ID: 1149417220

View in Genome Browser
Species Human (GRCh38)
Location 17:56471781-56471803
Sequence AACATTTAGCACTTTGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 499
Summary {0: 1, 1: 0, 2: 5, 3: 45, 4: 448}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149417220_1149417222 12 Left 1149417220 17:56471781-56471803 CCAGACACAAAGTGCTAAATGTT 0: 1
1: 0
2: 5
3: 45
4: 448
Right 1149417222 17:56471816-56471838 TTATATGCTATGCCCAGAATAGG 0: 1
1: 0
2: 53
3: 573
4: 1612

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149417220 Original CRISPR AACATTTAGCACTTTGTGTC TGG (reversed) Intronic
902177091 1:14658625-14658647 AACATTTTCCACTTTGGGACAGG + Intronic
903738015 1:25542720-25542742 AACCTTTACCAATTTGTGTTGGG - Intergenic
903927900 1:26843996-26844018 AACATTTTGTACTGTATGTCTGG + Intronic
905112709 1:35608493-35608515 AACATTTATCATTTTGTGTTGGG - Intronic
906763092 1:48397098-48397120 AACATTTGGCCTTTTGTGTCTGG - Intronic
907012974 1:50981073-50981095 TACATTTTGCACTTTGTATGTGG + Intergenic
907410821 1:54282121-54282143 TACCTTTGGCACTTTGTCTCAGG - Intronic
907802784 1:57788417-57788439 AGCATGTAGCCTTTTGTGTCTGG - Intronic
908478398 1:64511738-64511760 AATAATTAGCACTTTGAGTTGGG + Intronic
909117466 1:71556336-71556358 AACTTTTTCCACTTTCTGTCTGG - Intronic
909739484 1:79010134-79010156 AACATTTAGAAGTTTTGGTCGGG + Intergenic
910312112 1:85835646-85835668 TACATGTAGCCTTTTGTGTCTGG - Intronic
912002580 1:104853633-104853655 AAAATGTAGCACTGTGTGTTGGG + Intergenic
912747908 1:112260748-112260770 GACAATTAGCATGTTGTGTCTGG - Intergenic
913577240 1:120189063-120189085 AACATGTAGCACATTATGTCTGG - Intergenic
914559153 1:148800490-148800512 AACATGTAGCACATTATGTCTGG - Intergenic
914613680 1:149329733-149329755 AACATGTAGCACATTATGTCTGG + Intergenic
914973906 1:152339887-152339909 AACATTTGTCCTTTTGTGTCTGG - Intergenic
915151623 1:153837136-153837158 AATATTTATCCTTTTGTGTCTGG - Intronic
915922371 1:159986168-159986190 AATATTTATCCTTTTGTGTCTGG - Intergenic
915992388 1:160530707-160530729 AACATTTGTCTTTTTGTGTCTGG + Intergenic
916148991 1:161767500-161767522 TTTATTTAGCTCTTTGTGTCAGG + Intronic
916522493 1:165577423-165577445 AATATGTAGTACTTTGTGCCTGG - Intergenic
917130256 1:171734352-171734374 AACATATAGCCTTTTGTGACTGG - Intronic
917230935 1:172837134-172837156 AATATTTAGTCCTTTGTGACTGG - Intergenic
917917705 1:179720808-179720830 AATATGTAGCCTTTTGTGTCTGG - Intergenic
919027883 1:192201328-192201350 AACAGCTTGCACTGTGTGTCTGG - Intergenic
920582358 1:207123139-207123161 AATATTTTGCACTTAGTCTCTGG + Intronic
921603233 1:217129699-217129721 AACATTTGGCCTTTTGTATCTGG - Intronic
921627455 1:217393019-217393041 AACATTTAGCAATTTGAGGCAGG + Intergenic
922955586 1:229596420-229596442 AACACTAAGCAGTTTGTGGCTGG - Intronic
923905926 1:238383570-238383592 AAAATTTAGGAATTTGTGTTGGG - Intergenic
1062871935 10:912352-912374 AACATTTACAAATTTGTGTTGGG + Intronic
1063500064 10:6545481-6545503 AACATTTGTCCCTTGGTGTCTGG - Intronic
1064717592 10:18192737-18192759 AACATGTAACCTTTTGTGTCTGG + Intronic
1064990046 10:21248417-21248439 AAAATTTGTCCCTTTGTGTCTGG + Intergenic
1065408179 10:25391320-25391342 AACAGCTAGCACTGTGTGCCTGG + Intronic
1067092545 10:43275858-43275880 AACATGTGGCCTTTTGTGTCTGG + Intergenic
1068674959 10:59761253-59761275 AATATTTGTCACTTTGTGACTGG + Intergenic
1069560519 10:69426171-69426193 CTTATTTAGCCCTTTGTGTCAGG - Intergenic
1070035138 10:72714848-72714870 AATATTTAATACTTTGTTTCTGG + Intronic
1070826895 10:79396105-79396127 AACATTTGTCCTTTTGTGTCTGG + Intronic
1071453190 10:85819362-85819384 AACATTCATCACTTGGTGTGGGG - Intronic
1072296793 10:94016145-94016167 AACATTTAGAACTTTGGGAAAGG + Intronic
1072816456 10:98514167-98514189 AACATTTGTCCTTTTGTGTCTGG - Intronic
1072996669 10:100250972-100250994 AAAATGTAGTCCTTTGTGTCTGG + Intronic
1073262402 10:102200736-102200758 ACCAATCAGCACTCTGTGTCTGG - Intergenic
1074105463 10:110386305-110386327 AATATTTGTCCCTTTGTGTCTGG + Intergenic
1074665043 10:115712568-115712590 AAGATTTAGAAATTTGTGGCTGG + Intronic
1074993280 10:118731587-118731609 AATATGTAGCCCTTTGGGTCTGG - Intronic
1075044526 10:119135543-119135565 AACATTTACCCTTTAGTGTCTGG - Intronic
1077212751 11:1380583-1380605 AATATGTAGCCTTTTGTGTCTGG - Intergenic
1078387148 11:10902623-10902645 AACGTTTGTCCCTTTGTGTCTGG + Intergenic
1080791001 11:35522448-35522470 AACATTTGTCTTTTTGTGTCTGG + Intronic
1081957900 11:47109560-47109582 AGGATTTAGCACTCTGTGTCTGG - Intronic
1082063979 11:47883829-47883851 AATATGTAGCCTTTTGTGTCTGG - Intergenic
1082665969 11:55976676-55976698 AACATTTGTCTCCTTGTGTCTGG + Intergenic
1082924712 11:58532461-58532483 ACCAATCAGCACTCTGTGTCTGG + Intronic
1083906147 11:65672202-65672224 AACATTTGTCCTTTTGTGTCTGG - Intergenic
1084381664 11:68816675-68816697 TCCATTTAGTACTTTGTGGCAGG - Intronic
1085916067 11:80889488-80889510 AACATTTAACATTTTATGTGTGG - Intergenic
1086087892 11:82973994-82974016 AACATGTGGCCTTTTGTGTCTGG - Exonic
1086661534 11:89425444-89425466 AACATTTAGTAATATGGGTCTGG + Intronic
1086901929 11:92377452-92377474 AACTTTTATCACTTTTTATCTGG - Intronic
1087318123 11:96628682-96628704 AATATGTGGCATTTTGTGTCTGG - Intergenic
1088186004 11:107170866-107170888 AACATTCAGAAATTTGTGTAGGG - Intergenic
1089204182 11:116745630-116745652 AATATTTGGCCTTTTGTGTCTGG - Intergenic
1090128776 11:124117702-124117724 AACATTTACGAGTTTGTGGCTGG + Exonic
1090149047 11:124362502-124362524 AATATTTAGCACTCTTTGGCAGG + Intergenic
1091163354 11:133446792-133446814 AACATTTTGTCATTTGTGTCTGG + Intronic
1092800981 12:12166423-12166445 AATATTTATCACTCTGTGTTGGG - Intronic
1093632604 12:21427587-21427609 AACACATAGCAATTTGTCTCAGG + Intergenic
1094736570 12:33241317-33241339 ACCAATCAGCACTCTGTGTCTGG - Intergenic
1095448667 12:42306600-42306622 CATATTTAGCACTATGTTTCAGG - Intronic
1096012690 12:48234447-48234469 AACATATAACTCTTTGTTTCAGG - Intergenic
1097995624 12:65884911-65884933 CACATATAGCACTATGTGCCAGG - Intronic
1098041121 12:66355010-66355032 ACCATTAGGCACTTGGTGTCTGG - Intronic
1098064164 12:66594423-66594445 AACATTTACAAATTTGTGTTGGG - Intronic
1099088671 12:78278556-78278578 AACAGCTTGCACTGTGTGTCTGG + Intergenic
1099190109 12:79553752-79553774 ACCAATCAGCACTTTGTGTCTGG - Intergenic
1100328314 12:93562453-93562475 AACATTTAACAACTTGTATCAGG - Intergenic
1100373334 12:93990003-93990025 AACATTTATCTTTTTGTGACTGG - Intergenic
1100873766 12:98940680-98940702 TTTATTTAGCACTTTGTCTCAGG - Intronic
1101069167 12:101054915-101054937 AATATATAGCATTTTGTGTCTGG + Intronic
1102826846 12:115954032-115954054 AACCTTTGTCATTTTGTGTCAGG - Exonic
1102857851 12:116310183-116310205 AACATGTGGCCTTTTGTGTCTGG + Intergenic
1103142575 12:118562361-118562383 AATATGTAGCCTTTTGTGTCTGG + Intergenic
1103257979 12:119559378-119559400 AACATTGATCACTTTGTGTTTGG + Intergenic
1103394703 12:120598699-120598721 AGCATTTATCACTGTGTGCCAGG - Intergenic
1103517942 12:121519522-121519544 AACATGTGGCCTTTTGTGTCTGG - Intronic
1103741246 12:123093111-123093133 ACCATGTGGCATTTTGTGTCTGG - Intronic
1104062461 12:125280236-125280258 AACATTTATTTCTTTGTGTTGGG - Intronic
1104423090 12:128653161-128653183 AACATGTGGCCCTTTGTGCCTGG - Intronic
1105062550 12:133166527-133166549 AATATTTGTCCCTTTGTGTCTGG - Intronic
1105459528 13:20570600-20570622 AATATGTAGCCTTTTGTGTCTGG - Intronic
1106434203 13:29709287-29709309 AACATGTGGCCTTTTGTGTCTGG + Intergenic
1108277500 13:48826143-48826165 AACAGCTTGCACTATGTGTCTGG - Intergenic
1108558187 13:51616848-51616870 AACACTTAGAACTATGTGCCAGG - Intronic
1108600750 13:51992490-51992512 AACATTTAGCACTTGGTATATGG - Intronic
1108958276 13:56187900-56187922 ACCAATCAGCACTCTGTGTCTGG + Intergenic
1108991023 13:56658644-56658666 ACCAATCAGCACTGTGTGTCTGG - Intergenic
1109073338 13:57799205-57799227 AACATTAAGGACTATGTGTACGG + Intergenic
1110050309 13:70888424-70888446 AACATTCAGCAATTTATGACAGG - Intergenic
1110207879 13:72938455-72938477 AATATTTGGCCTTTTGTGTCTGG + Intronic
1110691419 13:78433543-78433565 ATCATTTAGCACTGTGGCTCTGG - Intergenic
1110773697 13:79380612-79380634 AACATTTATTTCTTTGTGTTGGG + Intronic
1111072602 13:83188049-83188071 AACAGCTTGCACTTTGTGCCTGG + Intergenic
1111380486 13:87443703-87443725 AACATTGACCCTTTTGTGTCTGG - Intergenic
1111948360 13:94689360-94689382 AAAATGTAGCCTTTTGTGTCTGG - Intergenic
1112147467 13:96717070-96717092 AACATCTAGCCCTTTGTGTCTGG + Intronic
1112161166 13:96869401-96869423 AATATGTAGCCTTTTGTGTCTGG + Intergenic
1114006885 14:18323525-18323547 AATATTTATCTTTTTGTGTCTGG - Intergenic
1114136219 14:19854821-19854843 AACATTTATCATTTTTTGTTGGG + Intergenic
1114663225 14:24363124-24363146 AATATGTAGCCTTTTGTGTCTGG - Intergenic
1115015246 14:28603346-28603368 CACATTCAGTACTTTGTGCCTGG - Intergenic
1115060729 14:29186778-29186800 ACCAATCAGCACTCTGTGTCTGG + Intergenic
1115118385 14:29909571-29909593 ACCATTCAGCACTCTGTATCTGG + Intronic
1115675123 14:35664490-35664512 AACATTCAAGCCTTTGTGTCTGG + Intronic
1116308717 14:43293180-43293202 AAAATTTAGCAGTTTATGTGAGG + Intergenic
1116522168 14:45862814-45862836 AACATTTAGCAGTCTGTGAGTGG + Intergenic
1116949802 14:50869035-50869057 AATATGTTGCATTTTGTGTCTGG - Intronic
1117869225 14:60181982-60182004 AACATTTATCATTTTTTGTGTGG - Intergenic
1118260012 14:64237766-64237788 AACATGTGGTCCTTTGTGTCTGG - Intronic
1120685725 14:87534321-87534343 AATATTTAACTTTTTGTGTCTGG + Intergenic
1120871621 14:89342314-89342336 ATCTTTGAGCACTTTGTATCAGG - Intronic
1121354704 14:93204651-93204673 AACATGTACCCTTTTGTGTCTGG + Intronic
1122240173 14:100359409-100359431 AACATGTGGCCTTTTGTGTCTGG - Intronic
1122832970 14:104411843-104411865 AACATTTATCATTTTGTTTTTGG - Intergenic
1123197380 14:106629553-106629575 GACAGTTTGCACTTTGTGCCTGG + Intergenic
1123198719 14:106641429-106641451 GACAGTTTGCACTTTGTGCCTGG + Intergenic
1123825470 15:24078043-24078065 ACCAATCAGCACTCTGTGTCTGG - Intergenic
1124378896 15:29148033-29148055 AACATGTGGCCGTTTGTGTCTGG - Intronic
1124946813 15:34275848-34275870 AATATTTATCTTTTTGTGTCTGG - Intronic
1125378913 15:39065254-39065276 AATATTTAGCACTTGGAATCTGG + Intergenic
1126296405 15:47141630-47141652 AACATTTATTTCTTTGTGTTGGG - Intergenic
1126340778 15:47638898-47638920 AAAATGTAGCACTTGGTCTCAGG + Intronic
1126777992 15:52115925-52115947 AACATGTGGCTCTTTGTCTCTGG + Exonic
1127050053 15:55072612-55072634 AACATTTTTCTTTTTGTGTCTGG - Intergenic
1127100939 15:55564307-55564329 AACATGTGGCTTTTTGTGTCTGG - Intronic
1127115320 15:55720832-55720854 AACATTTATGAATTTGTGTTGGG + Intronic
1127944772 15:63739871-63739893 CACAATAAGCCCTTTGTGTCTGG + Intronic
1128641471 15:69341269-69341291 AATATTTGTCCCTTTGTGTCTGG + Intronic
1128858110 15:71038246-71038268 AACATTTAGAAGTGTGTGTGTGG + Intronic
1129787045 15:78316431-78316453 CACATTAAGCCCTTTGTCTCTGG + Intergenic
1130421792 15:83755511-83755533 AATATTTATCCTTTTGTGTCTGG + Intronic
1130451465 15:84057790-84057812 CACATTTAGAATTTTGTGTTTGG + Intergenic
1131193872 15:90339456-90339478 AACATGTGGCCTTTTGTGTCTGG - Intergenic
1132123387 15:99197513-99197535 CATATTTAGCACTATGTATCAGG + Intronic
1133801018 16:9085605-9085627 AATATTTAGCCTTTTGTGTCTGG - Intergenic
1134087204 16:11365708-11365730 AATATGTAGCATTTCGTGTCTGG + Intronic
1136059445 16:27716191-27716213 AACATATAGCCTTCTGTGTCTGG - Intronic
1137960800 16:52880134-52880156 AATATTTGTCATTTTGTGTCTGG - Intergenic
1138168569 16:54827047-54827069 AATATGTAGCATTTTGTGTCTGG + Intergenic
1138632144 16:58306075-58306097 AGCATTTGTCACTCTGTGTCTGG - Intronic
1140242826 16:73219044-73219066 AATATGTAGCCCTTTGTGTCTGG + Intergenic
1140682177 16:77395939-77395961 AGCATTTACCACTATGAGTCAGG + Intronic
1140835111 16:78786849-78786871 AAAATTTACCACTTTGGGGCTGG + Intronic
1141254965 16:82392471-82392493 CAGATGTAGCCCTTTGTGTCTGG + Intergenic
1141534839 16:84672026-84672048 AACATGTGGCCTTTTGTGTCTGG - Intergenic
1144803277 17:17946462-17946484 AATATATAGCTGTTTGTGTCTGG + Intronic
1145212583 17:21025734-21025756 AACATGTGGCCCTTCGTGTCTGG - Intronic
1147538716 17:41338126-41338148 AAAATTAACCACTTTGTGCCTGG + Intergenic
1149417220 17:56471781-56471803 AACATTTAGCACTTTGTGTCTGG - Intronic
1149883511 17:60316930-60316952 AATATTTGCCATTTTGTGTCTGG - Intronic
1150027665 17:61694341-61694363 AATATGTAGCATTTTGTATCTGG + Intronic
1150189476 17:63223023-63223045 AATATTTGGCCTTTTGTGTCTGG - Intronic
1151148008 17:72059073-72059095 TACAGGTAGCTCTTTGTGTCAGG - Intergenic
1155140938 18:23043923-23043945 AACATTTGTCCTTTTGTGTCTGG - Intergenic
1155488679 18:26375168-26375190 AACATGTGGCCTTTTGTGTCTGG + Intronic
1155806202 18:30174895-30174917 ACCAGTCAGCACTCTGTGTCTGG - Intergenic
1156652024 18:39235938-39235960 ACCAATCAGCACTCTGTGTCTGG + Intergenic
1156660389 18:39339568-39339590 AAACTCTAGCACTTTGAGTCAGG - Intergenic
1157484738 18:48078798-48078820 AACATGTAACCTTTTGTGTCTGG + Intronic
1157510880 18:48272892-48272914 AATATGTAGCCTTTTGTGTCTGG - Intronic
1157876324 18:51277078-51277100 AATATTTGTCCCTTTGTGTCTGG + Intergenic
1158763523 18:60419699-60419721 AACATTTGGACTTTTGTGTCTGG - Intergenic
1158901492 18:61966074-61966096 AATATGTAGCATTCTGTGTCTGG + Intergenic
1159068743 18:63598511-63598533 TACATGTAGTATTTTGTGTCTGG + Exonic
1159250061 18:65864326-65864348 AACATTTAAGAATTTGTGTCGGG - Intronic
1159262487 18:66032451-66032473 AACTTTTAGAACTGTGTGTTTGG - Intergenic
1161433526 19:4248293-4248315 AAAATAAAGCACTTTGTGTTTGG + Intronic
1162730988 19:12718735-12718757 AACATCTAGAATTTTGTGTTCGG - Intronic
1163684752 19:18705033-18705055 AGGATTTATCATTTTGTGTCTGG + Intronic
1167585156 19:50370397-50370419 AATATGTAGCTCTTTGTGACTGG - Intronic
1168503199 19:56910655-56910677 AACATCCAGCGCTTTGTGCCTGG - Intergenic
926071679 2:9899257-9899279 AACATTTGACTTTTTGTGTCTGG + Intronic
926803449 2:16683048-16683070 AAGACTGAGCACTGTGTGTCAGG - Intergenic
928099444 2:28427364-28427386 AACATGTGGCCTTTTGTGTCTGG - Intergenic
928169105 2:28992007-28992029 CTCATTTAGCCCTTTGGGTCAGG + Intronic
928449431 2:31365445-31365467 AACATCTAGAACCTTGTATCTGG + Exonic
928791047 2:34954003-34954025 AAAATATAGTATTTTGTGTCTGG - Intergenic
929290512 2:40185482-40185504 AACATGTAGCCATTTGTGTCTGG - Intronic
929324105 2:40585175-40585197 AATATGTGGCCCTTTGTGTCTGG + Intronic
929473856 2:42225004-42225026 AACATTTGTCCTTTTGTGTCTGG + Intronic
929498762 2:42471389-42471411 AACATGGAGCCTTTTGTGTCTGG - Intronic
929965451 2:46531279-46531301 AACATATAGCATTTTGTGTCTGG + Intronic
930246909 2:48992978-48993000 ATCATTTAGCATTTTTTTTCCGG + Intronic
930266021 2:49199897-49199919 TACATATAACACATTGTGTCAGG + Intergenic
931167574 2:59764746-59764768 AACAATTAGCAGTTTGGGCCAGG + Intergenic
931519055 2:63075018-63075040 AATATTTATCCCTTTGTGTCTGG + Intergenic
931726500 2:65116543-65116565 AACATCTAGCACATACTGTCTGG + Intronic
932192798 2:69755081-69755103 AACATTTATCCTTCTGTGTCTGG - Intronic
932208800 2:69909452-69909474 AACATGTAGCCTTTTGTGTCTGG + Intronic
932814071 2:74847807-74847829 AACAGGTAGCACAGTGTGTCTGG + Intronic
932912233 2:75818121-75818143 AACATCTTGCACTGTGTGCCTGG - Intergenic
934589554 2:95534248-95534270 AAAGTTTAGGAATTTGTGTCGGG + Intergenic
934953767 2:98599134-98599156 AACATGTAGCCTTTTGTGACTGG - Intergenic
935104678 2:100029553-100029575 AGCATTTATCTCTTTGTGACTGG - Intronic
936363393 2:111828687-111828709 AATATTTATCTCTCTGTGTCTGG - Intronic
938728898 2:134130528-134130550 ACCAATCAGCACTCTGTGTCTGG + Intronic
939697675 2:145347260-145347282 AACATTTAGAACATTCTGCCCGG - Intergenic
939764357 2:146227576-146227598 AGCATCTTTCACTTTGTGTCAGG + Intergenic
940541365 2:155024265-155024287 AACATTTTGCATTTAGTGTATGG + Intergenic
940701429 2:157048679-157048701 AACATTTTGCACTTTATTTCAGG + Intergenic
940860248 2:158763852-158763874 AATATTTATCTCTTTGTGACTGG - Intergenic
941484257 2:166059884-166059906 AAAATTAAGCACTTTCTATCTGG + Intronic
941835260 2:170010154-170010176 AACATTTAGTATTTTGTTTCTGG + Intronic
942235159 2:173896746-173896768 AATATGTAGCCTTTTGTGTCTGG - Intergenic
943199699 2:184804374-184804396 AGCATTTGGCAAATTGTGTCCGG + Intronic
943576147 2:189633281-189633303 ACCATTCTGCACTTTGTGTAAGG + Intergenic
943710152 2:191083965-191083987 AAGATATAGAACTTTGTGGCTGG + Intronic
943819248 2:192299124-192299146 AAAATTGAGCACATTGTCTCTGG + Intergenic
944050875 2:195468009-195468031 AACTCTTAGGAGTTTGTGTCAGG - Intergenic
944541280 2:200756165-200756187 AACCTAGAGCACTTTGTGACTGG - Intergenic
944557762 2:200904939-200904961 AACATGTGGTCCTTTGTGTCCGG + Intergenic
944864437 2:203846923-203846945 AACATTTAGCAATTTGTGCCAGG - Intergenic
945767002 2:213993310-213993332 AATATTTTGCACTGTGTGACTGG - Intronic
947881599 2:233519005-233519027 AACATATAGTCTTTTGTGTCTGG - Intronic
948282364 2:236757172-236757194 AATATATAGTATTTTGTGTCTGG + Intergenic
1169298887 20:4424986-4425008 AATATGTAACCCTTTGTGTCTGG + Intergenic
1169670638 20:8097053-8097075 AACATGTGGCCTTTTGTGTCTGG + Intergenic
1169880084 20:10337598-10337620 AACATATGGCCTTTTGTGTCTGG + Intergenic
1170315150 20:15032963-15032985 AACATTTGCCCTTTTGTGTCTGG - Intronic
1171888340 20:30679265-30679287 AATATTTAGTCCTTTGTGACTGG - Intergenic
1172065875 20:32220060-32220082 AATATTTATCTTTTTGTGTCTGG + Intronic
1172431607 20:34897461-34897483 AACACGTGGCCCTTTGTGTCTGG + Intronic
1172659916 20:36560690-36560712 AATATTTATTATTTTGTGTCTGG + Intergenic
1172687990 20:36771816-36771838 AACAGTTAGGACTTTGGATCTGG - Intronic
1173755329 20:45510854-45510876 GACATTTAGGATTTTGTCTCAGG + Intergenic
1174855454 20:54041069-54041091 AATATTTTGCTTTTTGTGTCTGG - Intronic
1175917140 20:62431506-62431528 AGCATTTGGCTCTTCGTGTCTGG + Intergenic
1176813615 21:13573002-13573024 AACATTTATCATTTTTTGTTGGG - Intergenic
1178078931 21:29042304-29042326 AACATTGAGGACTTTGGGTTGGG - Intronic
1178471530 21:32897866-32897888 AACATTTGTCATTTTGTGCCTGG + Intergenic
1178599350 21:33982611-33982633 AACATGTGGCCTTTTGTGTCTGG + Intergenic
1180431392 22:15254335-15254357 AATATTTATCTTTTTGTGTCTGG - Intergenic
1181278091 22:21699357-21699379 AACATTTAGTAACTTGTCTCAGG - Exonic
1181488412 22:23246040-23246062 AACATGTGGCACTTTGTGACTGG + Intronic
1182425991 22:30272977-30272999 AACATGTGGCCTTTTGTGTCTGG - Intergenic
1183886549 22:40888179-40888201 AACATTTGGCTTTTTGTGACTGG + Intronic
950449789 3:13059137-13059159 AGCATTGAGCTCCTTGTGTCTGG - Intronic
951535571 3:23737515-23737537 AATATTTAGGACTTTGTCTTTGG - Intergenic
953423958 3:42777572-42777594 AATATTTGCCATTTTGTGTCTGG - Intronic
954307078 3:49733647-49733669 AATATTTATCCTTTTGTGTCTGG - Intronic
954598556 3:51849883-51849905 ACCAATTAGCACTCTGTGTCTGG + Intergenic
954889533 3:53912387-53912409 AATATTTGGTTCTTTGTGTCTGG - Intergenic
955943008 3:64164497-64164519 AACATTTATGACTTAGTTTCTGG - Intronic
956637018 3:71375555-71375577 AACATTTAGGACTTAATTTCAGG - Intronic
957019929 3:75114620-75114642 ACCATTTAACAATTTGTCTCTGG + Intergenic
957187016 3:76955120-76955142 AATATTTGCCATTTTGTGTCTGG + Intronic
957276138 3:78093530-78093552 AACATTTTGCACCTTGCGCCTGG + Intergenic
959259919 3:104064587-104064609 AACATTTACAAATTTGTGTTTGG - Intergenic
959299385 3:104578555-104578577 GACATTTAGCACTGTGTACCTGG - Intergenic
959643659 3:108671770-108671792 AATATAAAGCACTTTGTGTTTGG - Intronic
960527611 3:118727832-118727854 AATATGTGGCTCTTTGTGTCTGG - Intergenic
960677735 3:120213059-120213081 AACATGGGGCCCTTTGTGTCTGG - Intronic
961845168 3:129756737-129756759 AACATGTAACACTTTGAGTCTGG - Intronic
961863389 3:129936070-129936092 AACATTTGGCCTTTTGTATCTGG - Intergenic
963166461 3:142209287-142209309 AACATATAGCACATTTTGTTGGG - Intronic
963257195 3:143157390-143157412 AACATTTATCCTTTTGTGTCTGG - Intergenic
963494807 3:146045468-146045490 AACAGCTTGCACTATGTGTCTGG - Intergenic
963999080 3:151746883-151746905 AATTTTTAACACTTTTTGTCAGG + Intronic
964560622 3:157991759-157991781 AACATGTGGCCTTTTGTGTCTGG + Intergenic
964736274 3:159921897-159921919 TATTTTTAGCACTTTGTGCCTGG + Intergenic
964840764 3:160991130-160991152 AAAATTTACCAATTTGTGTTAGG + Intronic
965005212 3:163012907-163012929 AACATTTATCTTTTTGTGTATGG + Intergenic
965052050 3:163663481-163663503 AACATCTTGCACTGTGTGCCTGG + Intergenic
965287695 3:166838366-166838388 AAAATTTATCAATTTGTGTTGGG - Intergenic
965764575 3:172116529-172116551 AACATTTGGTCTTTTGTGTCTGG + Intronic
966133195 3:176667679-176667701 AGAATTTATCACTTTGTGTTAGG + Intergenic
966700661 3:182846714-182846736 AACATGTGGCCTTTTGTGTCTGG - Intronic
966855640 3:184192261-184192283 AACATTTATCACTTTATGTTGGG + Intronic
966987683 3:185197021-185197043 AATATGTAGCCTTTTGTGTCTGG - Intronic
967762610 3:193242067-193242089 AACATTTACAAATTTGTGTTGGG - Intronic
968179649 3:196583106-196583128 ACCATTTAGCCTTTTGTGTCTGG + Intronic
968247188 3:197163902-197163924 AATATTTATCCTTTTGTGTCTGG - Intronic
969303059 4:6308875-6308897 ACCAATCAGCACTCTGTGTCTGG - Intergenic
969438647 4:7203909-7203931 CACATTTGTCATTTTGTGTCTGG + Intronic
970182685 4:13415941-13415963 ACCAATCAGCACCTTGTGTCTGG + Intronic
970402708 4:15733291-15733313 ACCAGTCAGCACTCTGTGTCCGG - Intronic
970408562 4:15786575-15786597 ACCAATCAGCACTCTGTGTCTGG - Intronic
970452512 4:16184994-16185016 TACATTTAGTACTTTTTGTGTGG + Intronic
970521874 4:16892793-16892815 AACATTTAGCTTTTTGTTTGGGG - Intronic
972204265 4:36753177-36753199 ACCATTTAGTACTTTCTGTAAGG + Intergenic
972365117 4:38367383-38367405 AACATTTACAAATTTGTGTTGGG + Intergenic
972471230 4:39406359-39406381 AAAATATAGCACTTTGTGGATGG - Intergenic
972586583 4:40443053-40443075 AATATTTATCCCTTTGTGTCTGG - Intronic
972788548 4:42349068-42349090 AACAATTCTTACTTTGTGTCAGG - Intergenic
973045487 4:45531131-45531153 ACCAGTCAGCACTCTGTGTCTGG + Intergenic
973192325 4:47399845-47399867 AACACCTTGCACTTTCTGTCTGG + Intronic
973557139 4:52095014-52095036 AACATTTAACTCTCTGTGTGGGG - Exonic
973672482 4:53235334-53235356 AACATTTATCAATTTATGGCAGG + Intronic
973720028 4:53713926-53713948 AACATGTGGCCTTTTGTGTCTGG - Intronic
974219615 4:58949251-58949273 AACATTTAAAACTTTATTTCTGG + Intergenic
974499470 4:62681359-62681381 ATGATGTAGCACTTTGTATCAGG + Intergenic
974590089 4:63936717-63936739 AACAGCTAGCAATTTTTGTCAGG + Intergenic
975031435 4:69622863-69622885 AATTTTTAGCAATTTTTGTCAGG - Intronic
975505683 4:75134164-75134186 GACATTTCTCATTTTGTGTCTGG - Intergenic
975872149 4:78791701-78791723 AATATTTAGCATTTTGTGTCTGG + Intronic
976283997 4:83353609-83353631 AATATGTATCATTTTGTGTCTGG + Intergenic
977206614 4:94170357-94170379 AGCAATCAGCACTCTGTGTCTGG + Intergenic
977408570 4:96632417-96632439 ACCAATCAGCACTCTGTGTCTGG + Intergenic
977575411 4:98668706-98668728 AATATTTGTCCCTTTGTGTCTGG - Intergenic
978265550 4:106820027-106820049 AACATGTGACATTTTGTGTCTGG + Intergenic
978482440 4:109209506-109209528 AAAATTTACTGCTTTGTGTCTGG - Intronic
979352316 4:119658566-119658588 AATATGTAGCCTTTTGTGTCTGG + Intergenic
979903655 4:126255941-126255963 ACCAATCAGCACTCTGTGTCTGG - Intergenic
981280690 4:142954780-142954802 ACCAATCAGCACTCTGTGTCTGG + Intergenic
981515187 4:145600024-145600046 AATATTTGTCACTTTATGTCTGG + Intergenic
982142988 4:152346764-152346786 AACATGTGGCCTTTTGTGTCTGG + Intronic
983359582 4:166711059-166711081 AACCTTTAACATTTTGTGTAGGG + Intergenic
984041576 4:174740858-174740880 AATATTTAACATTTTGAGTCTGG + Intronic
984843049 4:184086127-184086149 AACATTTAAAACTTGGTCTCAGG - Intergenic
984862591 4:184253620-184253642 ACCAATCAGCACTCTGTGTCTGG + Intergenic
984957444 4:185059446-185059468 AATATTTGTCCCTTTGTGTCTGG + Intergenic
985003107 4:185505127-185505149 AATATTTGCCTCTTTGTGTCTGG + Intronic
985392688 4:189506641-189506663 AACATGTGGCCTTTTGTGTCTGG + Intergenic
986582383 5:9279052-9279074 AACAACTTGCACTGTGTGTCTGG + Intronic
987328885 5:16837364-16837386 AATATATAGCCTTTTGTGTCTGG - Intronic
988211687 5:28212305-28212327 GATATTTAGCACTTTTTGCCTGG - Intergenic
988814194 5:34816256-34816278 AAACTTTAGCACTTTGTATTTGG - Intronic
990502290 5:56408635-56408657 AACATGTATTCCTTTGTGTCTGG - Intergenic
991929104 5:71734070-71734092 AACACGTGGCCCTTTGTGTCTGG + Intergenic
991947256 5:71911135-71911157 AACTTTGAGCAGTTAGTGTCAGG + Intergenic
991962576 5:72060057-72060079 TATATTTGGCATTTTGTGTCTGG - Intergenic
992087034 5:73287172-73287194 AATATTTATCCCTTTGTGACTGG - Intergenic
992789020 5:80197370-80197392 AATATATAGCCCTCTGTGTCTGG - Intronic
992850530 5:80802821-80802843 AAAGTTTATCACTTTGTGGCTGG + Intronic
993211253 5:84954856-84954878 AATATGTAGCATTTTGTGTCTGG - Intergenic
993481566 5:88430766-88430788 AACATGTTGCACTGTGTGCCTGG - Intergenic
993741003 5:91539597-91539619 AATATTTGTCCCTTTGTGTCTGG + Intergenic
993919818 5:93787596-93787618 CAGTTTTATCACTTTGTGTCTGG - Intronic
994654522 5:102573965-102573987 AATATGTAGCTCTTTGTGTCTGG + Intergenic
994699608 5:103117278-103117300 AATATATAGCCATTTGTGTCTGG - Intronic
995069554 5:107903775-107903797 AATATTTTGCATTTTGTGTTAGG - Intronic
995842104 5:116452290-116452312 ACCATTTAGCACCTTATGACTGG - Intronic
996050668 5:118929379-118929401 AACACTTAGCACTCTGTGAATGG - Intronic
996139045 5:119882239-119882261 AATATTTATCTTTTTGTGTCTGG - Intergenic
996244125 5:121238676-121238698 ATGATGTAGCATTTTGTGTCTGG + Intergenic
997041483 5:130260812-130260834 AGAATTTAGCCCTTTGAGTCTGG + Intergenic
997046585 5:130326324-130326346 AACATTTAGCACTTTCCATTTGG - Intergenic
997577499 5:134993198-134993220 AATATTTGTCCCTTTGTGTCTGG - Intronic
997731567 5:136183717-136183739 AAAATTTACCAATTTGTGTTGGG - Intronic
998100699 5:139431454-139431476 AACATGTAGCTTTTTGTATCTGG + Intronic
999426789 5:151494549-151494571 CATATGTAGCCCTTTGTGTCTGG + Intergenic
999931712 5:156440235-156440257 AACATTTGGCTTTTGGTGTCTGG + Intronic
1000220907 5:159212972-159212994 AATATGTAGCATTTTGTGTCTGG + Intergenic
1000333308 5:160223166-160223188 ACCATTTTTCACTTTGTCTCTGG + Intronic
1000350819 5:160351043-160351065 AATATTTAGCACTGTGGGCCAGG - Intronic
1000406174 5:160890536-160890558 AACATGTGGCTCTTTGTGTCTGG + Intergenic
1001437032 5:171707344-171707366 AACATTTAGAATTTTGTATGTGG - Intergenic
1001693895 5:173655001-173655023 AATATTTAGCACTTTCTAACTGG - Intergenic
1002282688 5:178141942-178141964 CACATGTAGCCTTTTGTGTCCGG + Intronic
1002793313 6:450689-450711 ACCAATCAGCACTCTGTGTCTGG + Intergenic
1002893385 6:1357128-1357150 AATATTTGGCACTTTATGTCTGG - Intergenic
1004159224 6:13198682-13198704 AAAGTTTACCATTTTGTGTCGGG + Intronic
1005001685 6:21248044-21248066 AACATATGTCATTTTGTGTCTGG + Intergenic
1005117613 6:22356083-22356105 ACCAATCAGCACTCTGTGTCTGG - Intergenic
1005405423 6:25482579-25482601 AACTTTTAAAACTTTGAGTCAGG + Intronic
1005889005 6:30121039-30121061 CACATTAAGAACTTTGTGCCGGG - Intergenic
1006614474 6:35316967-35316989 AATATTTGTCCCTTTGTGTCTGG + Intronic
1007669746 6:43541665-43541687 AACATATGGCCTTTTGTGTCTGG + Intronic
1007748090 6:44055471-44055493 AACACATAGCACTATGTGCCAGG - Intergenic
1008724143 6:54395444-54395466 AACATTTTCCACTTTGTCCCAGG + Intergenic
1008837664 6:55856138-55856160 AATATATAGCCCTTTGGGTCTGG + Intronic
1009029784 6:58042887-58042909 AACATTTATCAAATTGTGGCTGG + Intergenic
1009739380 6:67723690-67723712 ACCAATCAGCACTCTGTGTCTGG + Intergenic
1010544427 6:77132869-77132891 GACATATAGCATTTTGTGTCTGG - Intergenic
1010628499 6:78168453-78168475 AACATTCAGCCCCATGTGTCTGG + Intergenic
1010653173 6:78479300-78479322 AACACTTACCACAGTGTGTCTGG - Intergenic
1010761219 6:79725428-79725450 AAAATTTAGCAGTTTGGGCCAGG + Intergenic
1011060322 6:83258639-83258661 TATATCTAGCACTATGTGTCAGG + Intronic
1011740274 6:90352749-90352771 AATATTTGTCATTTTGTGTCTGG + Intergenic
1013497633 6:110714183-110714205 AATATATAGCTCTTGGTGTCTGG + Intronic
1013599441 6:111690649-111690671 AACATTTATCACTATGTGCTGGG + Intronic
1013957353 6:115855998-115856020 ACCAATCAGCACTCTGTGTCTGG + Intergenic
1014244682 6:119055145-119055167 AATATTTAGCCTTTTGTGTCTGG + Intronic
1015109995 6:129581883-129581905 AGCATATAGCACTGTCTGTCTGG - Intronic
1015335425 6:132031890-132031912 AATATTTATCCTTTTGTGTCTGG + Intergenic
1016114505 6:140263074-140263096 AACATTTAGGGATATGTGTCAGG - Intergenic
1016128372 6:140434345-140434367 AACAGCTTGCACTGTGTGTCTGG + Intergenic
1016334084 6:142985077-142985099 AATAATTACCACATTGTGTCTGG + Intergenic
1016810346 6:148255099-148255121 AATATGTGGCCCTTTGTGTCTGG - Intergenic
1017041501 6:150311894-150311916 AACATTTATAACTTTGCATCAGG - Intergenic
1018087551 6:160317275-160317297 AAAATGTGGCATTTTGTGTCTGG + Intergenic
1018352381 6:162973471-162973493 AACCTTTAGCACTGAATGTCAGG + Intronic
1018478366 6:164166107-164166129 AACATTGTGTACTTTGTGCCAGG - Intergenic
1019090350 6:169525972-169525994 AATATTTATCTTTTTGTGTCTGG - Intronic
1019752366 7:2739378-2739400 AGCATGCAGCCCTTTGTGTCTGG + Intronic
1020024498 7:4889267-4889289 AATATTTGACATTTTGTGTCTGG + Intergenic
1020572237 7:9878812-9878834 AACATTTAACAGTTTTTGTTAGG - Intergenic
1022852710 7:34281980-34282002 AACAGCTTGCACCTTGTGTCTGG - Intergenic
1022962910 7:35446993-35447015 AACATGTAGTCATTTGTGTCTGG + Intergenic
1023052668 7:36266830-36266852 AATATGTAGCCTTTTGTGTCTGG + Intronic
1023243482 7:38175827-38175849 ACCAATCAGCACTCTGTGTCTGG - Intergenic
1023243491 7:38175905-38175927 ACCAATTAGCACTCTGTGTCTGG - Intergenic
1023472726 7:40542139-40542161 GTTATTTAGCACTATGTGTCAGG + Intronic
1023530365 7:41147180-41147202 AGTATTTAGCCTTTTGTGTCTGG - Intergenic
1024601275 7:50983672-50983694 GCCACTTAGCACTTTGTGTTGGG + Intergenic
1025970867 7:66324144-66324166 AACATTTGTCCTTTTGTGTCTGG - Intronic
1027140781 7:75655635-75655657 AATATTTATCCCTTTGTGTCTGG - Intronic
1028961002 7:96749813-96749835 AACAATTTGCACTGTGTGCCTGG - Intergenic
1030282712 7:107793485-107793507 AATACATGGCACTTTGTGTCTGG - Intronic
1030904641 7:115167660-115167682 AATATTTTGCACTCTTTGTCTGG + Intergenic
1030977973 7:116150893-116150915 AATGTTTAGCACTTTGATTCCGG - Intronic
1031839857 7:126724943-126724965 AACAAATAGTACTTTGTGTCAGG + Intronic
1032008616 7:128325675-128325697 CTTATTTAGCACTTTGTGTTAGG - Intronic
1032060429 7:128719568-128719590 AACATATAGTCTTTTGTGTCTGG + Intronic
1033160077 7:138987784-138987806 AGTATGTAGCACTTTGTGTCTGG + Intergenic
1033401622 7:141031147-141031169 AGCATGTAGTCCTTTGTGTCTGG - Intergenic
1035576270 8:708540-708562 AACATATGACCCTTTGTGTCTGG - Intronic
1035994758 8:4533116-4533138 AACATATGGCATTTTGTGACTGG + Intronic
1036951104 8:13140148-13140170 AACAGTTGCCCCTTTGTGTCTGG + Intronic
1037250851 8:16892144-16892166 AATATTTAACACTTTTTTTCTGG - Intergenic
1037402981 8:18512129-18512151 AATATTTGTCCCTTTGTGTCTGG - Intergenic
1038009975 8:23467695-23467717 TACAATTGGAACTTTGTGTCTGG - Intergenic
1038697959 8:29822903-29822925 AATATTTTCCCCTTTGTGTCTGG - Intergenic
1038858815 8:31362926-31362948 AACATTTGGCAGTGTATGTCTGG + Intergenic
1038970690 8:32630943-32630965 AAATTGTAGCATTTTGTGTCTGG + Intronic
1039192201 8:34988798-34988820 AACATTTAGACCATAGTGTCTGG + Intergenic
1039263429 8:35798261-35798283 ATCATTTTGCACTTGATGTCAGG + Intergenic
1041476180 8:58269085-58269107 AACATTTACAAATTTGTGTTGGG + Intergenic
1041849901 8:62378928-62378950 AACAGTTTGCACCTTGTGCCTGG + Intronic
1042262084 8:66870187-66870209 AACATATGGCCTTTTGTGTCTGG + Intergenic
1042460312 8:69058157-69058179 AATATTTAGCACTTTGTGCCAGG + Intergenic
1042835323 8:73074725-73074747 AACTTTTAGCCCCTTGTATCTGG + Intronic
1043300600 8:78726252-78726274 AACATTTAGTGCTTTCTGTTAGG + Intronic
1043620931 8:82191859-82191881 ACCAATCAGCACTCTGTGTCTGG - Intergenic
1044010150 8:86984467-86984489 AACATCTTGCACTGTGTGTCTGG + Intronic
1044705387 8:95003601-95003623 ACCCTTCAACACTTTGTGTCTGG + Intronic
1044788974 8:95826237-95826259 AACATTTGACTCTTTATGTCTGG + Intergenic
1044851481 8:96432882-96432904 AACAGCTTGCACTGTGTGTCTGG + Intergenic
1045185767 8:99836517-99836539 AATATTCATCATTTTGTGTCTGG + Intronic
1045187426 8:99853292-99853314 AACTTTCAGTACATTGTGTCTGG - Intronic
1045207464 8:100056930-100056952 AACAGTTTGCACTGTGTGCCCGG + Intronic
1045999335 8:108400635-108400657 AACATTTATTTCTTTGTGTTGGG + Intronic
1046745089 8:117868029-117868051 AAAGTTAAGGACTTTGTGTCTGG - Intronic
1047072016 8:121355799-121355821 GACATTTGACTCTTTGTGTCTGG + Intergenic
1047915604 8:129580790-129580812 AACATGTACTATTTTGTGTCTGG - Intergenic
1048127632 8:131654982-131655004 AACATGTGACACTTTGTGTCTGG - Intergenic
1050787132 9:9417789-9417811 AATTTTTAAGACTTTGTGTCAGG + Intronic
1051872164 9:21750598-21750620 AACATTTTTCACATTATGTCTGG - Intergenic
1052212549 9:25923381-25923403 AACGTTTATGAATTTGTGTCGGG - Intergenic
1052515659 9:29476225-29476247 ATCATTGAGCACTGTTTGTCAGG + Intergenic
1052568871 9:30194921-30194943 AATATGTGGCATTTTGTGTCTGG + Intergenic
1052576664 9:30299783-30299805 ATCAATCAGCACTCTGTGTCTGG + Intergenic
1052633260 9:31068213-31068235 AACAGTAAGCAATGTGTGTCTGG - Intergenic
1052783220 9:32802264-32802286 AACATTTAGAAGTTAGTGACAGG - Intergenic
1053231455 9:36413477-36413499 AAAATGTAGCCTTTTGTGTCTGG - Intronic
1053503039 9:38617776-38617798 AACATTTTGCACTATCTCTCAGG - Intergenic
1054730336 9:68695947-68695969 AACATGTAGCCTTTTGTGTCTGG + Intergenic
1055901079 9:81238977-81238999 CACACCTAGCACATTGTGTCAGG + Intergenic
1057153088 9:92812169-92812191 AACATTTTGCACTATCTCTCAGG + Intergenic
1059315163 9:113418318-113418340 AACATTTGTCCTTTTGTGTCTGG + Intronic
1059391161 9:114000438-114000460 AAAATTTATGACTTTGTGTTGGG - Intronic
1059730380 9:117051279-117051301 AATATTTAGCACAATGTATCCGG - Intronic
1060049547 9:120367950-120367972 AACATGTGGCCTTTTGTGTCTGG - Intergenic
1060100459 9:120836095-120836117 AACATTTATCCTTTTGTGTCTGG + Intronic
1060914717 9:127380670-127380692 AACATGTGGCCTTTTGTGTCTGG - Intronic
1186931062 X:14390831-14390853 AACATGTGGCCTTTTGTGTCTGG - Intergenic
1187396319 X:18922601-18922623 AACATTTATCATTTTGTGACTGG - Intronic
1187503596 X:19860359-19860381 AATATTTATCCTTTTGTGTCTGG - Intronic
1188573030 X:31612226-31612248 AATATTTTTCATTTTGTGTCTGG + Intronic
1190017771 X:46842723-46842745 AATATTTAGCCTTTTGTGACTGG + Intronic
1190020162 X:46867007-46867029 AACATGTAGCCTTTTGGGTCTGG + Intronic
1190085392 X:47391154-47391176 AATATATATGACTTTGTGTCAGG + Intronic
1190366527 X:49699722-49699744 AATATGTAGCCTTTTGTGTCTGG + Intergenic
1190401628 X:50042005-50042027 AATATGTGACACTTTGTGTCTGG - Intronic
1191188616 X:57640460-57640482 AACAGTTTGCACTGTGTGCCTGG + Intergenic
1192240774 X:69325862-69325884 CACATGTGGCATTTTGTGTCTGG + Intergenic
1192307615 X:69979154-69979176 AATATTTGTCCCTTTGTGTCTGG + Intronic
1193450669 X:81660973-81660995 AACATTTAACACTTTGTTGCTGG + Intergenic
1193747743 X:85302811-85302833 AACATATAGTCTTTTGTGTCTGG - Intronic
1193910011 X:87292721-87292743 AAAATTTGCCACTTTGTTTCAGG - Intergenic
1194856898 X:98941697-98941719 AACATTTGTCCTTTTGTGTCTGG - Intergenic
1195270749 X:103228006-103228028 AACATGTGACATTTTGTGTCTGG - Intergenic
1195935851 X:110125174-110125196 AGCATTTACTACTTTGTATCAGG - Intronic
1196062798 X:111429630-111429652 AATATGTGGCATTTTGTGTCTGG - Intergenic
1196411180 X:115420832-115420854 AATATGTAGCCTTTTGTGTCTGG - Intergenic
1196489633 X:116250688-116250710 ACCAATCAGCACTCTGTGTCTGG + Intergenic
1196692943 X:118580250-118580272 AGCATTCAGCACTGTGTTTCTGG + Intronic
1196800164 X:119535650-119535672 AACATTTAACTTTTTGTGACTGG - Intergenic
1197307184 X:124857480-124857502 AATATTTGTCAATTTGTGTCTGG - Intronic
1198621484 X:138516627-138516649 AACATGTGACCCTTTGTGTCTGG - Intergenic
1198897413 X:141470997-141471019 AACATGTATTACTCTGTGTCTGG - Intergenic
1199763268 X:150922019-150922041 AATATTTGGCCTTTTGTGTCCGG + Intergenic
1199795154 X:151188164-151188186 AATATGTAGCATTTTGTGTCTGG + Intergenic
1202342724 Y:23886769-23886791 ACCAATCAGCACTCTGTGTCAGG - Intergenic
1202528045 Y:25783316-25783338 ACCAATCAGCACTCTGTGTCAGG + Intergenic