ID: 1149445913

View in Genome Browser
Species Human (GRCh38)
Location 17:56713349-56713371
Sequence CTATTAACTCATATGTAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149445910_1149445913 -6 Left 1149445910 17:56713332-56713354 CCATACTTTTCTGTACCCTATTA No data
Right 1149445913 17:56713349-56713371 CTATTAACTCATATGTAAAATGG No data
1149445909_1149445913 1 Left 1149445909 17:56713325-56713347 CCTAGAACCATACTTTTCTGTAC No data
Right 1149445913 17:56713349-56713371 CTATTAACTCATATGTAAAATGG No data
1149445908_1149445913 13 Left 1149445908 17:56713313-56713335 CCTTGTGTGATTCCTAGAACCAT No data
Right 1149445913 17:56713349-56713371 CTATTAACTCATATGTAAAATGG No data
1149445907_1149445913 14 Left 1149445907 17:56713312-56713334 CCCTTGTGTGATTCCTAGAACCA No data
Right 1149445913 17:56713349-56713371 CTATTAACTCATATGTAAAATGG No data
1149445905_1149445913 24 Left 1149445905 17:56713302-56713324 CCCTGGCAAACCCTTGTGTGATT No data
Right 1149445913 17:56713349-56713371 CTATTAACTCATATGTAAAATGG No data
1149445906_1149445913 23 Left 1149445906 17:56713303-56713325 CCTGGCAAACCCTTGTGTGATTC No data
Right 1149445913 17:56713349-56713371 CTATTAACTCATATGTAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149445913 Original CRISPR CTATTAACTCATATGTAAAA TGG Intergenic
No off target data available for this crispr