ID: 1149447367

View in Genome Browser
Species Human (GRCh38)
Location 17:56724063-56724085
Sequence CTGTAAAGTCACATGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1149447365_1149447367 -3 Left 1149447365 17:56724043-56724065 CCACTCACAGTTGGGGGGCACTG No data
Right 1149447367 17:56724063-56724085 CTGTAAAGTCACATGGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1149447367 Original CRISPR CTGTAAAGTCACATGGAAAA AGG Intergenic
No off target data available for this crispr