ID: 1149431197

View in Genome Browser
Species Human (GRCh38)
Location 17:56596414-56596436
Sequence CGGGCACTTTCTCCCCTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149431189_1149431197 20 Left 1149431189 17:56596371-56596393 CCACCTCTGGCATCTGCTTTTGG No data
Right 1149431197 17:56596414-56596436 CGGGCACTTTCTCCCCTTGAGGG No data
1149431192_1149431197 17 Left 1149431192 17:56596374-56596396 CCTCTGGCATCTGCTTTTGGGAA No data
Right 1149431197 17:56596414-56596436 CGGGCACTTTCTCCCCTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149431197 Original CRISPR CGGGCACTTTCTCCCCTTGA GGG Intergenic
No off target data available for this crispr