ID: 1149440056

View in Genome Browser
Species Human (GRCh38)
Location 17:56666334-56666356
Sequence ACTCCATGTGTTTCTCATTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149440056_1149440060 8 Left 1149440056 17:56666334-56666356 CCCCAATGAGAAACACATGGAGT No data
Right 1149440060 17:56666365-56666387 AGTGTCCTCTGCTGCAAAGTGGG No data
1149440056_1149440065 29 Left 1149440056 17:56666334-56666356 CCCCAATGAGAAACACATGGAGT No data
Right 1149440065 17:56666386-56666408 GGGAGGGTCAATAATTTTCAAGG No data
1149440056_1149440066 30 Left 1149440056 17:56666334-56666356 CCCCAATGAGAAACACATGGAGT No data
Right 1149440066 17:56666387-56666409 GGAGGGTCAATAATTTTCAAGGG No data
1149440056_1149440059 7 Left 1149440056 17:56666334-56666356 CCCCAATGAGAAACACATGGAGT No data
Right 1149440059 17:56666364-56666386 TAGTGTCCTCTGCTGCAAAGTGG No data
1149440056_1149440064 13 Left 1149440056 17:56666334-56666356 CCCCAATGAGAAACACATGGAGT No data
Right 1149440064 17:56666370-56666392 CCTCTGCTGCAAAGTGGGGAGGG No data
1149440056_1149440061 9 Left 1149440056 17:56666334-56666356 CCCCAATGAGAAACACATGGAGT No data
Right 1149440061 17:56666366-56666388 GTGTCCTCTGCTGCAAAGTGGGG No data
1149440056_1149440062 12 Left 1149440056 17:56666334-56666356 CCCCAATGAGAAACACATGGAGT No data
Right 1149440062 17:56666369-56666391 TCCTCTGCTGCAAAGTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149440056 Original CRISPR ACTCCATGTGTTTCTCATTG GGG (reversed) Intergenic
No off target data available for this crispr