ID: 1149430724

View in Genome Browser
Species Human (GRCh38)
Location 17:56594122-56594144
Sequence CTCCCCCGTCTCTCCGGAGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 125}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149430724_1149430735 16 Left 1149430724 17:56594122-56594144 CCGCCTCCGGAGAGACGGGGGAG 0: 1
1: 0
2: 1
3: 8
4: 125
Right 1149430735 17:56594161-56594183 GCTCGGCGTGCTCTCCTCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 61
1149430724_1149430737 23 Left 1149430724 17:56594122-56594144 CCGCCTCCGGAGAGACGGGGGAG 0: 1
1: 0
2: 1
3: 8
4: 125
Right 1149430737 17:56594168-56594190 GTGCTCTCCTCCGGGGACGCGGG 0: 1
1: 0
2: 0
3: 6
4: 101
1149430724_1149430736 22 Left 1149430724 17:56594122-56594144 CCGCCTCCGGAGAGACGGGGGAG 0: 1
1: 0
2: 1
3: 8
4: 125
Right 1149430736 17:56594167-56594189 CGTGCTCTCCTCCGGGGACGCGG 0: 1
1: 0
2: 0
3: 5
4: 93
1149430724_1149430730 -6 Left 1149430724 17:56594122-56594144 CCGCCTCCGGAGAGACGGGGGAG 0: 1
1: 0
2: 1
3: 8
4: 125
Right 1149430730 17:56594139-56594161 GGGGAGCGCGGCGGCGCCGCGGG 0: 1
1: 0
2: 2
3: 83
4: 635
1149430724_1149430734 15 Left 1149430724 17:56594122-56594144 CCGCCTCCGGAGAGACGGGGGAG 0: 1
1: 0
2: 1
3: 8
4: 125
Right 1149430734 17:56594160-56594182 GGCTCGGCGTGCTCTCCTCCGGG 0: 1
1: 0
2: 1
3: 3
4: 120
1149430724_1149430733 14 Left 1149430724 17:56594122-56594144 CCGCCTCCGGAGAGACGGGGGAG 0: 1
1: 0
2: 1
3: 8
4: 125
Right 1149430733 17:56594159-56594181 GGGCTCGGCGTGCTCTCCTCCGG 0: 1
1: 0
2: 0
3: 10
4: 106
1149430724_1149430731 -1 Left 1149430724 17:56594122-56594144 CCGCCTCCGGAGAGACGGGGGAG 0: 1
1: 0
2: 1
3: 8
4: 125
Right 1149430731 17:56594144-56594166 GCGCGGCGGCGCCGCGGGCTCGG 0: 1
1: 0
2: 8
3: 74
4: 530
1149430724_1149430729 -7 Left 1149430724 17:56594122-56594144 CCGCCTCCGGAGAGACGGGGGAG 0: 1
1: 0
2: 1
3: 8
4: 125
Right 1149430729 17:56594138-56594160 GGGGGAGCGCGGCGGCGCCGCGG 0: 1
1: 0
2: 5
3: 84
4: 742

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149430724 Original CRISPR CTCCCCCGTCTCTCCGGAGG CGG (reversed) Exonic
900514309 1:3073975-3073997 CTCCCGCGTCTCTCGGGGCGCGG - Intronic
900527122 1:3134878-3134900 CTCGCCGGGCTCTCAGGAGGTGG - Intronic
901577028 1:10209955-10209977 TTCCGCCTTCTCTCCCGAGGTGG + Intergenic
901631002 1:10648114-10648136 CTCCTCCCTCTGTCCGGAAGTGG + Exonic
902383767 1:16065025-16065047 CTCCACCCTCTCTCCCCAGGAGG + Intronic
902896740 1:19485032-19485054 TTCCCCCGTCTCTCCGGCCCAGG - Intronic
903131561 1:21282768-21282790 CTCTCCCTTCTCTCCGCAGATGG - Intronic
904391179 1:30187208-30187230 CCTCCCTGTCTCTCCGCAGGTGG - Intergenic
910759036 1:90717716-90717738 CTCCCCCGCGGCTCCCGAGGTGG + Intergenic
917865498 1:179190578-179190600 CCCCCACGTCTCTGTGGAGGGGG - Intronic
920546760 1:206824659-206824681 CACCCCCATTTCTCCGGATGAGG + Intronic
1065240135 10:23695781-23695803 CGCTCCAGACTCTCCGGAGGCGG + Intronic
1069684609 10:70309675-70309697 TTCCCCAGTTTCTCCAGAGGAGG + Intronic
1071278361 10:84076964-84076986 GTCCCCCGTTCCTCAGGAGGGGG + Intergenic
1074427281 10:113362637-113362659 CTCCCCAGTCCCTGCGAAGGTGG - Intergenic
1076156909 10:128211341-128211363 TCGCCCGGTCTCTCCGGAGGTGG + Intergenic
1076750450 10:132539494-132539516 CTCCCTGGTCTCTCCAGAGATGG - Intronic
1077052773 11:575300-575322 CTTCCCCGTCTCTCCGGCGTCGG + Intergenic
1080662176 11:34305636-34305658 CTCTCCTGTCTCTCTGAAGGTGG - Intronic
1082961513 11:58922551-58922573 GTCCCCAGTCTCACCGGAGAGGG - Intronic
1083617858 11:64035495-64035517 CTCCCCCGCCTCCACGGTGGAGG + Intronic
1083938585 11:65883125-65883147 CTCCCCCATCTCACCTGAAGGGG - Exonic
1084179121 11:67437788-67437810 CTCCCCAGTCTCTCTGGAGGAGG + Exonic
1084425392 11:69081381-69081403 CTCCCGTGTCTCTCCCCAGGAGG + Exonic
1088579189 11:111299534-111299556 CTGCCCCGGCTCGCGGGAGGTGG - Exonic
1090831397 11:130423207-130423229 CTTCCCCATCTCCCAGGAGGTGG - Intronic
1091140705 11:133232009-133232031 CTCCCTCGTCCTTCCTGAGGAGG - Intronic
1095968073 12:47882824-47882846 CTCCCCAGTCTCTAAGGAAGTGG + Intronic
1100921059 12:99487195-99487217 CTCCCCCTTCTCCTAGGAGGTGG + Intronic
1105892534 13:24691755-24691777 CTCCTCAGTCTCTCCTGTGGGGG + Intronic
1106144308 13:27037924-27037946 CTCTCCCTTCTCTTCGGAGATGG - Intergenic
1106708996 13:32311475-32311497 CGTCCCCATCTCTCCGCAGGCGG + Exonic
1106786019 13:33108735-33108757 CTCCTCCCTCCCTCCAGAGGAGG - Intronic
1110513449 13:76381114-76381136 TTCCCCAGTCTGTCCAGAGGAGG - Intergenic
1110860575 13:80341252-80341274 CGCCCTCGCCTTTCCGGAGGAGG + Intergenic
1115961454 14:38838557-38838579 CTCCACAGTCTCTCCACAGGGGG + Intergenic
1117365299 14:55021491-55021513 CTCCACCTTCTCTCAGGAGGTGG - Intronic
1119003954 14:70907728-70907750 CTCACCCGGAGCTCCGGAGGTGG + Exonic
1122854676 14:104554401-104554423 GTCCCCCCTCACTGCGGAGGGGG - Intronic
1124516342 15:30370086-30370108 GACCCCCATCTCTCCAGAGGTGG - Intronic
1124726576 15:32160645-32160667 GACCCCCATCTCTCCAGAGGTGG + Intronic
1127488429 15:59440028-59440050 CTCCACCGTCTCACCAGAGTAGG + Intronic
1129159195 15:73737806-73737828 CCCCAGCGTCTGTCCGGAGGGGG - Exonic
1129301992 15:74630773-74630795 CTCCCTCTTCTCTCCCCAGGGGG - Exonic
1129412056 15:75355630-75355652 GTCCCCAGTCTCTCCTGTGGGGG + Exonic
1129711331 15:77821643-77821665 CTCCCCCTGCTGTCCGGAGCTGG + Intergenic
1129776838 15:78242287-78242309 ATCCCCGGTCTCTCCACAGGAGG - Intronic
1133282594 16:4675700-4675722 TTCCCCTGTCTCTCAGGCGGGGG - Intronic
1134290884 16:12902210-12902232 CTCGCTGGCCTCTCCGGAGGCGG - Exonic
1136229012 16:28876247-28876269 CTCCCCCGGCTTCCCAGAGGGGG - Intergenic
1138393970 16:56690405-56690427 CTCCTCCGCCTCCCCTGAGGAGG + Intronic
1140034356 16:71361115-71361137 CTCCCCCTTCACCCCGGAGCAGG - Intronic
1140904156 16:79396171-79396193 CTCACCTGTGTCTCAGGAGGAGG - Intergenic
1141108108 16:81250105-81250127 CCTCCCCGTCACTCCTGAGGAGG + Intronic
1141642392 16:85348877-85348899 CTCCCCCATCTCTCGGGGGCTGG - Intergenic
1143548515 17:7614603-7614625 CCCCGGCGTCTCCCCGGAGGAGG + Exonic
1144723915 17:17491786-17491808 CTCCCCTGCCTCTGGGGAGGGGG + Exonic
1145209963 17:21005436-21005458 CTCCCCCATCTCACCAGGGGAGG - Intronic
1147384094 17:40071629-40071651 CTCCCTCGCCTCTGCAGAGGAGG + Intronic
1148798935 17:50211019-50211041 CTCCCCCTTTTCTGCGGACGTGG - Intergenic
1149430724 17:56594122-56594144 CTCCCCCGTCTCTCCGGAGGCGG - Exonic
1151817208 17:76477193-76477215 CTCCCCTGTCTCCCCCGATGGGG - Exonic
1152084779 17:78211416-78211438 CTCCCCTGTCTCTGGGAAGGGGG - Intergenic
1154354503 18:13614875-13614897 CACACCCGTCTCTGCTGAGGAGG + Intronic
1163469768 19:17489344-17489366 CTCCCCCGTCTCTAGGGGTGGGG + Intronic
1164574285 19:29396628-29396650 CTCCCCTGTCCCTGGGGAGGAGG - Intergenic
1165472115 19:36009756-36009778 CTCTGCCGTCCCTCGGGAGGGGG + Intronic
1166930264 19:46297834-46297856 CTCCCCTGTCTCTCAGGATGGGG - Intronic
1168277090 19:55284368-55284390 TCGCCCCGTCTCTCCGGTGGGGG - Exonic
929966752 2:46542618-46542640 CTCCCGCGGCGCCCCGGAGGAGG - Intronic
931379925 2:61743176-61743198 CTGCCCCGTCGCTCAGGAGATGG + Intergenic
931870101 2:66446995-66447017 TTCCCCCGCTTCTTCGGAGGAGG - Intronic
933800357 2:85955481-85955503 CTCCTCCTCCTCTCTGGAGGTGG + Intergenic
934686520 2:96325622-96325644 CTCACCCGCCTATCCGTAGGAGG - Intronic
934763322 2:96868041-96868063 CTTCCCCTTCTCTTTGGAGGTGG + Intronic
935232234 2:101109070-101109092 CTCCCCCGCTTCTCTGCAGGTGG - Intronic
937646612 2:124272484-124272506 CTCCCCCACCTCTTCAGAGGAGG + Intronic
947665727 2:231904326-231904348 CTCCCCAGCCTCGGCGGAGGAGG + Intergenic
947912584 2:233811223-233811245 CTTCCCTGTCTCTCCGTGGGAGG + Intronic
948786490 2:240355497-240355519 CTCACTCTTCTCTCCGGAGAGGG + Intergenic
1170787674 20:19481733-19481755 CTCCCCGGGCTCTCTGTAGGTGG - Intronic
1173523584 20:43716207-43716229 CTCCCCAGACTCTCAGGTGGAGG + Exonic
1175068891 20:56315366-56315388 CTCCCCAGTCTCTGGGGAGCTGG - Intergenic
1176549275 21:8214456-8214478 CTCCTCCTCCTCCCCGGAGGGGG + Intergenic
1176557168 21:8258679-8258701 CTCCTCCTCCTCCCCGGAGGGGG + Intergenic
1176568207 21:8397494-8397516 CTCCTCCTCCTCCCCGGAGGGGG + Intergenic
1176576110 21:8441714-8441736 CTCCTCCTCCTCCCCGGAGGGGG + Intergenic
1179712044 21:43269010-43269032 CTGCCCCATCTCTCCGGGTGAGG + Intergenic
1180172504 21:46067105-46067127 CGCCCCTGTCTCTGTGGAGGTGG + Intergenic
1182101103 22:27658163-27658185 CTCCAGGGTCTCTCCAGAGGAGG - Intergenic
1184566105 22:45293113-45293135 CTCACCCTTCTCCCAGGAGGCGG - Intronic
1185134541 22:49062273-49062295 CTCCCCTGGCTCTGCCGAGGTGG + Intergenic
1185265889 22:49903833-49903855 CTCCCCCGGCCGTCCTGAGGGGG - Exonic
1203254160 22_KI270733v1_random:130772-130794 CTCCTCCTCCTCCCCGGAGGGGG + Intergenic
1203262216 22_KI270733v1_random:175851-175873 CTCCTCCTCCTCCCCGGAGGGGG + Intergenic
949504547 3:4714610-4714632 CTCTCCAGCCTCTCCTGAGGTGG + Intronic
962808353 3:138942482-138942504 CTTCTCCGTCTCACTGGAGGTGG + Intergenic
968228037 3:196988221-196988243 CTCCTCCGTCTTTCTGCAGGGGG + Intergenic
968728312 4:2258427-2258449 CTCCCCCATCCCTCTGGAAGGGG - Intronic
978384649 4:108167745-108167767 ATGCCCCAACTCTCCGGAGGAGG - Exonic
981911536 4:149987100-149987122 CTCTCCTGTCCCTCCGGAGCAGG + Intergenic
985995347 5:3594583-3594605 CGGCCCCGTCTCTGCGTAGGAGG + Intergenic
987282876 5:16428089-16428111 CTCCCCAGTCTCTCCAGCTGTGG - Intergenic
989957069 5:50371006-50371028 CACCCCCGACTCTTCGGAGTTGG + Intergenic
990836746 5:60029896-60029918 TTCCCCCGTCTCTGAGGATGGGG - Intronic
991969584 5:72126173-72126195 CTTCCTGGTCTCTCCGGAGGGGG - Intronic
999770794 5:154774151-154774173 CTCCTCCGTCCCTTTGGAGGAGG + Intronic
1006174518 6:32113997-32114019 ATCCACCGTATCTCTGGAGGGGG - Intronic
1006906932 6:37539006-37539028 CTCCCACTTCTCTCCGGAGCAGG - Intergenic
1007117919 6:39356884-39356906 CTCCCCTGTGTCTCAGTAGGCGG + Intronic
1014936523 6:127391815-127391837 CTACCCCTTCTCTCTGGAGGAGG + Intergenic
1015776873 6:136823101-136823123 CTCCCCCGGCTCTCCCTACGGGG - Intronic
1019447059 7:1076766-1076788 CTCCCCCGGCTTTCCCGAGAAGG - Intronic
1021958774 7:25852511-25852533 CCCCGCCGCCTCGCCGGAGGCGG + Intergenic
1029611864 7:101630806-101630828 CCCCCCCGCCTGCCCGGAGGAGG + Intergenic
1031024244 7:116662977-116662999 CTCCACCCTCTCTCCAGAGTGGG + Intergenic
1032419344 7:131765306-131765328 CTCCCCACTCTCTCCTGGGGAGG - Intergenic
1037682095 8:21106094-21106116 CACCCCTGTCTATCTGGAGGTGG - Intergenic
1037711718 8:21360490-21360512 CTCCCCAGTCTCTCCTGAAGAGG - Intergenic
1037886314 8:22598266-22598288 CTGCCCCCTCCCTCTGGAGGAGG + Intronic
1046819636 8:118621448-118621470 CTGCCCCCTCCCTCCGGAGCAGG - Intronic
1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG + Exonic
1048208059 8:132431405-132431427 GTCCCCCGACTCTGAGGAGGTGG - Intronic
1049762125 8:144336484-144336506 CTCCCCCGCCTGTCCAGGGGCGG - Intergenic
1051057052 9:13000239-13000261 CTTCCACATCTCTCCGGAAGAGG + Intergenic
1053153470 9:35757216-35757238 CTCCCCTCTCCCTCCGGCGGCGG - Exonic
1055401201 9:75926029-75926051 CTCCCCCATCTCACCTGAGCAGG + Intronic
1060838693 9:126777690-126777712 CTCCCCCAGCTCCCAGGAGGGGG - Intergenic
1060978390 9:127778783-127778805 CTCCCCACCCTCTCCGCAGGGGG + Intergenic
1061033403 9:128100324-128100346 CGCCCCCGCCTCCCAGGAGGTGG - Intronic
1061575426 9:131503176-131503198 CGTCCCCGTCTTTCCGGAGCTGG + Intronic
1203470561 Un_GL000220v1:113916-113938 CTCCTCCTCCTCCCCGGAGGGGG + Intergenic
1203478382 Un_GL000220v1:157888-157910 CTCCTCCTCCTCCCCGGAGGGGG + Intergenic
1186026662 X:5320693-5320715 CTGCCCCGTCTCAGTGGAGGGGG + Intergenic
1195310658 X:103629210-103629232 CTCCCCCGTCCCCCGGGAGGGGG + Intronic