ID: 1149430449

View in Genome Browser
Species Human (GRCh38)
Location 17:56593135-56593157
Sequence GTGCTTGAGGTGGGGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149430449_1149430457 0 Left 1149430449 17:56593135-56593157 CCCTCCAGCCCCACCTCAAGCAC No data
Right 1149430457 17:56593158-56593180 CGCCCCCCCTCCCCAAACACCGG No data
1149430449_1149430468 20 Left 1149430449 17:56593135-56593157 CCCTCCAGCCCCACCTCAAGCAC No data
Right 1149430468 17:56593178-56593200 CGGCTCTGCACCCTCCAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149430449 Original CRISPR GTGCTTGAGGTGGGGCTGGA GGG (reversed) Intergenic
No off target data available for this crispr