ID: 1149423693

View in Genome Browser
Species Human (GRCh38)
Location 17:56534573-56534595
Sequence CTGTTAAAATGTTGGAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149423693_1149423700 14 Left 1149423693 17:56534573-56534595 CCTCCTTTCCAACATTTTAACAG No data
Right 1149423700 17:56534610-56534632 CCCTGTCTTTGGAGGGAAAATGG No data
1149423693_1149423698 7 Left 1149423693 17:56534573-56534595 CCTCCTTTCCAACATTTTAACAG No data
Right 1149423698 17:56534603-56534625 TTGTTTTCCCTGTCTTTGGAGGG No data
1149423693_1149423697 6 Left 1149423693 17:56534573-56534595 CCTCCTTTCCAACATTTTAACAG No data
Right 1149423697 17:56534602-56534624 CTTGTTTTCCCTGTCTTTGGAGG No data
1149423693_1149423696 3 Left 1149423693 17:56534573-56534595 CCTCCTTTCCAACATTTTAACAG No data
Right 1149423696 17:56534599-56534621 GCTCTTGTTTTCCCTGTCTTTGG No data
1149423693_1149423703 16 Left 1149423693 17:56534573-56534595 CCTCCTTTCCAACATTTTAACAG No data
Right 1149423703 17:56534612-56534634 CTGTCTTTGGAGGGAAAATGGGG No data
1149423693_1149423702 15 Left 1149423693 17:56534573-56534595 CCTCCTTTCCAACATTTTAACAG No data
Right 1149423702 17:56534611-56534633 CCTGTCTTTGGAGGGAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149423693 Original CRISPR CTGTTAAAATGTTGGAAAGG AGG (reversed) Intergenic
No off target data available for this crispr