ID: 1149446357

View in Genome Browser
Species Human (GRCh38)
Location 17:56716261-56716283
Sequence GAACCCAGTGTTCAGTTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149446357_1149446358 -10 Left 1149446357 17:56716261-56716283 CCAAGAAACTGAACACTGGGTTC No data
Right 1149446358 17:56716274-56716296 CACTGGGTTCCATCCACCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149446357 Original CRISPR GAACCCAGTGTTCAGTTTCT TGG (reversed) Intergenic
No off target data available for this crispr