ID: 1149444721

View in Genome Browser
Species Human (GRCh38)
Location 17:56704825-56704847
Sequence CTGTGGGCCTTGAAAGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149444714_1149444721 12 Left 1149444714 17:56704790-56704812 CCTTTAAACCACGACGTCATAAG No data
Right 1149444721 17:56704825-56704847 CTGTGGGCCTTGAAAGAGAAAGG No data
1149444716_1149444721 4 Left 1149444716 17:56704798-56704820 CCACGACGTCATAAGAATGGCGG No data
Right 1149444721 17:56704825-56704847 CTGTGGGCCTTGAAAGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149444721 Original CRISPR CTGTGGGCCTTGAAAGAGAA AGG Intergenic
No off target data available for this crispr