
1178962114 21:37074224-37074246 GACGCTAATGGGAAGGGGGGTGG + Intronic
1179812497 21:43881384-43881406 GACAGAAAAGGGAGGTGGGAAGG + Intronic
1180121760 21:45756084-45756106 GGCTCAAAATGGATGGGGGATGG - Intronic
1180224852 21:46386280-46386302 GACACTAAAGGGGAGGGGTCGGG - Intronic
1181583760 22:23841984-23842006 GACACTGAGGGGTTGGGGGCTGG + Intergenic
1182534400 22:30989672-30989694 GACACTATAGGTTTAGGGGAAGG - Intergenic
1182918976 22:34062064-34062086 GAAACTAAAGGAAAGGGAGAGGG - Intergenic
1183691135 22:39389015-39389037 ACCCCAAAAGGGATGGGGGATGG + Intergenic
949135025 3:554139-554161 GACACTGAGGCAATGGGGGATGG + Intergenic
949287223 3:2421141-2421163 GTCATTAAGGTGATGGGGGAGGG - Intronic
950551293 3:13667700-13667722 GATAGTGAAGGGATGGGGGCGGG - Intergenic
951086502 3:18518228-18518250 CAAAATAAAGGGATGGAGGAAGG + Intergenic
951222514 3:20083790-20083812 GACACTAAAGGAATGAATGATGG + Intronic
952414441 3:33077625-33077647 TACAATAAAGGAATGGGGAAGGG - Intronic
953035403 3:39206491-39206513 AAAACTCAAGGGATGGGGCAGGG + Intergenic
953287732 3:41629228-41629250 GACACAAAAGCTGTGGGGGATGG + Intronic
955836709 3:63063477-63063499 GATACTACAGGGATGTGGGCAGG + Intergenic
956278274 3:67527472-67527494 TACACAAAAGGGATGGTGAAAGG + Intronic
957358777 3:79126952-79126974 GACACTTACGGGAAGGAGGAGGG - Intronic
957407079 3:79785321-79785343 CACAGGAAGGGGATGGGGGAGGG + Intergenic
957532789 3:81461526-81461548 AACTGGAAAGGGATGGGGGAAGG + Intergenic
957838073 3:85625665-85625687 GACAATTTAGGGATTGGGGAAGG + Intronic
958036782 3:88179415-88179437 GAGATTTAATGGATGGGGGATGG + Intergenic
958253155 3:91293403-91293425 CAAAATAAAGGGATGGAGGAAGG + Intergenic
960509865 3:118536421-118536443 AACTCAAAAGGGATGGGGCAGGG - Intergenic
960566020 3:119132335-119132357 CAAAATAAAGGGATGGAGGAAGG + Intronic
960655719 3:120002134-120002156 GACACTAAAGTGATTGGAAATGG - Exonic
961048011 3:123722526-123722548 GGGCCTAGAGGGATGGGGGAGGG + Intronic
962249145 3:133824387-133824409 CACTTTAAAGGGATGGGTGAGGG + Exonic
963123979 3:141798262-141798284 GCCCCTGAGGGGATGGGGGAGGG + Intronic
964538965 3:157757741-157757763 GACAGAAAAGGGATGGGGGTTGG + Intergenic
965551124 3:169966474-169966496 GACTCTAAGGGGATGGGGTCGGG + Intergenic
965961183 3:174430345-174430367 GTCACTAAAGGGATTTTGGAAGG + Intergenic
966252458 3:177881534-177881556 GACGCTAAAGAGATGAGAGAAGG + Intergenic
966937397 3:184719974-184719996 GAGACTCAAGGGAAGGAGGAAGG + Intergenic
967416712 3:189227065-189227087 GAGACTAAAGGCAGGGGGAAGGG + Intronic
968192329 3:196677884-196677906 AACAGTGGAGGGATGGGGGATGG - Intronic
969934868 4:10670322-10670344 TACTCTTAAGGGATGGGGGATGG - Intronic
971890099 4:32508611-32508633 GAGTCTGAAGGGAGGGGGGATGG + Intergenic
972058547 4:34836248-34836270 GACAATAATGGTATGTGGGATGG - Intergenic
973251033 4:48060031-48060053 CAAAATAAAGGGATGGAGGAAGG + Intergenic
974151188 4:58011275-58011297 CAAAATAAAGGGATGGAGGAAGG + Intergenic
974612878 4:64239517-64239539 CAAAATAAAGGGATGGAGGAAGG - Intergenic
975503418 4:75112133-75112155 CAAAATAAAGGGATGGAGGAAGG + Intergenic
976599965 4:86928977-86928999 AACACTAAAGGACTTGGGGAAGG - Intronic
978692265 4:111528105-111528127 GACAATAGAGGGATGGGTCATGG + Intergenic
978832763 4:113109224-113109246 GAAACAAAAGGGATGGAGTAAGG - Intronic
979320347 4:119315969-119315991 GAGACTAAAGGGGTGGAGTAGGG + Intergenic
980791194 4:137621344-137621366 GAGACTAAAGGGAAGGGTGATGG + Intergenic
981861898 4:149365492-149365514 CACACTCAAAGGATGGGGGTAGG - Intergenic
984258321 4:177413558-177413580 GAATCTCAAGGGAAGGGGGAAGG + Intergenic
984577271 4:181465752-181465774 GCTACTAAAGTGAAGGGGGAAGG - Intergenic
984595118 4:181657978-181658000 GACTCTAAAAGGAGGGAGGAAGG + Intergenic
985778917 5:1859533-1859555 GACAATCAAGGGTTGGGGGCTGG - Intergenic
986206917 5:5633340-5633362 GAGAATGAAGGGATTGGGGATGG + Intergenic
986647208 5:9929194-9929216 CTCACTAGAGGGATGGGAGAGGG + Intergenic
986989093 5:13531098-13531120 AACACTGGAGGGGTGGGGGAAGG - Intergenic
989068839 5:37489936-37489958 GACACTGGGGGGAAGGGGGAGGG - Intronic
991294986 5:65071208-65071230 GAAAATAAAGGGATGGGGCAGGG - Intergenic
993625185 5:90215344-90215366 GACACAAAAAGGAAGTGGGAAGG + Intergenic
994309518 5:98251793-98251815 GACACTAAAAGGAGGGAGAAAGG + Intergenic
994636783 5:102353582-102353604 CAAAATAAAGGGATGGAGGAAGG + Intergenic
995521785 5:113014258-113014280 GAGACTAAAGGGTTGGAGGCAGG - Exonic
996186967 5:120489510-120489532 CAAAATAAAGGGATGGAGGAAGG - Intronic
996232614 5:121085009-121085031 CAAAATAAAGGGATGGAGGATGG - Intergenic
996250033 5:121318093-121318115 AAAAGTAAAGGGATGGTGGAAGG + Intergenic
997882713 5:137604627-137604649 GCCTCAAAAGGGATAGGGGAAGG + Intergenic
998717060 5:144896375-144896397 GACACTGTGGGGCTGGGGGAAGG + Intergenic
998978371 5:147673162-147673184 GAGAGAAAAGGGGTGGGGGAAGG + Intronic
999115487 5:149159941-149159963 GAGACTACAAGGATGGGAGAGGG - Intronic
1000328398 5:160188851-160188873 CACCCCAAGGGGATGGGGGAGGG - Intronic
1000853112 5:166364356-166364378 GACACTAAATCTGTGGGGGAGGG - Intergenic
1001427432 5:171632728-171632750 GATCCTAAAGGGCTGTGGGAGGG - Intergenic
1002342203 5:178524495-178524517 GTCACAGAAAGGATGGGGGATGG + Intronic
1002945899 6:1760425-1760447 GCCACTAAAATGATGGGAGAGGG + Intronic
1005826658 6:29635904-29635926 TACAGTAAAGGAATGGGGAAGGG + Intergenic
1006861112 6:37171809-37171831 GCCAGTAAAAGGATGGGGGCGGG + Intronic
1006905857 6:37533036-37533058 GACACTGGAGTGATGGGGTAGGG + Intergenic
1007199453 6:40094189-40094211 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1007740184 6:44005160-44005182 GACTCTAAAGGACAGGGGGAGGG + Exonic
1007943537 6:45804462-45804484 GACACTAATGGGGTGTGGTAAGG - Intergenic
1008016818 6:46529842-46529864 GACACTGAAGTGATGGGAGAAGG - Intergenic
1008463720 6:51806062-51806084 CACACTGATGGGAGGGGGGAGGG + Intronic
1008857514 6:56108397-56108419 GACAATAGAAGGATGGGCGAAGG + Intronic
1010318292 6:74475764-74475786 GACGGTAGAGGGGTGGGGGAAGG + Intergenic
1010663697 6:78600836-78600858 GACAGCAAAAGGTTGGGGGATGG + Intergenic
1010687325 6:78867928-78867950 GACACAAAAGGGTTGGCAGATGG + Intronic
1013229865 6:108152527-108152549 ACCACTAAATGGATGGGGGGTGG + Intronic
1013261910 6:108452555-108452577 GAACCAAAAGGGATGGGGGCAGG + Intronic
1013432300 6:110065951-110065973 GACAAGAACGGGATGGTGGATGG + Intergenic
1014731671 6:125039029-125039051 GACACAGCAGGGATGGGGGCAGG - Intronic
1015113501 6:129619624-129619646 GACGGGAAGGGGATGGGGGAGGG + Intronic
1015189537 6:130457784-130457806 GGCACCACAGGGATTGGGGAAGG - Intergenic
1015688790 6:135896895-135896917 CACACTGAAGAGATGGGGGATGG - Intronic
1015943573 6:138476489-138476511 GACTCCAAAGGGAGGGAGGATGG + Intronic
1016074264 6:139777476-139777498 TACACTAAAAGGGCGGGGGAAGG + Intergenic
1017910519 6:158788337-158788359 CACCCAAAAGGGATGGGGGAAGG + Intronic
1018881621 6:167888114-167888136 GAGACTAAAGAGATGAGTGAAGG + Intronic
1021451591 7:20787171-20787193 GAGACTGGAGGGAGGGGGGATGG + Intergenic
1021870340 7:25000105-25000127 TAAACTAAAGGGATGGAGGAAGG - Intergenic
1022004346 7:26253783-26253805 GACAAGAAAGGGAGGGAGGAAGG + Intergenic
1022122668 7:27324476-27324498 GACAACAAAGGGGTGGGGGGAGG - Intergenic
1022190385 7:28011882-28011904 GGGACTTAAGGGATGGGAGATGG + Intronic
1024025618 7:45407942-45407964 GACGCGGAAGGGCTGGGGGAGGG - Intergenic
1025050806 7:55732565-55732587 TACAATAAAGGAATGGGGAAGGG - Intergenic
1025479361 7:60962735-60962757 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1025518617 7:61689126-61689148 AACATCACAGGGATGGGGGATGG - Intergenic
1025542942 7:62117773-62117795 AACATCACAGGGATGGGGGATGG - Intergenic
1025552623 7:62269589-62269611 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1027435424 7:78159340-78159362 GAAACCAAAGGGTTGGGGGTGGG - Intronic
1027974724 7:85137426-85137448 GACACTACAGGGATATGGCAAGG + Intronic
1028191995 7:87864666-87864688 GAAAATGAAGGGATGGGGAAAGG - Intronic
1029830052 7:103246864-103246886 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1031519728 7:122748867-122748889 AACAATAAGGGGGTGGGGGAGGG + Intronic
1033597874 7:142869340-142869362 GAGACAAAGGGGATGAGGGAGGG + Intronic
1033760295 7:144430064-144430086 GTCACTAGAGGGTAGGGGGAGGG + Intergenic
1034503622 7:151468120-151468142 GTCACTGGAGTGATGGGGGAGGG - Intronic
1035239118 7:157518472-157518494 GACAGCAACGGGATGGTGGAGGG - Intergenic
1035537734 8:405382-405404 GAAAAGAAAGGTATGGGGGAGGG - Intergenic
1035672716 8:1432525-1432547 GAGACAAAAGAGATGGGCGAGGG + Intergenic
1036788494 8:11703117-11703139 CAGATTAGAGGGATGGGGGAAGG - Intronic
1037208832 8:16360313-16360335 GAGACTAAAGAGAGGGAGGAGGG + Intronic
1038800538 8:30744779-30744801 GGCAGGGAAGGGATGGGGGAGGG + Intronic
1038822896 8:30969256-30969278 GACACAAAAGTGATGGCAGATGG - Intergenic
1039314491 8:36356490-36356512 GAGACAAAAGGGAAGGAGGAAGG + Intergenic
1039587515 8:38719580-38719602 GACTGTAAAGGGAGGGAGGAGGG - Intergenic
1041012343 8:53557660-53557682 AACAGTAAAGGGCTGGAGGAGGG + Intergenic
1042838278 8:73097396-73097418 ACCATTAAAGGGAAGGGGGAGGG + Intronic
1042980629 8:74522943-74522965 GAAAATAAAGGGATGGAAGAAGG + Intergenic
1043298089 8:78692193-78692215 GAGGCTAAAGGGAGGGGGAAAGG - Intronic
1044998280 8:97857891-97857913 TACAGTAAAGGAATGGGGAAGGG + Intergenic
1045882975 8:107063133-107063155 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1046047739 8:108984455-108984477 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1047581362 8:126219293-126219315 GAAACAAAAGGGATGGGTAATGG - Intergenic
1047846226 8:128808390-128808412 GAGAATAAAGGGAAGGAGGACGG - Intergenic
1048009127 8:130442937-130442959 GAAACGAAAGGGAAGGGGGTGGG - Intronic
1049231076 8:141481885-141481907 GACAGTAAAGGTCTGGGGGAGGG - Intergenic
1049404179 8:142444299-142444321 GAGAGGAAGGGGATGGGGGATGG + Intergenic
1054983745 9:71237077-71237099 GAAAGGAAAGGGAAGGGGGATGG + Intronic
1056955260 9:91076067-91076089 GGCAGTATGGGGATGGGGGATGG - Intergenic
1061255737 9:129453579-129453601 GAAGATGAAGGGATGGGGGATGG + Intergenic
1062161636 9:135083579-135083601 GACACTGAGGGAAAGGGGGAAGG + Intronic
1203427143 Un_GL000195v1:51548-51570 GACATTACAGGGTTGGTGGAAGG - Intergenic
1185620777 X:1451376-1451398 GACCCCCTAGGGATGGGGGAGGG - Intronic
1185620832 X:1451519-1451541 GACCCCCTAGGGATGGGGGAGGG - Intronic
1185621052 X:1452093-1452115 GACCCCCTAGGGATGGGGGAGGG - Intronic
1185621203 X:1452479-1452501 GTCCCCATAGGGATGGGGGAGGG - Intronic
1185621231 X:1452549-1452571 GAACCTCTAGGGATGGGGGAGGG - Intronic
1187262819 X:17702927-17702949 CACCTTAAAGGGATGGGGAAGGG - Intronic
1187289997 X:17943844-17943866 GATAATATAGGGATGGGGGAGGG - Intergenic
1187323011 X:18257952-18257974 GAGAGGAAAGGGAAGGGGGAAGG + Intronic
1189160829 X:38806163-38806185 GGCACGAAAGGGATGGGGTGGGG - Exonic
1189230897 X:39451528-39451550 GTGACTTAAGGGATAGGGGAGGG - Intergenic
1189317084 X:40064017-40064039 ATCACTAATGGGGTGGGGGAGGG + Intronic
1190983759 X:55482201-55482223 GACAGTGAAGGCATGGAGGATGG + Intergenic
1191109633 X:56794527-56794549 GAATCTAGAGGGAAGGGGGAAGG - Intergenic
1191799013 X:65056944-65056966 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1192783303 X:74315265-74315287 AAAAAAAAAGGGATGGGGGAGGG + Intergenic
1193018036 X:76757841-76757863 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1193019394 X:76774926-76774948 GACAGTGGAGGGCTGGGGGAGGG - Intergenic
1193542671 X:82790584-82790606 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1193797049 X:85890037-85890059 GACTCTAAAAGGAGGGAGGAAGG + Intronic
1194630406 X:96275728-96275750 GATACTAATGGGGTCGGGGAGGG + Intergenic
1195108189 X:101620493-101620515 GACACTAATGGAATTGTGGAGGG + Intergenic
1195819950 X:108933852-108933874 GACTGTTATGGGATGGGGGAGGG - Intergenic
1195853213 X:109305447-109305469 GACACTTGAAGGATGGTGGAGGG + Intergenic
1196112819 X:111965108-111965130 CAAAATAAAGGGATGGAGGAAGG + Intronic
1196351299 X:114733686-114733708 GACAGTAGAGGGAGGGGTGATGG - Intronic
1196755212 X:119151398-119151420 GACACTCAAGGGCTTTGGGAAGG + Intergenic
1196910826 X:120482715-120482737 TACATTAAAGGGATGAGGGCTGG - Intergenic
1201736468 Y:17268013-17268035 CAGACTAAATGGATGGGAGATGG + Intergenic